PmiRExAt expression matrix was developed by downloading plant small RNA public datasets (comprising in total 4.2 billion+ sequence reads, occupying more than 3.7 Terabytes disk space ) and multi-step computational analysis accelerated by using in-house HPC facility.
PmiRExAt users can do desired data-mining in this rich processed resource.


1859 NR wheat miRNA IDsmiRNA_sequencedatabase name
tae-miR1127UCCUUCCGUUCGGAAUUACPMRD
tae-miR1131UAGUACCGGUUCGUGGCUAACCPMRD
tae-miR164UGGAGAAGCAGGGCACGUGCAPMRD
tae-miR5084AUACAGUACUGCAGAGGAUCCUAAPMRD
tae-miR1138GCUUAGAUGUGACAUCCUUAAAAPMRD
tae-miR444aUUGCUGCCUCAAGCUUGCUGCmiRBase.V20
tae-miR395bUGAAGUGUUUGGGGGAACUCmiRBase.V20
tae-miR156UGACAGAAGAGAGUGAGCACAmiRBase.V20
tae-miR1118CACUACAUUAUGGAAUGGAGGGAPMRD
tae-miR160UGCCUGGCUCCCUGUAUGCCAPMRD
tae-miR398UGUGUUCUCAGGUCGCCCCCGPMRD
tae-miR159aUUUGGAUUGAAGGGAGCUCUGPMRD
tae-miR171bCGAUUGAGCCGUGCCAAUAUCPMRD
tae-miR1139AGAGUAACAUACACUAGUAACAPMRD
tae-miR1130CCUCCGUCUCGUAAUGUAAGACGPMRD
tae-miR1120ACAUUCUUAUAUUAUGAGACGGAGPMRD
tae-miR395aGUGAAGUGUUUGGGGGAACUCmiRBase.V20
tae-miR399UGCCAAAGGAGAAUUGCCCPMRD
tae-miR171aUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
tae-miR1129CAGCGAGCCAGCGGAGACCGGCAGPMRD
tae-miR1133CAUAUACUCCCUCCGUCCGAAAPMRD
tae-miR408CUGCACUGCCUCUUCCCUGGCPMRD
tae-miR1125AACCAACGAGACCAACUGCGGCGGPMRD
tae-miR167aUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
tae-miR1128UACUACUCCCUCCGUCCGAAAPMRD
tae-miR1119UGGCACGGCGUGAUGCUGAGUCAGPMRD
tae-miR167bUGAAGCUGACAGCAUGAUCUAmiRBase.V20
tae-miR5086ACAUUGGUGGAAGGCGUGGUAmiRBase.V20
tae-miR1134CAACAACAACAAGAAGAAGAAGAUPMRD
tae-miR1123UCCGUGAGACCUGGUCUCAUAGAPMRD
tae-miR5085AAGGACAUUUUUUGUGGCCUGmiRBase.V20
tae-miR1135CUGCGACAAGUAAUUCCGAACGGAPMRD
tae-miR1121AGUAGUGAUCUAAACGCUCUUAPMRD
tae-miR1122UAGAUACAUCCGUAUCUAGAPMRD
tae-miR1124GCAGGACGUGAAGAGCGAGUCCPMRD
tae-miR319UUGGACUGAAGGGAGCUCCCUmiRBase.V20
tae-miR1117UAGUACCGGUUCGUGGCACGAACCPMRD
tae-miR169GGGCAAGUCACCCUGGGCUACCmiRBase.V20
tae-miR1137UAGUACAAAGUUGAGUCAUCPMRD
tae-miR1136UUGUCGCAGGUAUGGAUGUAUCUAPMRD
tae-miR1126UCCACUAUGGACUACAUACGGAGPMRD
tae-miR1132CAUUAUGGAACGGAAGGAGPMRD
tae-miR156aUGACAGAAGAGAGAGAGCACPMRD
tae-miR166CCGGACCAGGCUUCAUUCCCAPMRD
tae-miR171cUAAUUGAGCCGCGCCCAUAUCPMRD
tae-miR172aAGAAUCCUGAUGAUGCUGCAGPMRD
tae-miR172cAGGAUCUUGAUGAUGCUGCAGPMRD
tae-miR2001CGCUCGCCGGAGCAGCGUGCAPMRD
tae-miR2002UGAGAUGAGAUUACCCCAUACPMRD
tae-miR2003CGGUUGGGCUGUAUGAUGGCGAPMRD
tae-miR2004UUUGUUUUUAUGUUAUUUUGUGAAPMRD
tae-miR2005GGGUGUAUAGCUCAGUUGGPMRD
tae-miR2006UACCACGACUGUCAUUAAGCAPMRD
tae-miR2007CAAGAUAUUGGGUAUUUCUGUCPMRD
tae-miR2008GACUCCGUGGCCCAAUGGAPMRD
tae-miR2009aUGAGAAGGUAGAUCAUAAUAGCPMRD
tae-miR2009bUUAGAUGAGAAGGCAGAUCAUAPMRD
tae-miR2009cUCAGAUGAGAAGGCAGAUCAUAAUAPMRD
tae-miR2010UGUGCGCAAUAAGAUUUUGCUAPMRD
tae-miR2011UGCAGUGGCAUAUGCAACUCUPMRD
tae-miR2012UUGGACGAGGAUGUGCAACUGPMRD
tae-miR2013UUGAACGACCUCACCAUGUCGPMRD
tae-miR2014AGCAAACAUAUCUGAGCACAPMRD
tae-miR2015UGCAUCAUCUCGAACUCGUCGPMRD
tae-miR2016UGACCCUGAGGCACUCAUACCGPMRD
tae-miR2017CUUAUGCAACGUCUGAGGAUPMRD
tae-miR2018GCCCGUCUAGCUCAGUUGGUPMRD
tae-miR2019CGGGUCGGCGCUGCACGCGGCPMRD
tae-miR2020AUAGCAUCAUCCAUCCUACCAPMRD
tae-miR2021UUUUGUCACAUAUAAUACAUAPMRD
tae-miR2022UGGCCAAGGUCUCUUGAGGCUPMRD
tae-miR2023aUUUUGCCGGUUGAACGACCUCAPMRD
tae-miR2023bUUUUGCUGGUUGAACGACCUCAPMRD
tae-miR2023cUUUUGCCGGUUGAUCGACCUCAPMRD
tae-miR2024aGCAGUUGCUGUCUCAAGCUUPMRD
tae-miR2024bUGCAGUUGCUGCCUCAAGCUUPMRD
tae-miR2025GUGUUCUCAGGUCGCCCCCGCPMRD
tae-miR9677aUGGCCGUUGGUAGAGUAGGAGAmiRBase 21
tae-miR2027GUAUUAGGUUGGUCAAAUUGACGAPMRD
tae-miR2028UAGCUGUGCUUUCAGCAAGAAPMRD
tae-miR2029UUGAGUGCAGCGUUGAUGAACPMRD
tae-miR2030CAGGGCGGGGAACAGGUGGCCPMRD
tae-miR2031AUAAGCACCGGUGCUUAAGAAPMRD
tae-miR2032UGUAGAUACUCCCUAAGGCUUPMRD
tae-miR2033aUAUUUCUUUACAGAGGGAGUAPMRD
tae-miR2033bUAUUUCUUUACAGAAGGAGUAPMRD
tae-miR319aUUGGACUGAAGGGAGCUCCCPMRD
tae-miR319bUUGGAGUGAAGGGAGCUCCAPMRD
tmo-miR1120CUCUGUAAACUAAUAUAAGPMRD
tmo-miR1122UACUCCCUCCGUCCCAAAAUUGUUPMRD
ttu-miR160bUGCCUGGCUCCCUGUAUGCCUPMRD
tur-miR1122UACUCCUUUUGUCCUAAAAUUUGUPMRD
ata-miR169UAGCCAAGGAUGAAUUGCCAGTang, Z. et al. (2012)
ath-miR157aUUGACAGAAGAUAGAGAGCACTang, Z. et al. (2012)
ath-miR165aUCGGACCAGGCUUCAUCCCCCTang, Z. et al. (2012)
ath-miR167dUGAAGCUGCCAGCAUGAUCUGGTang, Z. et al. (2012)
ath-miR169aCAGCCAAGGAUGACUUGCCGATang, Z. et al. (2012)
ath-miR169bCAGCCAAGGAUGACUUGCCGGTang, Z. et al. (2012)
ath-miR171aUGAUUGAGCCGCGCCAAUAUCTang, Z. et al. (2012)
ath-miR172aAGAAUCUUGAUGAUGCUGCAUTang, Z. et al. (2012)
ath-miR172eGGAAUCUUGAUGAUGCUGCAUTang, Z. et al. (2012)
ath-miR394aUUGGCAUUCUGUCCACCUCCTang, Z. et al. (2012)
ath-miR396aUUCCACAGCUUUCUUGAACUGTang, Z. et al. (2012)
ath-miR399bUGCCAAAGGAGAGUUGCCCUGTang, Z. et al. (2012)
bdi-miR319b-3pUUGGACUGAAGGGUGCUCCCUTang, Z. et al. (2012)
cpa-miR160dUGCCUGGCUCCCUGAAUGCCATang, Z. et al. (2012)
cpa-miR167cUGAAGCUGCCAGCAUGAUCUUTang, Z. et al. (2012)
cpa-miR167dUGAAGCUGCCAGCAUGAUCUGATang, Z. et al. (2012)
crt-miR166bUCGGACCAGGCUUCAUUCCCUUTang, Z. et al. (2012)
csi-miR166aUCGGACCAGGCUUCAUUCCCCCTang, Z. et al. (2012)
gma-miR167cUGAAGCUGCCAGCAUGAUCUGTang, Z. et al. (2012)
gma-miR172fAGAAUCUUGAUGAUGCUGCATang, Z. et al. (2012)
gma-miR408dUGCACUGCCUCUUCCCUGGCTang, Z. et al. (2012)
mtr-miR166bUCGGACCAGGCUUCAUUCCUATang, Z. et al. (2012)
mtr-miR166cUCGGACCAGGCUUCAUUCCUCTang, Z. et al. (2012)
osa-miR1432-5pAUCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
osa-miR1436ACAUUAUGGGACGGAGGGAGUTang, Z. et al. (2012)
osa-miR160a-3pGCGUGCAAGGAGCCAAGCAUGTang, Z. et al. (2012)
osa-miR164dUGGAGAAGCAGGGCACGUGCUTang, Z. et al. (2012)
osa-miR166a-5pGGAAUGUUGUCUGGUUCAAGGTang, Z. et al. (2012)
osa-miR166b-5pGGAAUGUUGUCUGGCUCGGGGTang, Z. et al. (2012)
osa-miR166e-3pUCGAACCAGGCUUCAUUCCCCTang, Z. et al. (2012)
osa-miR166k-3pUCGGACCAGGCUUCAAUCCCUTang, Z. et al. (2012)
osa-miR166mUCGGACCAGGCUUCAUUCCCUTang, Z. et al. (2012)
osa-miR168a-5pUCGCUUGGUGCAGAUCGGGACTang, Z. et al. (2012)
osa-miR169eUAGCCAAGGAUGACUUGCCGGTang, Z. et al. (2012)
osa-miR2275aUUUGGUUUCCUCCAAUAUCUCATang, Z. et al. (2012)
osa-miR396c-3pGGUCAAGAAAGCUGUGGGAAGTang, Z. et al. (2012)
osa-miR396e-3pAUGGUUCAAGAAAGCCCAUGGAAATang, Z. et al. (2012)
osa-miR396e-5pUCCACAGGCUUUCUUGAACUGTang, Z. et al. (2012)
osa-miR444UGUUGUCUCAAGCUUGCUGCCTang, Z. et al. (2012)
osa-miR444bUGCAGUUGUUGUCUCAAGCUUTang, Z. et al. (2012)
osa-miR528-5pUGGAAGGGGCAUGCAGAGGAGTang, Z. et al. (2012)
osa-miR827UUAGAUGACCAUCAGCAAACATang, Z. et al. (2012)
ppt-miR156aUGACAGAAGAGAGUGAGCACTang, Z. et al. (2012)
ppt-miR390aAAGCUCAGGAGGGAUAGCGCCTang, Z. et al. (2012)
pta-miR166aUCGGACCAGGCUUCAUUCCCCTang, Z. et al. (2012)
pta-miR396UUCCACAGCUUUCUUGAACUUTang, Z. et al. (2012)
ptc-miR166nUCGGACCAGGCUUCAUUCCUUTang, Z. et al. (2012)
ptc-miR166pUCGGACCAGGCUCCAUUCCUUTang, Z. et al. (2012)
sbi-miR1432CUCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
sbi-miR156eUGACAGAAGAGAGCGAGCACTang, Z. et al. (2012)
sbi-miR166kUCGGACCAGGCUUCAUUCCUTang, Z. et al. (2012)
smo-miR156aCGACAGAAGAGAGUGAGCACTang, Z. et al. (2012)
sof-miR168bUCGCUUGGGCAGAUCGGGACTang, Z. et al. (2012)
vvi-miR156eUGACAGAGGAGAGUGAGCACTang, Z. et al. (2012)
vvi-miR167cUGAAGCUGCCAGCAUGAUCUCTang, Z. et al. (2012)
zma-miR156l-3pGCUCACUGCUCUAUCUGUCACCTang, Z. et al. (2012)
zma-miR160a-3pGCGUGCAAGGGGCCAAGCAUGTang, Z. et al. (2012)
zma-miR166g-5pGGAAUGUUGUCUGGUUGGAGATang, Z. et al. (2012)
zma-miR2118eUUCCUGAUGUCUCCCAUUCCUATang, Z. et al. (2012)
zma-miR2275b-3pUUCAGUUUCCUCUAAUAUCUCATang, Z. et al. (2012)
zma-miR390a-3pCGCUAUCUAUCCUGAGCUCCATang, Z. et al. (2012)
zma-miR396b-3pGUUCAAUAAAGCUGUGGGAAATang, Z. et al. (2012)
osa-miR1318UCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
tae_1AAACUAAUAUAUGAGCGUUUARitu Pandey et al. (2014)
tae_2AAUUCGGGACGGAGGGAGUAARitu Pandey et al. (2014)
tae_3UUUCUGCGACGAGUAAUUCGGRitu Pandey et al. (2014)
tae_4ACUUCCUCCGUUCGGAAUUACRitu Pandey et al. (2014)
tae_5AGACAAGUAAUUUCGAACGGARitu Pandey et al. (2014)
tae_6AGCGAUCUGCCGAAGCUGUURitu Pandey et al. (2014)
tae_7AGGCCCACUGGGCAGCGCCCCRitu Pandey et al. (2014)
tae_8AGUAAUUUUGGACGGAGGGAGRitu Pandey et al. (2014)
tae_9AUAAGCACCGGUGCUUAAGGARitu Pandey et al. (2014)
tae_10AUUAGUACUGGUUCGUGGCACRitu Pandey et al. (2014)
tae_11AUUUCUGGACGGAGGGAGUAARitu Pandey et al. (2014)
tae_12CAUCUAUUUUGGAACGGAGGGRitu Pandey et al. (2014)
tae_13CCCUGGCAGAUAGCGCGAUCARitu Pandey et al. (2014)
tae_14CGCGCUGCCCUGUGAGCUUGCRitu Pandey et al. (2014)
tae_15CGGUAGGGCUGUAUGAUGGCGARitu Pandey et al. (2014)
tae_16UUUGACCAAGUUUGUAGAGAARitu Pandey et al. (2014)
tae_18CUGACAUACGGGCGUGUGGGCRitu Pandey et al. (2014)
tae_19GGGCGUUCGCGCGGGCCGACCRitu Pandey et al. (2014)
tae_20GGUGAACGCGCCGCCGUCAAACRitu Pandey et al. (2014)
tae_22GUGCGCGGUCUGUUUUGGUCAGRitu Pandey et al. (2014)
tae_23UAAUGUAAGACGCUUUUUGACRitu Pandey et al. (2014)
tae_26UAUGGAUGAAGAUAUGCACUGRitu Pandey et al. (2014)
tae_27UCCCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_29UCUGUAAACUAACAUAAGAGCRitu Pandey et al. (2014)
tae_30UCUGUAAACUAAUGUAAGAGCRitu Pandey et al. (2014)
tae_31UCUGUGACAAGUAAUUCCGAARitu Pandey et al. (2014)
tae_32UCUUACAUUAUGGGACGGAGURitu Pandey et al. (2014)
tae_33UGAACGUGUGCUGAACGCGGARitu Pandey et al. (2014)
tae_34UGACAAAUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_35UGACAACUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_36UGACAAGUACUUUCGGACGGARitu Pandey et al. (2014)
tae_37UGACAAGUAUUCUCGGACGGARitu Pandey et al. (2014)
tae_38UGACAAGUAUUUCGGACGGARitu Pandey et al. (2014)
tae_39UGACAAGUAUUUUCGAACGGARitu Pandey et al. (2014)
tae_40UGAUAAGUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_42UGGCGAGGGACAUACACUGURitu Pandey et al. (2014)
tae_43UUCCGAAAAGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_44UUCCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_45UUCCGAAAGGCUUGAAGCGAAURitu Pandey et al. (2014)
tae_46UUCGAUCGUAAUCGGAUGGUCRitu Pandey et al. (2014)
tae_47UUCUGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_48UUGUCUUAGAUUCGUCUAGAUARitu Pandey et al. (2014)
tae_49UUUCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae-miR3001aAAAATTCAACTCGTTTGGACASun,F. et al. (2014)
tae-miR3002aAAATCCGGTTTATTTTTCTASun,F. et al. (2014)
tae-miR3003aAAATGAACAAAAGGGGATGTASun,F. et al. (2014)
tae-miR3004bAAATTTCAGATCATTTGGACASun,F. et al. (2014)
tae-miR3005aAACAATTGATATGGATCGGAGSun,F. et al. (2014)
tae-miR3006aAACCAAAGCTGGCATACCTTTSun,F. et al. (2014)
tae-miR3007aAACTATTTCGGTACAGAGGGASun,F. et al. (2014)
tae-miR3008aAACTGTGAACTCGCGGGGATGSun,F. et al. (2014)
tae-miR3009aTGGTCTGTGTTTGTTTCAAACSun,F. et al. (2014)
tae-miR3010aAAGCGTAGTCGAACGAATCTGSun,F. et al. (2014)
tae-miR3010bAAGCGTAGTCGAACGAATCTSun,F. et al. (2014)
tae-miR3011aAATGCCATGTTGTTCTGAAGASun,F. et al. (2014)
tae-miR3012aAATTAATTTGGATTGGAGGGASun,F. et al. (2014)
tae-miR3013aTGTTGCATGACAAGTTGAGCASun,F. et al. (2014)
tae-miR3014bAATTTCGAACGGAGGGAGTAGSun,F. et al. (2014)
tae-miR3015aACAAGTAATTCGGAATGAAGGSun,F. et al. (2014)
tae-miR3016aACACTTATGTTGGGACGGAGGSun,F. et al. (2014)
tae-miR3017aACATCTGAGCAGCTCTCGGCASun,F. et al. (2014)
tae-miR3017bAGCATCTGAGAAGCTCTCGGCASun,F. et al. (2014)
tae-miR3017cAGCATCTGAGCAGCTCTCGGCASun,F. et al. (2014)
tae-miR3018aACCTGCAGTTGGGCCAATGACSun,F. et al. (2014)
tae-miR3019aACCTTCAGGAAGGACTGCATCSun,F. et al. (2014)
tae-miR3020aTCGACAAGTATTTCCAGACGGSun,F. et al. (2014)
tae-miR3021aACGACACAAGCAGCAACTCTCSun,F. et al. (2014)
tae-miR3022aACGGCATAGAGGCACTGCAAASun,F. et al. (2014)
tae-miR3023aACGGCGCGTCCGCGGTCGGAASun,F. et al. (2014)
tae-miR3024aAGAACAGCGGGGAGGTGCTACSun,F. et al. (2014)
tae-miR3025aAGAAGAGGGTCAAGAAAGCTGTSun,F. et al. (2014)
tae-miR3026aAGACCCACAGGGCAGTGTGCCSun,F. et al. (2014)
tae-miR3026bAGACCCACAGGGCAGTGCGCCSun,F. et al. (2014)
tae-miR3027aAGACGAGGGTGATCATAAACTSun,F. et al. (2014)
tae-miR3028aAGAGCAGCTCAGATGTCCAAASun,F. et al. (2014)
tae-miR3029aAGAGCGCACCGCCGTCGAGGGSun,F. et al. (2014)
tae-miR3030aAGAGGCTAACCATGAAAGCGGSun,F. et al. (2014)
tae-miR3031aAGAGGGCAGGCCTGGCGCAGSun,F. et al. (2014)
tae-miR3032aTTAAGAACAGCAGGGCATTTTSun,F. et al. (2014)
tae-miR3033aAGATTGATTAACGAAGATGGCSun,F. et al. (2014)
tae-miR3034aAGCATGTGTTCAGAAGATTAGGSun,F. et al. (2014)
tae-miR3035aAGGACTAGGGTTCCTACCGGCSun,F. et al. (2014)
tae-miR3036aAGGCCCACAGGACAGCGCCCCSun,F. et al. (2014)
tae-miR3037aAGGCCCACAGGGTAGCGTGCASun,F. et al. (2014)
tae-miR3038aTTACTCGTCGCGGAAATGGATSun,F. et al. (2014)
tae-miR3039aAGGTGGAATACTTGAAGAAGASun,F. et al. (2014)
tae-miR3039bAGGTGGAATACCTGAAGAAGASun,F. et al. (2014)
tae-miR3040aAGTAAATCGGAACAGAGGGAGSun,F. et al. (2014)
tae-miR3041aAGTAGAATGAACGACCAGGCTSun,F. et al. (2014)
tae-miR3042aAGTTGAAGATGAGATATTGAASun,F. et al. (2014)
tae-miR3043aATAAAACCTTCAGCTATCCATCSun,F. et al. (2014)
tae-miR3044aATCATGCGATCCTTTTGGAAGSun,F. et al. (2014)
tae-miR3045aATCTAAGACAAGTAATTCGGGSun,F. et al. (2014)
tae-miR3046aATCTGGACAAATCTAAGACAASun,F. et al. (2014)
tae-miR3047aATGACGAGTAAATCAGAACGGSun,F. et al. (2014)
tae-miR3048aATGGATGACACGTGGCATTTASun,F. et al. (2014)
tae-miR3049aATGTAGAAGCACCAGGGTAAGSun,F. et al. (2014)
tae-miR3050aATTACTTGTCGCAGAAGTGGASun,F. et al. (2014)
tae-miR3051aATTGCCATCCTTTAGTCTGCASun,F. et al. (2014)
tae-miR3052aATTGTTCAGTGTTTCGAAGGASun,F. et al. (2014)
tae-miR3053aTTCGCCGGCTGCGCGTTCCCCSun,F. et al. (2014)
tae-miR3054aCAAGGGAAGGAAGTAGCCAACSun,F. et al. (2014)
tae-miR3055bCATCTGAGAAGCTCTCGGCAASun,F. et al. (2014)
tae-miR3056aCCAGGAGAAGTACGTGGCGTGSun,F. et al. (2014)
tae-miR3057aCGAATGTATTTTTTATGGCTTGSun,F. et al. (2014)
tae-miR3058aCGAGTAATATGGAACGGAGGGSun,F. et al. (2014)
tae-miR3059aCGATCCGAATTAATTGACGCASun,F. et al. (2014)
tae-miR3060aCGATTGGTGCTCGTCGGTGACSun,F. et al. (2014)
tae-miR3061aCGGTAGGACTGTTTGATGGCGASun,F. et al. (2014)
tae-miR3061bCGGTATGACTGTATGATGGCGASun,F. et al. (2014)
tae-miR3062aTTCTTCAAGTACTCCACTTTTSun,F. et al. (2014)
tae-miR3063aCGGTTGGCTGTATGATGGCGASun,F. et al. (2014)
tae-miR3064aCTCCGTTCCAAAATAGACGACSun,F. et al. (2014)
tae-miR3064bCTCCGTTCCAGAATAGATGACSun,F. et al. (2014)
tae-miR3064cCTCCGTTCCAAAATAGATTACSun,F. et al. (2014)
tae-miR3065aTTCGCCGGAGCAGCGTGCAGASun,F. et al. (2014)
tae-miR3066aCTTGTTTGTCATTAAGCTTCSun,F. et al. (2014)
tae-miR3066bCTTGTTTGTCATTAAGCTTCTGSun,F. et al. (2014)
tae-miR3067aGAAACGTTGGGTGGTTGTGGCSun,F. et al. (2014)
tae-miR3068aGAAGTACACTTATTCGCGGACSun,F. et al. (2014)
tae-miR3069aTTGAACATCCCAGAGCCACCGSun,F. et al. (2014)
tae-miR3070aGCCTGCAAAAATTCGTCGTGASun,F. et al. (2014)
tae-miR3071aGCGAAGGATTTGCAGATACTCSun,F. et al. (2014)
tae-miR3072aGCGGCGTCGTCGAACTCGCCCSun,F. et al. (2014)
tae-miR3134aTTGAATTTGTCCATAGCATCASun,F. et al. (2014)
tae-miR3073aGCGTGCACGGATCCAAGCATASun,F. et al. (2014)
tae-miR3074aTTGAGACGAACACAGACCAACSun,F. et al. (2014)
tae-miR3075aGGCAAGTCCGTCCTTGGCTACASun,F. et al. (2014)
tae-miR3076aGGCGATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-miR3077aTTGAGCACACCTGAGTCCAGTSun,F. et al. (2014)
tae-miR3078bGGTGAGCGCGCCGCCGTCGAASun,F. et al. (2014)
tae-miR3079aGTAGGATGGCTGGTGCTATGGSun,F. et al. (2014)
tae-miR3080aTTGATGACACGTGCAACATGASun,F. et al. (2014)
tae-miR3081aTAAAGCGTAGTCGAACGAATCSun,F. et al. (2014)
tae-miR3082aTAAGAAGCAAATAGCACATGSun,F. et al. (2014)
tae-miR3082bTAAGAAGCAAAGAGCACATGSun,F. et al. (2014)
tae-miR3083bTAAGACAAGTATTTCCGGACGSun,F. et al. (2014)
tae-miR3084aTAATCTTCTGGATATATGCTTASun,F. et al. (2014)
tae-miR3084bTAATCTTCTGGATACATGCTTASun,F. et al. (2014)
tae-miR3085aTAATGCTGTCAGAGTTGGAACSun,F. et al. (2014)
tae-miR3086aTACGGCCTGATGACATCCACASun,F. et al. (2014)
tae-miR3086bTACGGCCTGATGACATCCACGSun,F. et al. (2014)
tae-miR3087aTACTGTGGGCACTTATTTGACASun,F. et al. (2014)
tae-miR3088aTACTGTTCAGTGCTCACGGTTSun,F. et al. (2014)
tae-miR3089aTAGAATGGCTGGTGCTATGGASun,F. et al. (2014)
tae-miR3090aTAGAGCTCCTCGGATGTCATASun,F. et al. (2014)
tae-miR3091aTAGCTCTCAGGCGCTGCACTAGTSun,F. et al. (2014)
tae-miR3092aTATCTGGACAAATCTGAGACASun,F. et al. (2014)
tae-miR3093aTATGATGGCGATACCGATTGGSun,F. et al. (2014)
tae-miR3094aTATTAGTTGTCGCTGAAACGGSun,F. et al. (2014)
tae-miR3095aTTTTTAATGGCAACTTTAGTSun,F. et al. (2014)
tae-miR3096aTCAGGAAGGACCGCATCATCTSun,F. et al. (2014)
tae-miR3097aTCAGGACGTTGCAACATTAACSun,F. et al. (2014)
tae-miR3098aTCATCTGGCATTGCTTTCTCTSun,F. et al. (2014)
tae-miR3099aTCATGAATTTTTGTACGCATGSun,F. et al. (2014)
tae-miR3100aTCATTTGGAACTCGCCGGTGCSun,F. et al. (2014)
tae-miR3101aTCGCAAATAATGGTGGCTCTCSun,F. et al. (2014)
tae-miR3102aTCGGCTACTTCCTTTCCCTTGCSun,F. et al. (2014)
tae-miR3103aTCGGGACATTCTATGTGCATGSun,F. et al. (2014)
tae-miR3104aTCTCCTCGATGACCATGCTGASun,F. et al. (2014)
tae-miR3105aTCTGATTTACTCGTCGTGGTTSun,F. et al. (2014)
tae-miR3106aTCTGCAAAGTTTGAAGTTCATSun,F. et al. (2014)
tae-miR3107aTCTGGAATTAGTTGACGCTCASun,F. et al. (2014)
tae-miR3108bTCTGTAACTAAATATAAGACGSun,F. et al. (2014)
tae-miR3109aTCTGTCCCTGAATATAAGACGSun,F. et al. (2014)
tae-miR3110aTCTGTTCACAAATGTAAGACGSun,F. et al. (2014)
tae-miR3111aTCTGTTCACTTTTATAAGACGSun,F. et al. (2014)
tae-miR3112aTTTTTGGTGACATGCATGAACSun,F. et al. (2014)
tae-miR3113aTGAAACACTGTGTGAGAGAAGSun,F. et al. (2014)
tae-miR3114aTGAACATCCCAGAGCCACCGGSun,F. et al. (2014)
tae-miR3115aTTTTTTGATCCTTAGGATGGCSun,F. et al. (2014)
tae-miR3116aTGAACTCAGGTGTGCTCAACTSun,F. et al. (2014)
tae-miR3117bTGAGAAAGGACTGCATCATCTSun,F. et al. (2014)
tae-miR3117aTGAAGAAGGACTGCATCATCTSun,F. et al. (2014)
tae-miR3118aTTTGTCTAGATACGGATATATSun,F. et al. (2014)
tae-miR3119aTGAAGTAGAGCAGGGACCTCASun,F. et al. (2014)
tae-miR3119bTGAAGTAGAGCAGAGACCTCASun,F. et al. (2014)
tae-miR3120aTGAATCTTGGGAAAAAGCTGCATSun,F. et al. (2014)
tae-miR3121aTGAATTTGTCCATAGCATCATSun,F. et al. (2014)
tae-miR3121bTGAATTTTTCCATAGCATCAGSun,F. et al. (2014)
tae-miR3121cTTAATTTGTCCATAGCATCCGSun,F. et al. (2014)
tae-miR3122aTGACATGTGGCATTCACAAATCASun,F. et al. (2014)
tae-miR3122bTGACATGTGGCATTCACAAATSun,F. et al. (2014)
tae-miR3123aTGAGACGAGATCTCCCCATACSun,F. et al. (2014)
tae-miR3124bTGAGCATCAACTAATTCCGGASun,F. et al. (2014)
tae-miR3125aTGCAGTCCTCGATGTCGTAGSun,F. et al. (2014)
tae-miR3125bTTGCAGTCCTCGATGTCGTAGSun,F. et al. (2014)
tae-miR3126aTGCGCCCTGCAGTACGTCAGASun,F. et al. (2014)
tae-miR3127aTTTTTTTGCCATATTTTCCACSun,F. et al. (2014)
tae-miR3128aTGGACATCCGAGCAGCTCTCASun,F. et al. (2014)
tae-miR3129aTGGACGAGGATGTGCAGCTGCSun,F. et al. (2014)
tae-miR3130aTGGATGTCATCGTGGCCGTACASun,F. et al. (2014)
tae-miR3131aTGGCATTGAGGGAGTCAAGCASun,F. et al. (2014)
tae-miR3132aTGGGCAAGTCACCCTGGCTACCSun,F. et al. (2014)
tae-miR3133bTTTTGATGACATGCATGGACASun,F. et al. (2014)
tae-lmiR4001aAAAGATTCTGGGAGAAGCTGGGTASun,F. et al. (2014)
tae-lmiR4001bAAAGATTCTGGAAGAAGCTGGGTASun,F. et al. (2014)
tae-lmiR4002aAAAGACGGTCTTAGAAAATGCATTSun,F. et al. (2014)
tae-lmiR4003aAAAGTTAACCTCGAAAAACGCATTSun,F. et al. (2014)
tae-lmiR4004aAGATAAGCTAGTAATAATGTCATASun,F. et al. (2014)
tae-lmiR4004bAGATAAGGTAGTAATAATGTCATASun,F. et al. (2014)
tae-lmiR4005bAAATTACTCGTCGTAGAAATGGATSun,F. et al. (2014)
tae-lmiR4006aAACATAGAGTAGTAACATGGGCATSun,F. et al. (2014)
tae-lmiR4006bAACATAGACTAGTAACATGGGCATSun,F. et al. (2014)
tae-lmiR4007bAACCACTAGTGCAGCGCCTGAGAGSun,F. et al. (2014)
tae-lmiR4007cAACCACTAGTGCAGCGTCTGAGAGSun,F. et al. (2014)
tae-lmiR4008aAACCTAGAACTACGCGAATGACTTSun,F. et al. (2014)
tae-lmiR4009aAACGACCTAGGTACACATGCAAGASun,F. et al. (2014)
tae-lmiR4010aAAGACTTAGATGTGCAATACTTATSun,F. et al. (2014)
tae-lmiR4010bAGGACTTAGATGTGCAATACTTAGSun,F. et al. (2014)
tae-lmiR4011aAAGCCCAGTCGGCCTGCAGTTGGCSun,F. et al. (2014)
tae-lmiR4012aTAGGACAAGTATTTTCGGACGGAGSun,F. et al. (2014)
tae-lmiR4012eTCGGACAAGTATTTCCGGACGGAGSun,F. et al. (2014)
tae-lmiR4013aGAGGCCTTTAGTACCGGTTGGTGGSun,F. et al. (2014)
tae-lmiR4014aAAGTACTTTGATCATCATAGGCTTSun,F. et al. (2014)
tae-lmiR4015bAATATGCGGACTAAATAAAAACGGSun,F. et al. (2014)
tae-lmiR4016aAATCATGTATGTGATCTATGGGACSun,F. et al. (2014)
tae-lmiR4017aAATGGACAAAAAGGGGTGTATCTASun,F. et al. (2014)
tae-lmiR4018aAATTGGCAACCTAGATATACGCGTSun,F. et al. (2014)
tae-lmiR4019aAATTTAACCAACGAGACTGACTGCSun,F. et al. (2014)
tae-lmiR4020aACCCGGCAGTTGGGTAAAGTCACASun,F. et al. (2014)
tae-lmiR4021aACCGGAAAGAAGCAAACCACACGGSun,F. et al. (2014)
tae-lmiR4022aACGAGGCTCCTCTGACGTACTGCASun,F. et al. (2014)
tae-lmiR4023aACGGCGCAAAATGAGTGAATCTACSun,F. et al. (2014)
tae-lmiR4024aACGTCTCTCCTGTAGAAATAGGCASun,F. et al. (2014)
tae-lmiR4025aACTCGGCTCCCCTGACGTACTGCASun,F. et al. (2014)
tae-lmiR4026bACTGATAGGATGGGTCATTTTGGTSun,F. et al. (2014)
tae-lmiR4027aACTGTGCCTTCTAAACTGTGACGGSun,F. et al. (2014)
tae-lmiR4028aAGAAAAGTCTGGTTTATTTCTCTASun,F. et al. (2014)
tae-lmiR4029bAGAAGTACACTTATTCATGGACGGSun,F. et al. (2014)
tae-lmiR4029cAGATGTACACTTATTCATGGACGGSun,F. et al. (2014)
tae-lmiR4029dAGAAGTACACTTATTCACGGACGGSun,F. et al. (2014)
tae-lmiR4029eAGAAGTACACTTATTCGCGGACGGSun,F. et al. (2014)
tae-lmiR4029fAGATGTACACTTATTCACGGACGGSun,F. et al. (2014)
tae-lmiR4030aAGACAAAAGCTAGAAGTACACTTASun,F. et al. (2014)
tae-lmiR4031bAGAGAAAACTGTCTACATCTACAASun,F. et al. (2014)
tae-lmiR4032aAGAGAAAAGTAGGTACATCTAGAASun,F. et al. (2014)
tae-lmiR4033aAGAGCTAGGCGCTGCACTGTATAGSun,F. et al. (2014)
tae-lmiR4034aAGATAAGATAGTAATAATGTCAGTSun,F. et al. (2014)
tae-lmiR4034bAGATAAGGTAGTAATAATGTTAGTSun,F. et al. (2014)
tae-lmiR4034cAGATAAGGTAGTAATAATGTCAGTSun,F. et al. (2014)
tae-lmiR4035aAGATAAGGTAGTAATAATGGCATASun,F. et al. (2014)
tae-lmiR4036aAGATGACACGTGGCATTCACAAATSun,F. et al. (2014)
tae-lmiR4037aTTGGAATCAGACGCACGGATGGCTSun,F. et al. (2014)
tae-lmiR4038aAGATGTACACTCTTCACCGGACGGSun,F. et al. (2014)
tae-lmiR4039aAGATTAATAGTACATGACATGCATSun,F. et al. (2014)
tae-lmiR4040aAGCAACCAGGGCAATTCTTCTGAGSun,F. et al. (2014)
tae-lmiR4041aAGCAAGGCGCTGCACTCTACTGTGSun,F. et al. (2014)
tae-lmiR4042aAGCACCATACGGTACTGCAGAGGASun,F. et al. (2014)
tae-lmiR4043aAGCACCGGTGCTTATTTGTACAAGSun,F. et al. (2014)
tae-lmiR4044aAGCACTACCACCGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4044cAGCGCTACCGCCGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4045aAGCGCTACCGCCGCTGGCCGGACASun,F. et al. (2014)
tae-lmiR4046aAGCGCTACCGACGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4047aAGCGTCTCTCCTGTAGAAATAGGCSun,F. et al. (2014)
tae-lmiR4048aAGGAAGTGGTGTAGACTGCACGGASun,F. et al. (2014)
tae-lmiR4049aAGGACGTGTGGGCATATTTGCTTCSun,F. et al. (2014)
tae-lmiR4050aAGGACTTGTAAACTAAGACGGAGGSun,F. et al. (2014)
tae-lmiR4050bAGGACTTGTAAACTGAGACGGAGGSun,F. et al. (2014)
tae-lmiR4050cAGGACTTGTAAACTGAGATGGAGGSun,F. et al. (2014)
tae-lmiR4051aAGGACTTGTAAACTGAAACAGAGGSun,F. et al. (2014)
tae-lmiR4052aAGGATCCTCTGCAGTACTGTACGGSun,F. et al. (2014)
tae-lmiR4053aAGGCATATTTTAGAGTGTAGATTCSun,F. et al. (2014)
tae-lmiR4054aAGGCCTGAAGCTAAGCAACGTGCASun,F. et al. (2014)
tae-lmiR4055aAGTGGCAATTCTGGAAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4055cAGTGACAATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4056aAGTGGCAATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4057aAGTTTGACTTTCGGCAAAACCAATSun,F. et al. (2014)
tae-lmiR4058aTTAAGACAAGAATTTTGAGACGGASun,F. et al. (2014)
tae-lmiR4059aATACGCGGACTAAATAAAAACGGASun,F. et al. (2014)
tae-lmiR4060cATATGCAGACTAAAAAGAAATGGASun,F. et al. (2014)
tae-lmiR4061aATATGCGGAGTAAAAAGAAACGGASun,F. et al. (2014)
tae-lmiR4062bATCAAAATGGATAAAAGAAGATGTSun,F. et al. (2014)
tae-lmiR4063aGTTTTGGATTTGTCTAGATACGGASun,F. et al. (2014)
tae-lmiR4064aATGAAGATAGTAACTTAGACTAGTSun,F. et al. (2014)
tae-lmiR4065aATGATGTTAACTTGTATTTGATGTSun,F. et al. (2014)
tae-lmiR4066aATGGTATGTGTCACTGTAAAGGTTSun,F. et al. (2014)
tae-lmiR4067aATGTAGCTGCAGTAGATGCTCCGGSun,F. et al. (2014)
tae-lmiR4068aATTAACGATCTAGATACACGTGCASun,F. et al. (2014)
tae-lmiR4069aATTCTGCACCCTGGATGATGAATASun,F. et al. (2014)
tae-lmiR4070aATTGACGACCTAAGGATACGCGCASun,F. et al. (2014)
tae-lmiR4070bATTGACGATCTAGGGATACGCGCASun,F. et al. (2014)
tae-lmiR4071aCAAGACAAGTAATTCAGAACGGAGSun,F. et al. (2014)
tae-lmiR4071cTAAGACAAGTAATTCAGAACGGAGSun,F. et al. (2014)
tae-lmiR4072bCACGACGAGTAATTTGAAACGGAGSun,F. et al. (2014)
tae-lmiR4073aCACCAACCGGTACTAATGGGCATCSun,F. et al. (2014)
tae-lmiR4074aCACCATACGGTACTGCAGAGGATCSun,F. et al. (2014)
tae-lmiR4075aCAGCGACACTTATTTTGGGACGGASun,F. et al. (2014)
tae-lmiR4076aCAGCGCTACCGCCGCTGGCCGGACSun,F. et al. (2014)
tae-lmiR4077aCAGGCGCTGCACACTGACTTAGTASun,F. et al. (2014)
tae-lmiR4078aTATAGGAAATGAGATGACATGTATSun,F. et al. (2014)
tae-lmiR4079aCATATTCATTACCACCATATATACSun,F. et al. (2014)
tae-lmiR4080aCATCTCTCCTGTAGAAATAGGCACSun,F. et al. (2014)
tae-lmiR4081aTCTGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081bTCCGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081cCCCGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081dTCCGGACAGCTGTGGTAGTGTTATSun,F. et al. (2014)
tae-lmiR4081eTCCGGACAGCTATGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4082aCCGGATTTTTCTGAAGCACCGGTGSun,F. et al. (2014)
tae-lmiR4083aCCGTTCGGAATTACTTGTCGCGGASun,F. et al. (2014)
tae-lmiR4084aCCTCCGTCACGGTTTAGAAGGCGCSun,F. et al. (2014)
tae-lmiR4085aCGCGGACACGAGACGGACGCGCGCSun,F. et al. (2014)
tae-lmiR4086aCGGGTTTTTCTGAAGCACCGGTGCSun,F. et al. (2014)
tae-lmiR4086bCGGATTTTTCTGAAGCACCGGTGCSun,F. et al. (2014)
tae-lmiR4087aCGGTCTTGATAGTTAAATTTACGGSun,F. et al. (2014)
tae-lmiR4088aCTAATAAAATATTAATGCATGTCASun,F. et al. (2014)
tae-lmiR4089aCTAGAACTCATCTAGATGAGACATSun,F. et al. (2014)
tae-lmiR4090bCTCTGTTCACTTTTATAAGACGTTSun,F. et al. (2014)
tae-lmiR4091aGAAGATAGTAACTTAGACTAGTGTSun,F. et al. (2014)
tae-lmiR4092aGACAAGTAATTCGGAACGAAGGGASun,F. et al. (2014)
tae-lmiR4092bGACAAGTAATTCGGAACAGAGGGASun,F. et al. (2014)
tae-lmiR4093dGACAAGTATTTCTGAACGGAGGGASun,F. et al. (2014)
tae-lmiR4094aGACGACCTAGGGATACGCGCACGCSun,F. et al. (2014)
tae-lmiR4095aGACGAGCACTGCAATATAGACTAGSun,F. et al. (2014)
tae-lmiR4096aGACGAGTAATTTGGAACGGATGGASun,F. et al. (2014)
tae-lmiR4097aGACTTATAAGTTGGGTCTGTTTGGSun,F. et al. (2014)
tae-lmiR4098aGAGCATCTGAGCAGCTCTCGGCAASun,F. et al. (2014)
tae-lmiR4099aGAGGCTCCTCTGACGTACTGCAGGSun,F. et al. (2014)
tae-lmiR4100aGATAACACCCCTTAAGACCTTATTSun,F. et al. (2014)
tae-lmiR4101aGATGTACACTTATTCGCGGACGGASun,F. et al. (2014)
tae-lmiR4102aGCAGGACTTGTAAACTGAAACGGASun,F. et al. (2014)
tae-lmiR4102bGTAGGACTTGTAAACTGAGACGGASun,F. et al. (2014)
tae-lmiR4103aGCATATTAGGTTTGTCTGAAGTCASun,F. et al. (2014)
tae-lmiR4104aGCATGCACATAGAATGTCCGGATASun,F. et al. (2014)
tae-lmiR4105aGCGCTACATTGTGGAACGGAGGGASun,F. et al. (2014)
tae-lmiR4106aGGCTCGAACCGGGACAGAAGGCTGSun,F. et al. (2014)
tae-lmiR4107aGGGACGAACCAGGACCAATGGGCCSun,F. et al. (2014)
tae-lmiR4108aGGGGATAAAGAGGATGCTTACAGCSun,F. et al. (2014)
tae-lmiR4109aGGGTCCAGTCGGCCTGCAGTTGGCSun,F. et al. (2014)
tae-lmiR4110aGTAGGACAAGTATTTCCGGACGGASun,F. et al. (2014)
tae-lmiR4111aGTCTCTCCTGTAGAAATAGGCATCSun,F. et al. (2014)
tae-lmiR4112aGTCTTAGATTTGTGTAGATACGGASun,F. et al. (2014)
tae-lmiR4113aGTGAGACCCGCTCTGATGGATGACSun,F. et al. (2014)
tae-lmiR4114aGTTAAATTTATGATCAAAGTTGGASun,F. et al. (2014)
tae-lmiR4115aGTTCGGGCAGTTGCGGTAGTGCTGSun,F. et al. (2014)
tae-lmiR4116aGTTTACAGACGGCAAAGTGAGCTCSun,F. et al. (2014)
tae-lmiR4117aGTTTGATTGTTTAATAGTAGTGGASun,F. et al. (2014)
tae-lmiR4118aTAAGACTCTAGAGGGTGTTATCATSun,F. et al. (2014)
tae-lmiR4119aTAAGCATGTGTTCAGAAGATTAGGSun,F. et al. (2014)
tae-lmiR4120aTAAGGTCTTAAGGGGTGTTATCATSun,F. et al. (2014)
tae-lmiR4121aTAGAGGGCAGAGCAATCTTCAACTSun,F. et al. (2014)
tae-lmiR4122aTAGCTCTCAGGCGCTGCACTAGTGSun,F. et al. (2014)
tae-lmiR4123aTAGCTGTAGCGGTTTCCTAGCCCCSun,F. et al. (2014)
tae-lmiR4124aTAGGAACCAAACGGGAGGGACTTTSun,F. et al. (2014)
tae-lmiR4125aTCGGGCAGACTGCTGAGCAGTCGGSun,F. et al. (2014)
tae-lmiR4126aTCGTCATTCACGGTGTGCACGATCSun,F. et al. (2014)
tae-lmiR4127aTCTGCGACAAGTAATTCCAAACGGSun,F. et al. (2014)
tae-lmiR4128aTCTAGACAAATGTAAGACAAGAATSun,F. et al. (2014)
tae-lmiR4129aTCTCCTGTAGAAATAGGCACTGGTSun,F. et al. (2014)
tae-lmiR4130aTCTGCAACAAGTAATTCCGAACGGSun,F. et al. (2014)
tae-lmiR4130cTCTGAGACAAGTAATTCCGAACGGSun,F. et al. (2014)
tae-lmiR4131aTCTGGCCAACCGCGACTAAAGGACSun,F. et al. (2014)
tae-lmiR4132aTCTGTCCCAGAATATAAGAACGTTSun,F. et al. (2014)
tae-lmiR4133aTGAAGCACGTGGATAGAGGAAGCASun,F. et al. (2014)
tae-lmiR4134aTGACATGTGGCATTCACAAATCACSun,F. et al. (2014)
tae-lmiR4134cTGACACGTGGCATTCACAAATCATSun,F. et al. (2014)
tae-lmiR4135aTGAGACCCGCCCTGATGGATGACASun,F. et al. (2014)
tae-lmiR4136bTGATAGATGACACGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4136cTGATGGATGACATGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4136dTGATGGATAACACGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4137aTGGATGACATGTGGCATTCACAAASun,F. et al. (2014)
tae-lmiR4138aTGGCAACTATAGTGTAAACATCATSun,F. et al. (2014)
tae-lmiR4139aTGGCACGAAGTAGCTGCGCCCACASun,F. et al. (2014)
tae-lmiR4140aTGTGTCAGTGACTCAAAGGTAGGCSun,F. et al. (2014)
tae-lmiR4141aTTGAACTGTTTCCTCTGAAATTCCSun,F. et al. (2014)
tae-lmiR4142aTTGAATTTCCTCTATAAGCGCATTSun,F. et al. (2014)
aau-miR2086GACATGAATGCAGAACTGGAAMayer et al (2014)
ahy-miR159TTTGGATTGAAGGGAGCTCTAMayer et al (2014)
ahy-miR167-3pAGATCATGTGGCAGTTTCACCMayer et al (2014)
ahy-miR3513-5pTTAATTTCTGAGTTTGTCATCMayer et al (2014)
ahy-miR398TGTGTTCTCAGGTCACCCCTMayer et al (2014)
aly-miR156aQGCTCACTGCTCTTTCTGTCAGAMayer et al (2014)
aly-miR156bQGCTCACCTCTCTTTCTGTCAGTMayer et al (2014)
aly-miR156cQGCTCACTGCTCTATCTGTCAGAMayer et al (2014)
aly-miR156dQGCTCACTCTCTTTCTGTCATAMayer et al (2014)
aly-miR156eQGCTTACTCTCTCTCTGTCACCMayer et al (2014)
aly-miR156fQGCTCACTCTCTATCTGTCACCMayer et al (2014)
aly-miR156hQGCTCTCTTTCCTTCTGCCACCMayer et al (2014)
aly-miR157dQGCTCTCTATGCTTCTGTCATCMayer et al (2014)
aly-miR158aQCTTTGTCTACAATTTTGGAAAMayer et al (2014)
aly-miR158bQTTTGTCTACAATTTTGGAAAMayer et al (2014)
aly-miR159aQGAGCTCCTTGAAGTTCAAACGMayer et al (2014)
aly-miR159bTTTGGATTGAAGGGAGCTCTTMayer et al (2014)
aly-miR159bQGAGCTCCTTGAAGTTCAATGGMayer et al (2014)
aly-miR159cTTTGGATTGAAGGGAGCTCCTMayer et al (2014)
aly-miR160cQGCGTACAAGGAGCCAAGCATGMayer et al (2014)
aly-miR161_1QCCGGTTTAGTCACTTTCACMayer et al (2014)
aly-miR164aQCACGTACTCCCCTTCTCCAACMayer et al (2014)
aly-miR164cTGGAGAAGCAGGGCACGTGCGMayer et al (2014)
aly-miR165aTCGGACCAGGCTTCATCCCCMayer et al (2014)
aly-miR167cTAAGCTGCCAGCATGATCTTGMayer et al (2014)
aly-miR167cQAGGTCATGCTGGTAGTTTCACMayer et al (2014)
aly-miR167dQAGGTCATCCTGCAGCTTCAGTMayer et al (2014)
aly-miR168aTCGCTTGGTGCAGGTCGGGAAMayer et al (2014)
aly-miR169aQGGCAAGTTGTCCTTGGCTACAMayer et al (2014)
aly-miR169bQGGCAAGTTGTCCTTCGGCTACAMayer et al (2014)
aly-miR169dTGAGCCAAGGATGACTTGCCGMayer et al (2014)
aly-miR169hTAGCCAAGGATGACTTGCCTGMayer et al (2014)
aly-miR169hQGGCAGTCTCCTTGGCTATTMayer et al (2014)
aly-miR169jQGGCAGTCTCCTTGGCTATCMayer et al (2014)
aly-miR169mQGGCAGTCTTCTTGGCTATCMayer et al (2014)
aly-miR169nTAGCCAAAGATGACTTGCCTGMayer et al (2014)
aly-miR170TGATTGAGCCGTGTCAATATCMayer et al (2014)
aly-miR171cQAGATATTGGTGCGGTTCAATCMayer et al (2014)
aly-miR172aQGTGGCATCATCAAGATTCACAMayer et al (2014)
aly-miR172bQGCAGCACCATCAAGATTCACAMayer et al (2014)
aly-miR172cQGGAGCATCATCAAGATTCACAMayer et al (2014)
aly-miR172eGAATCTTGATGATGCTGCATMayer et al (2014)
aly-miR172eQGCAGCACCATTAAGATTCACMayer et al (2014)
aly-miR319aQAGAGCTTCCTTGAGTCCATTCMayer et al (2014)
aly-miR319cTTGGACTGAAGGGAGCTCCTTMayer et al (2014)
aly-miR3434TCAAAATCAGAGAATCAACCAMayer et al (2014)
aly-miR3437QCGGTGGATCTTGTTTTTTGTMayer et al (2014)
aly-miR3439QTTGGGGTTTCGAAATCAAGAGMayer et al (2014)
aly-miR3444TTGGGAGCTCGATGAGATCGAMayer et al (2014)
aly-miR3448TCTGAGGATTTTTTTTGTGGTCMayer et al (2014)
aly-miR390bQCGCTATCCATCCTGAGTTCCAMayer et al (2014)
aly-miR393aTCCAAAGGGATCGCATTGATCCMayer et al (2014)
aly-miR393bQATCATGCGATCTCTTTGGATTMayer et al (2014)
aly-miR395bCTGAAGTGTTTGGGGGGACTCMayer et al (2014)
aly-miR395cCTGAAGTGTTTGGGGGGACTTMayer et al (2014)
aly-miR395iCTGAAGTGTTTGGAGGAACTCMayer et al (2014)
aly-miR396aQGTTCAATAAAGCTGTGGGAAGMayer et al (2014)
aly-miR396bQGCTCAAGAAAGCTGTGGGAAAMayer et al (2014)
aly-miR398aTGTGTTCTCAGGTCACCCCTTMayer et al (2014)
aly-miR398bTGTGTTCTCAGGTCACCCCTGMayer et al (2014)
aly-miR398cQGGGTCGACATGAGAACATATGMayer et al (2014)
aly-miR399aTGCCAAAGGAGATTTGCCCGGMayer et al (2014)
aly-miR399bQGGGCGCCTCTCCATTGGCAGGMayer et al (2014)
aly-miR399dTGCCAAAGGAGATTTGCCCCGMayer et al (2014)
aly-miR399eTGCCAAAGGAGATTTGCCTCGMayer et al (2014)
aly-miR399fTGCCAAAGGAGATTTGCCCTGMayer et al (2014)
aly-miR399fQGGGCAAGATCACCATTGGCAGAMayer et al (2014)
aly-miR399gQGGGCAAATACTCCATTGGCAGAMayer et al (2014)
aly-miR408QCAGGGAACAAGCAGAGCATGGMayer et al (2014)
aly-miR4232TCACATTTATTAGGATGTGTGCMayer et al (2014)
aly-miR4233CACATCATCAACATCAACTCCMayer et al (2014)
aly-miR4245ACAAAGTTTTATACTGACAATMayer et al (2014)
aly-miR4248aACATTTTATTTTTGGCAATCAMayer et al (2014)
aly-miR771QGGGCTCCTCAGATGTTCATGMayer et al (2014)
aly-miR774bTGAGATGAAGATTTGGATGACMayer et al (2014)
aly-miR825TTCTCGAGAAGGTGCATGAACMayer et al (2014)
aly-miR827TTAGATGACCATCAACAAACGMayer et al (2014)
aly-miR828TCTTGCTTAAATGAGTATTCCAMayer et al (2014)
aly-miR829CAAATCAAATCTTCAAGGTACMayer et al (2014)
aly-miR829QACTTTGAATCTTTGATTTGAAMayer et al (2014)
aly-miR834TGGTAGCAGTAGCGGTGGTAAMayer et al (2014)
aly-miR837-5pCATTGTTTCTTGTTTTTTTCAMayer et al (2014)
aly-miR838TTTTCTTCTTCTTCTTGCACAMayer et al (2014)
aly-miR845aCGGCTCTGATACCAGTTGATGMayer et al (2014)
aly-miR845bTCGCTCTGATACCAAATGATGMayer et al (2014)
aly-miR848QGGCAATCCCATGTCAAAMayer et al (2014)
aly-miR857TTTTGTATGTTGAAGGTGTATMayer et al (2014)
aly-miR859TCTCTCCGTTGTAAAATCAAAMayer et al (2014)
aly-miR861-3pGATGGATATATCTTCAAGAACMayer et al (2014)
aly-miR862-3pACATGCTGGATCTACTTGAAGMayer et al (2014)
aqc-miR159TTTGGACTGAAGGGAGCTCTAMayer et al (2014)
aqc-miR167TCAAGCTGCCAGCATGATCTAMayer et al (2014)
aqc-miR169aTAGCCAAGGATGACTTGCCTAMayer et al (2014)
aqc-miR171cTAATTGAACCGCACTAATATCMayer et al (2014)
aqc-miR171fTAATTGAGCCGTGCCAATATCMayer et al (2014)
aqc-miR398bTGTGTTCTCAGGTCGCCCCTGMayer et al (2014)
aqc-miR399TGCCAAAGGAGAGTTGCCCTAMayer et al (2014)
aqc-miR477cCTCTCCCTCAAGTTCTTCTAMayer et al (2014)
ath-miR156iTGACAGAAGAGAGAGAGCAGMayer et al (2014)
ath-miR169gQTCCGGCAAGTTGACCTTGGCTMayer et al (2014)
ath-miR406TAGAATGCTATTGTAATCCAGMayer et al (2014)
ath-miR407TTTAAATCATATACTTTTGGTMayer et al (2014)
ath-miR413ATAGTTTCTCTTGTTCTGCACMayer et al (2014)
ath-miR414TCATCTTCATCATCATCGTCAMayer et al (2014)
ath-miR420TAAACTAATCACGGAAATGCAMayer et al (2014)
ath-miR5015aTTGGTGTTATGTGTAGTCTTCMayer et al (2014)
ath-miR5017TTATACCAAATTAATAGCAAAMayer et al (2014)
ath-miR5019TGTTGGGAAAGAAAAACTCTTMayer et al (2014)
ath-miR5020cTGGCATGGAAGAAGGTGAGACMayer et al (2014)
ath-miR5021TGAGAAGAAGAAGAAGAAAAMayer et al (2014)
ath-miR5024-5pATGACAAGGCCAAGATATAACAMayer et al (2014)
ath-miR5631TGGCAGGAAAGACATAATTTTMayer et al (2014)
ath-miR5639TAGTCCACTGTGGTCTAAGGCMayer et al (2014)
ath-miR5650TTGTTTTGGATCTTAGATACAMayer et al (2014)
ath-miR5652TTGAATGTGAATGAATCGGGCMayer et al (2014)
ath-miR5658ATGATGATGATGATGATGAAAMayer et al (2014)
ath-miR5660CAGGTGGTTAGTGCAATGGAAMayer et al (2014)
ath-miR779_1TTCTGCTATGTTGCTGCTCATMayer et al (2014)
ath-miR827TTAGATGACCATCAACAAACTMayer et al (2014)
ath-miR830TAACTATTTTGAGAAGAAGTGMayer et al (2014)
ath-miR835-3pTGGAGAAGATACGCAAGAAAGMayer et al (2014)
ath-miR838TTTTCTTCTACTTCTTGCACAMayer et al (2014)
ath-miR845bTCGCTCTGATACCAAATTGATGMayer et al (2014)
ath-miR854aGATGAGGATAGGGAGGAGGAGMayer et al (2014)
ath-miR863-5pTTATGTCTTGTTGATCTCAATMayer et al (2014)
bdi-miR1122TAGATACATCCGTATTTGGAMayer et al (2014)
bdi-miR1127AACTACTCCCTCCGTCCGATAMayer et al (2014)
bdi-miR1135TTTCGACAAGTAATTCCGACCGGAMayer et al (2014)
bdi-miR1139GAGTAACATACACTAGTAACAMayer et al (2014)
bdi-miR159CTTGGATTGAAGGGAGCTCTMayer et al (2014)
bdi-miR164fTGGAGAAGAAGGGCACATGCAMayer et al (2014)
bdi-miR166eCTCGGACCAGGCTTCATTCCCMayer et al (2014)
bdi-miR166fTCTCGGACCAGGCTTCATTCCMayer et al (2014)
bdi-miR169dTAGCCAAGAATGACTTGCCTAMayer et al (2014)
bdi-miR319TGAGGGAGCTTTCTTCTGTCCMayer et al (2014)
bdi-miR393aTCCAAAGGGATCGCATTGATCMayer et al (2014)
bdi-miR395dAAGTGTTTGGGGAACTCTAGGMayer et al (2014)
bdi-miR399TGCCAAAGGAGAATTACCCTGMayer et al (2014)
bdi-miR437GAACTTAGAGAAGTTTGACTTMayer et al (2014)
bdi-miR5054TCCCCACGGTCGGCGCCAMayer et al (2014)
bdi-miR5056AGGAAGAACCGGTAATAAGCAMayer et al (2014)
bdi-miR5057AAATTTCAAATCATTTTGACAMayer et al (2014)
bdi-miR5064CGAATTTGTCCATAGCATCAGMayer et al (2014)
bdi-miR5066AAGTGTATAAGTGGAGTGCCTMayer et al (2014)
bdi-miR5067TCAGCGACAACTAATATGGATMayer et al (2014)
bdi-miR5068ATCGGGTAGAGCGGGTATGGGTATMayer et al (2014)
bdi-miR5069TAGGTTATTGATTTGACCAACMayer et al (2014)
bdi-miR5070AACTAAGTAGGGTCAGAGGGTMayer et al (2014)
bdi-miR5164CGCAACTTTGTCTAGATACGCMayer et al (2014)
bdi-miR5169TTTGACCAAGTTTGTAGAACAMayer et al (2014)
bdi-miR5171ACTTAATATGGGACGGAAGAAMayer et al (2014)
bdi-miR5174CTCCGTTCCATAAAGATTGGCMayer et al (2014)
bdi-miR5175aAAGAATTTAGGAACGGAGGGAMayer et al (2014)
bdi-miR5175bCCTCTGTTCCTAAATTCTTGTMayer et al (2014)
bdi-miR5176-3pTGTGATGATGTGGCATAGAATMayer et al (2014)
bdi-miR5180aTAAGTGTCTCAGTTTTGAACTMayer et al (2014)
bdi-miR5181aTGATCCATAATAAGTGTCAGGMayer et al (2014)
bdi-miR5181bTCCGATCCATAATAAGTGTCGMayer et al (2014)
bdi-miR5182TGATGATCTTGGAACACGTGCMayer et al (2014)
bdi-miR5183TATTTGGACAAATTTGAGTCAMayer et al (2014)
bdi-miR5185aTTCTAGTTCATTTTTCAAATCMayer et al (2014)
bdi-miR5198GGGGAAAAGAGATTGAGGGAGMayer et al (2014)
bdi-miR5200TGTAGATACTCTCTAAGGCTTMayer et al (2014)
bdi-miR5202TTACGTGAGTTAAATCGTCGAMayer et al (2014)
bdi-miR5203ACTTATTATGGACCGGAGGGAMayer et al (2014)
bna-miR169gTAGCCAAGGATGACTTGCCTGCMayer et al (2014)
bna-miR169mTGAGCCAAAGATGACTTGCCGMayer et al (2014)
bra-miR172bQGCAGCACCATTAAGATTCACAMayer et al (2014)
cme-miR168TCGCTTGGTGCAGGTCGGGAMayer et al (2014)
cre-miR1166_2AGGTCCATGACCTCATGGGMayer et al (2014)
cre-miR1167GGGGTGTGATGATTTGAAACMayer et al (2014)
cre-miR1171TGGAGTGGAGTGGAGTGGAGTGGMayer et al (2014)
cre-miR905QAGGTCCCTGGATATGGCACCMayer et al (2014)
crt-miR166aTCGGACCAGGCTTCATTCCCGTMayer et al (2014)
csi-miR166cTCGGACCAGGCTTCATTCCCMayer et al (2014)
csi-miR169GAGCCAAGAATGACTTGCCGAMayer et al (2014)
csi-miR171aTTGAGCCGCGCCAATATCACMayer et al (2014)
csi-miR172aQGCAGCGTCCTCAAGATTCACAMayer et al (2014)
csi-miR172bAGAATCTTGATGATGCGGCAAMayer et al (2014)
csi-miR172cTGGAATCTTGATGATGCTGCAGMayer et al (2014)
csi-miR319TTTGGACTGAAGGGAGCTCCTMayer et al (2014)
csi-miR393ATCCAAAGGGATCGCATTGATCMayer et al (2014)
csi-miR3951TAGATAAAGATGAGAGAAAAAMayer et al (2014)
csi-miR396cTTCAAGAAATCTGTGGGAAGMayer et al (2014)
csi-miR479TGTGATATTGGTTCGGCTCATCMayer et al (2014)
csi-miR827TTAGATGACCATCAACAAACAMayer et al (2014)
far-miR1134CGACAACAACAACAAGAAGAAGAGMayer et al (2014)
far-miR164aTGGAGAAGCAGGGCACTTGCTMayer et al (2014)
far-miR437AAACATAGAGAAGTTTGACTTMayer et al (2014)
ghr-miR156cTGTCAGAAGAGAGTGAGCACMayer et al (2014)
ghr-miR393TCCAAAGGGATCGCATTGATCTMayer et al (2014)
ghr-miR399cTGCCAAAGGAGAGTTGGCCTTMayer et al (2014)
ghr-miR479CGTGATATTGGTTCGGCTCATCMayer et al (2014)
ghr-miR482aTCTTTCCTACTCCTCCCATACCMayer et al (2014)
gma-miR1507cQGAGGTGTTTGGGATGAGAGAAMayer et al (2014)
gma-miR1511AACCAGGCTCTGATACCATGMayer et al (2014)
gma-miR1514aTTCATTTTTAAAATAGGCATTMayer et al (2014)
gma-miR1514bTTCATTTTTAAAATAGACATTMayer et al (2014)
gma-miR1516bAGCTTCTCTACAGAAAATATAMayer et al (2014)
gma-miR1519TAAGTGTTGCAAAATAGTCATTMayer et al (2014)
gma-miR1530TTTTCACATAAATTAAAATATMayer et al (2014)
gma-miR1533ATAATAAAAATAATAATGAMayer et al (2014)
gma-miR1534TATTTTGGGTAAATAGTCATMayer et al (2014)
gma-miR159a-5pGAGCTCCTTGAAGTCCAATTGMayer et al (2014)
gma-miR159cATTGGAGTGAAGGGAGCTCCGMayer et al (2014)
gma-miR159e-5pGAGCTCCTTGAAGTCCAATTMayer et al (2014)
gma-miR164bTGGAGAAGCAGGGCACGTGCMayer et al (2014)
gma-miR166j-3pTCGGACCAGGCTTCATTCCCGMayer et al (2014)
gma-miR169cAAGCCAAGGATGACTTGCCGAMayer et al (2014)
gma-miR169dTGAGCCAAGGATGACTTGCCGGTMayer et al (2014)
gma-miR169eAGCCAAGGATGACTTGCCGGMayer et al (2014)
gma-miR169j-3pTTTCGACGAGTTGTTCTTGGCMayer et al (2014)
gma-miR169j-5pTAGCCAAGAATGACTTGCCGGMayer et al (2014)
gma-miR169kCAGCCAAGAATGACTTGCCGGMayer et al (2014)
gma-miR169nCAGCCAAGGGTGATTTGCCGGMayer et al (2014)
gma-miR171i-5pATAAGAAAGCAATGCTCAAAMayer et al (2014)
gma-miR172b-5pGTAGCATCATCAAGATTCACMayer et al (2014)
gma-miR172cGGAATCTTGATGATGCTGCAGMayer et al (2014)
gma-miR172dGGAATCTTGATGATGCTGCAGCAGMayer et al (2014)
gma-miR172gGCAGCACCATCAAGATTCACMayer et al (2014)
gma-miR172h-5pGCAGCAGCATCAAGATTCACAMayer et al (2014)
gma-miR2108aTTAATGTGTTGTGTTTGTCGGMayer et al (2014)
gma-miR319cTTGGACTGAAAGGAGCTCCTMayer et al (2014)
gma-miR319gTTGGACTGAAGGGAGCTCCTTCMayer et al (2014)
gma-miR3522AGACCAAATGAGCAGCTGAMayer et al (2014)
gma-miR390bAAGCTCAGGAGGGATAGCACCMayer et al (2014)
gma-miR396a-3pTTCAATAAAGCTGTGGGAAGMayer et al (2014)
gma-miR396b-3pGCTCAAGAAAGCTGTGGGAGAMayer et al (2014)
gma-miR396hTCCACAGCTTTCTTGAACTGMayer et al (2014)
gma-miR403aTTAGATTCACGCACAAACTTGMayer et al (2014)
gma-miR4347AAGCTTCTTACGGATCAAGTTGATMayer et al (2014)
gma-miR4352aATTTCTAGGACATACTACGACGGTMayer et al (2014)
gma-miR4412-5pTGTTGCGGGTATCTTTGCCTCMayer et al (2014)
gma-miR4413AAGAGAATTGTAAGTCACTGMayer et al (2014)
gma-miR482b-3pTCTTCCCTACACCTCCCATACCMayer et al (2014)
gma-miR5031TTAATGATTAACATCTAATTTMayer et al (2014)
gma-miR5032AGAGCCACTTTTGGGTTCCCTATMayer et al (2014)
gma-miR5035CTTCTAAACATTTTTTCCCTTAMayer et al (2014)
gma-miR5040ATGATATATAACAAGCATGAGMayer et al (2014)
gma-miR530TGCATTTGCACCTGCACTTTMayer et al (2014)
gma-miR530bTGCATTTGCACCTGCACTTTAMayer et al (2014)
gma-miR5369TGAGAAAAGGAGGATGTCAMayer et al (2014)
gma-miR5674TAATTGTGTTGTACATTATCAMayer et al (2014)
gma-miR5675TAGAGACGACAACAATGGAAAMayer et al (2014)
gma-miR5678TTCCATGATAAGATCTTTGACMayer et al (2014)
gso-miR3522aTGAGACCAAATGAGCAGCTGAMayer et al (2014)
gso-miR482aTCTTCCCTACACCTCCCATACMayer et al (2014)
hvu-miR1120ACATTCTTATATTATGGGACGGAGMayer et al (2014)
hvu-miR1126TCAACTATGGACTACATACGGAAMayer et al (2014)
hvu-miR5048TATTTGCAGGTTTTAGGTCTAAMayer et al (2014)
hvu-miR5049TCCTAAATACTTGTTGTTGGGMayer et al (2014)
hvu-miR5050TTGAGGTCGTTCAACCAGCAAMayer et al (2014)
mtr-miR1510bQCCATGGATCCCTACCATGTGGMayer et al (2014)
mtr-miR156jTGACAGAAGAGGGTGAGCACMayer et al (2014)
mtr-miR164dTGGAGAAGCAGGGCACATGCTMayer et al (2014)
mtr-miR167bQGATCATGTTGGAGCTTCACCMayer et al (2014)
mtr-miR169dAAGCCAAGGATGACTTGCCGGMayer et al (2014)
mtr-miR169eGGAGCCAAGGATGACTTGCCGMayer et al (2014)
mtr-miR169fAAGCCAAGGATGACTTGCCTAMayer et al (2014)
mtr-miR169hGAGCCAAAGATGACTTGCCGGMayer et al (2014)
mtr-miR169mGAGCCAAGGATGACTTGCCGGMayer et al (2014)
mtr-miR171TGATTGAGTCGTGCCAATATCMayer et al (2014)
mtr-miR171cTGATTGAGCCGTGCCAATATTMayer et al (2014)
mtr-miR171eAGATTGAGCCGCGCCAATATCMayer et al (2014)
mtr-miR172cQGTAGCATCATCAAGATTCACAMayer et al (2014)
mtr-miR2592blQGAGTAATTCAAACTTGTTAAAMayer et al (2014)
mtr-miR2592sAAATGCTTGAGTCATGTTGTTMayer et al (2014)
mtr-miR2593aTTAAATGAATGAACCTAGAATMayer et al (2014)
mtr-miR2607ATGTGATTATGTGATAAGTGTMayer et al (2014)
mtr-miR2611TATTTGTCAGTGTTTGATGAAMayer et al (2014)
mtr-miR2628CATGAAAGAATGATGAGTAAMayer et al (2014)
mtr-miR2637AAATACTTCCTCTGATCACTGMayer et al (2014)
mtr-miR2642ATGAGTTTCATCAAATCATGTMayer et al (2014)
mtr-miR2643TTTGGGATCAGAAATTAGAGAMayer et al (2014)
mtr-miR2645TTTCTAGAGATGAGCATATATMayer et al (2014)
mtr-miR2651TTTGATTGGTATGCCTGCATTMayer et al (2014)
mtr-miR2652aTATGCAGGGTGCATAAGGATTMayer et al (2014)
mtr-miR2656aAAGTTGCATAATCGAGTTGGMayer et al (2014)
mtr-miR2661TAGGTTTGAGAAAATGGGCAGMayer et al (2014)
mtr-miR2673aCCTCTTCCTCTTCCTCTTCCACMayer et al (2014)
mtr-miR395bATGAAGTATTTGGGGGAACTCMayer et al (2014)
mtr-miR395hATGAAGTGTTTGGGGGAACTTMayer et al (2014)
mtr-miR399aTGCCAAAGGAGATTTGCCCAGMayer et al (2014)
mtr-miR399bTGCCAAAGGAGAGCTGCCCTGMayer et al (2014)
mtr-miR399dTGCCAAAGGAGAGCTGCCCTAMayer et al (2014)
mtr-miR399jCGCCAAAGAAGATTTGCCCCGMayer et al (2014)
mtr-miR399kTGCCAAAGAAGATTTGCCCTGMayer et al (2014)
mtr-miR399qTGCCAAAGGAGAGCTGCTCTTMayer et al (2014)
mtr-miR399rTGCCAAAGAAGATTTGCCCCGMayer et al (2014)
mtr-miR4414bTGTGAATGATGCGGGAGCTAAMayer et al (2014)
mtr-miR5205aCATACAATTTGGGACGGAGGGAGMayer et al (2014)
mtr-miR5205bCTTATAATTAGGGACGGAGGGAGTMayer et al (2014)
mtr-miR5205cCTTATAATTAGGGACGGAGGTAGTMayer et al (2014)
mtr-miR5212TGGATTTCGTATTTCTTTGGTAMayer et al (2014)
mtr-miR5227TGAAGAGAAGAAGATTGATGAAMayer et al (2014)
mtr-miR5235aATAAGGTCAATGATTGGCGTGMayer et al (2014)
mtr-miR5240TTGAAAAAATTGTGGATTTGAMayer et al (2014)
mtr-miR5248TTTTTAGTTGGCATGCATTCAMayer et al (2014)
mtr-miR5252TGAGAGCTCACTGAAGTCTGCMayer et al (2014)
mtr-miR5254AGGAGGTGGAAGCATTTGTGAMayer et al (2014)
mtr-miR5268aCCAGAGTGGAATGAAGATATGGTTMayer et al (2014)
mtr-miR5281aCTCTTGTAAATAGGATCGGAGGGAMayer et al (2014)
mtr-miR5281bTCTTATAAATAGGACCGGAGGGAGMayer et al (2014)
mtr-miR5287bTGCTTATAATAGTGATCGGAGGGTMayer et al (2014)
mtr-miR5293GATGAAGAAGTGGAAGGAAGAAGAMayer et al (2014)
mtr-miR5298bTGATGGAGATGATATGAAGATGAAMayer et al (2014)
mtr-miR5556QTGGAATTCTTCCGCCATCCAAMayer et al (2014)
mtr-miR5557QAACAAGTACTAAGGAAGCACAMayer et al (2014)
mtr-miR5561CATTTGGAGAGACATAGACAAMayer et al (2014)
osa-miR1320TGGAACGGAGGAATTTTATAGMayer et al (2014)
osa-miR1429-5pGTAATATACTAATCCGTGCATMayer et al (2014)
osa-miR1435TTTCTTAAGTCAAACTTTTTMayer et al (2014)
osa-miR1439TTTTGGAACGGAGTGAGTATTMayer et al (2014)
osa-miR1440TGCTCAAATACCACTCTCCTMayer et al (2014)
osa-miR156lCGACAGAAGAGAGTGAGCATAMayer et al (2014)
osa-miR159cATTGGATTGAAGGGAGCTCCAMayer et al (2014)
osa-miR159dATTGGATTGAAGGGAGCTCCGMayer et al (2014)
osa-miR159eATTGGATTGAAGGGAGCTCCTMayer et al (2014)
osa-miR159fCTTGGATTGAAGGGAGCTCTAMayer et al (2014)
osa-miR164cTGGAGAAGCAGGGTACGTGCAMayer et al (2014)
osa-miR164eTGGAGAAGCAGGGCACGTGAGMayer et al (2014)
osa-miR169dTAGCCAAGGATGAATTGCCGGMayer et al (2014)
osa-miR169pTAGCCAAGGACAAACTTGCCGGMayer et al (2014)
osa-miR171hGTGAGCCGAACCAATATCACTMayer et al (2014)
osa-miR171iGGATTGAGCCGCGTCAATATCMayer et al (2014)
osa-miR172cTGAATCTTGATGATGCTGCACMayer et al (2014)
osa-miR1846d-3pTATCCGGCGCCGCAGGGAGGMayer et al (2014)
osa-miR1847_2TGGCCCACATGTTAGTGCCACAACMayer et al (2014)
osa-miR1850_2TTGTGTGTGAACTAAACGTGGMayer et al (2014)
osa-miR1853-3pTAATTGGGGATGTTCGGTTGCTMayer et al (2014)
osa-miR1857-3pTCATGCTCCAAGAAAACCAGGMayer et al (2014)
osa-miR1861hCGGTCTTGAGGCAGGAACTGAGMayer et al (2014)
osa-miR1867TTTTTTTTCTAGGACAGAGGGAGTMayer et al (2014)
osa-miR1884b-3pAAAGTCAACGGTGTCATATATTTAMayer et al (2014)
osa-miR2092-5pCAACTGAAGTCGGTGTTTACTMayer et al (2014)
osa-miR2095-3pCTTCCATTTATGATAAGTATMayer et al (2014)
osa-miR2118aTTCTCGATGCCTCCCATTCCTAMayer et al (2014)
osa-miR2118cTTCCCGATGCCTCCTATTCCTAMayer et al (2014)
osa-miR2118dTTCCTGATGCCTCCCATGCCTAMayer et al (2014)
osa-miR2118eTTCCCAATGCCTCCCATGCCTAMayer et al (2014)
osa-miR2118fTTCCTGATGCCTCCCATTCCTAMayer et al (2014)
osa-miR2118lTTCCTAATGCTTCCCATTCCTAMayer et al (2014)
osa-miR2120AAAGATCTTTAGTCCCGGTTGTTCMayer et al (2014)
osa-miR2275cAGAATTGGAGGAAAACAAACTGAMayer et al (2014)
osa-miR2275dCTTGTTTTTCTCCAATATCTCAMayer et al (2014)
osa-miR2871a-3pTATTTTAGTTTCTATGGTCACMayer et al (2014)
osa-miR2905TACATGTCAGTGACAAAGGCAMayer et al (2014)
osa-miR2919AAGGGGGGGGGGGGAAAGAMayer et al (2014)
osa-miR2923AGACAAAAATATAAATAACAAAMayer et al (2014)
osa-miR319a-3p_2TTGGACTGAAGGGTGCTCCCMayer et al (2014)
osa-miR393b-3pTCAGTGCAATCCCTTTGGAATMayer et al (2014)
osa-miR395aGTGAAGTGCTTGGGGGAACTCMayer et al (2014)
osa-miR395cGTGAAGTGTTTGGAGGAACTCMayer et al (2014)
osa-miR395fGTGAATTGTTTGGGGGAACTCMayer et al (2014)
osa-miR395oATGAAGTGTTTGGAGGAACTCMayer et al (2014)
osa-miR395tGTGAAGTGTTTGGGGAAACTCMayer et al (2014)
osa-miR396fTCTCCACAGGCTTTCTTGAACTMayer et al (2014)
osa-miR396gTCCACAGGCTTTCTTGAACGGMayer et al (2014)
osa-miR3982-5pGCGCTCCACGTAGGCAACAATMayer et al (2014)
osa-miR399hTGCCAAAGGAGACTTGCCCAGMayer et al (2014)
osa-miR399kTGCCAAAGGAAATTTGCCCCGMayer et al (2014)
osa-miR413CTAGTTTCACTTGTTCTGCACMayer et al (2014)
osa-miR414TCATCCTCATCATCATCGTCCMayer et al (2014)
osa-miR415AACAGAACAGAAGCAGAGCAGMayer et al (2014)
osa-miR417GAATGTAGTGAATTTGTTCCAMayer et al (2014)
osa-miR435TTATCCGGTATTGGAGTTGAMayer et al (2014)
osa-miR437AAAGTTAGAGAAGTTTGACTTMayer et al (2014)
osa-miR438TTCCCACGCGTTATAGTGAAAMayer et al (2014)
osa-miR5079TTTGGATCTGTTATTTTGGTATMayer et al (2014)
osa-miR5083AGACTACAATTATCTGATCAMayer et al (2014)
osa-miR5161TCTGGATCAGAGGGAGTATAMayer et al (2014)
osa-miR5162AAATGACCAAAATACCCCTAGAACMayer et al (2014)
osa-miR529aCTGTACCCTCTCTCTTCTTCMayer et al (2014)
osa-miR530-5pTGCATTTGCACCTGCACCTAMayer et al (2014)
osa-miR5337AAATTACTTGTCGTTCTAGCTMayer et al (2014)
osa-miR5340TGATGACGTGGATGAATTTCAAAMayer et al (2014)
osa-miR5485TGACAACTGGTAGCAGAGCAAMayer et al (2014)
osa-miR5496CCAGCCGGTGGCATAGTTCTCMayer et al (2014)
osa-miR5532ATGGAATATATGACAAAGGTGGMayer et al (2014)
osa-miR815aAAGGGGATTGAGGAGATTGGGMayer et al (2014)
osa-miR816GTGACATATTTTACTACAACMayer et al (2014)
osa-miR818aAATCCCTTATATTATGGGACGGMayer et al (2014)
osa-miR820aTCGGCCTCGTGGATGGACCAGMayer et al (2014)
pab-miR3700GACGCCCAAAACTGAAGGTCAMayer et al (2014)
pab-miR3706TTTCGGAGAAATGGATAAGAMayer et al (2014)
pab-miR395CTGAAGTGTTTGGAGGAACTTMayer et al (2014)
pab-miR396aTTCCACAGCTTTCTTGAACTAMayer et al (2014)
pab-miR396bTTCCACGGCTTTCTTGAACTTMayer et al (2014)
pab-miR482aTCTTCCCTACTCCTCCCATTCCMayer et al (2014)
pab-miR482cTCTTTCCTACTCCTCCCATTCCMayer et al (2014)
ppt-miR1023c-5pCCACTCTCTCCGTTTCCCTTCCMayer et al (2014)
ppt-miR1025TGCCACAACAAAGCTAATAACMayer et al (2014)
ppt-miR1027aTTTCTATCTTCTCTTCCAATCMayer et al (2014)
ppt-miR1028a-3pTGACATTGTAGATCTACGTGCMayer et al (2014)
ppt-miR1029TCTCTCTCAACCAACCATACMayer et al (2014)
ppt-miR1030aTCTGCATCTGCACCTGCACCAMayer et al (2014)
ppt-miR1030hTCTGCATCTGCACCTGCACCGMayer et al (2014)
ppt-miR1030iCCTGCATCTGCACCTGCACCGMayer et al (2014)
ppt-miR1030jCCTGCATCTGCACCTGCACCAMayer et al (2014)
ppt-miR1044-3pTTGTAGTGCATATTTGTTTTMayer et al (2014)
ppt-miR1046-3pTGGTGAAAAATATGAAAAATCMayer et al (2014)
ppt-miR1046-5pTGGATTTCATATTTTTCACGMayer et al (2014)
ppt-miR1049TCTCTCTTAGCCAAACAGTCTMayer et al (2014)
ppt-miR1054TAAACCCTCTCTCTATTCCTGMayer et al (2014)
ppt-miR1217-3pAATTTGAAGCATGATGTCAAGMayer et al (2014)
ppt-miR1217-5pTGGTATCATGTTGCAAATGGCMayer et al (2014)
ppt-miR160cCGCCTGGCTCCCTGCATGCCAMayer et al (2014)
ppt-miR160gTGCCTGGCTCCTTGTATGCCAMayer et al (2014)
ppt-miR160hCGCCTGGCTCCTTGTATGCCAMayer et al (2014)
ppt-miR166jTCCGGACCAGGCTTCATTCCCMayer et al (2014)
ppt-miR166mTCGGACCAGGCATCATTCCTTMayer et al (2014)
ppt-miR167GGAAGCTGCCAGCATGATCCTMayer et al (2014)
ppt-miR171bTTGAGCCGCGCCAATATCACAMayer et al (2014)
ppt-miR2079AGAGTTGATGTTGATGACGCAMayer et al (2014)
ppt-miR319aCTTGGACTGAAGGGAGCTCCMayer et al (2014)
ppt-miR390cGAGCTCAGGAGGGATAGCGCCMayer et al (2014)
ppt-miR414TCATCCTCATCATCCTCGTCCMayer et al (2014)
ppt-miR534aTATGTCCATTGCAGTTGCATACMayer et al (2014)
ppt-miR536fTTCGTGCCAAGCTGTGTGCAMayer et al (2014)
ppt-miR902d-3pATGAAGGTCTGCATCGTAGCMayer et al (2014)
ppt-miR902k-3pACGAAGGATCTGCAATATAAAMayer et al (2014)
pta-miR159aTTGGATTGAAGGGAGCTCCAMayer et al (2014)
pta-miR159bTTGGATTGAAGAGAGCTCCCMayer et al (2014)
pta-miR159cCTTGGATTGAAGGGAGCTCCCMayer et al (2014)
pta-miR319TTGGACTGAAGGGAGCTCCMayer et al (2014)
pta-miR390AAGCCCAGGATGGATAGCGCCMayer et al (2014)
pta-miR482dTCCTCCCTACTCCTCCCATTMayer et al (2014)
pta-miR783ATGCTTTGCTGGTTCATTTTCMayer et al (2014)
pta-miR952bAACTGAGAATGCCATTGGTGMayer et al (2014)
ptc-miR156kTGACAGAAGAGAGGGAGCACMayer et al (2014)
ptc-miR159dCTTGGATTGAAGGGAGCTCCTMayer et al (2014)
ptc-miR159fATTGGAGTGAAGGGAGCTCGAMayer et al (2014)
ptc-miR160hTGCCTGGCTCCCTGCATGCCAMayer et al (2014)
ptc-miR167hTGAAGCTGCCAACATGATCTGMayer et al (2014)
ptc-miR169aaGAGCCAAGAATGACTTGTCGGMayer et al (2014)
ptc-miR169abTAGCCAAGGACGACTTGCCCAMayer et al (2014)
ptc-miR169oAAGCCAAGGATGACTTGCCTGMayer et al (2014)
ptc-miR169qTAGCCAAGGACGACTTGCCTGMayer et al (2014)
ptc-miR169sTCAGCCAAGGATGACTTGCCGMayer et al (2014)
ptc-miR169tGAGCCAAGAATGACTTGCCGGMayer et al (2014)
ptc-miR169uTAGCCAAGGACGACTTGCCTAMayer et al (2014)
ptc-miR169vTAGCCAAGGATGACTTGCCCAMayer et al (2014)
ptc-miR169xTAGCCAAGGATGACTTGCTCGMayer et al (2014)
ptc-miR169zCAGCCAAGAATGATTTGCCGGMayer et al (2014)
ptc-miR171jGGATTGAGCCGCGCCAATACTMayer et al (2014)
ptc-miR171kGGATTGAGCCGCGCCAATATCMayer et al (2014)
ptc-miR172iAGAATCCTGATGATGCTGCAAMayer et al (2014)
ptc-miR319eTTGGACTGAAGGGAGCTCCTMayer et al (2014)
ptc-miR319iTTGGGCTGAAGGGAGCTCCCMayer et al (2014)
ptc-miR394a-3pCTGTTGGTCTCTCTTTGTAAMayer et al (2014)
ptc-miR396fTTCCACGGCTTTCTTGAACTGMayer et al (2014)
ptc-miR397cTCATTGAGTGGAGCTTTGATGMayer et al (2014)
ptc-miR399hTGCCAAAGGAGAGTTTCCCTGMayer et al (2014)
ptc-miR399jTGCCAAAGGAGATTTGTCCGGMayer et al (2014)
ptc-miR399lCGCCAAAGGAGAGTTGCCCTCMayer et al (2014)
ptc-miR476aTAGTAATCCTTCTTTGCAAAGMayer et al (2014)
ptc-miR482_1CCTACTCCTCCCATTCCMayer et al (2014)
ptc-miR482_2TCTTGCCTACTCCTCCCATTMayer et al (2014)
rgl-miR5138AAAAATCGTTAGGCGCTAMayer et al (2014)
rgl-miR5139AAACCTGGCTCTGATACCAMayer et al (2014)
sbi-miR1435aTTTCTTAAGTCAAACTTTTCMayer et al (2014)
sbi-miR1435bTTTCTTAAGTCAAACCTTTTMayer et al (2014)
sbi-miR169oTAGCCAAGGATGATTTGCCTGMayer et al (2014)
sbi-miR171fATGAGCCGAACCAATATCACTMayer et al (2014)
sbi-miR172bGGAATCTTGATGATGCTGCAMayer et al (2014)
sbi-miR172fAGAATCCTGATGATGCTGCACMayer et al (2014)
sbi-miR399kTGCCAAAGGGGATTTGCCCGGMayer et al (2014)
sbi-miR5382CCAATCTAAACAGGCCCTMayer et al (2014)
sbi-miR5387TAACACGAACCGGTGCTAAAGGATCMayer et al (2014)
sbi-miR5387bCGTGGCTCTGACCGGTGCTAAAGGMayer et al (2014)
sbi-miR5565eTTGTTTGGATGTTGTCGGAMayer et al (2014)
sbi-miR5566TCAGCATCACCTCCCTGTTGTMayer et al (2014)
sbi-miR5570AAAAGACAAATCAGCATGTCAMayer et al (2014)
sly-miR1919aACGAGAGTCATCTGTGACAGGMayer et al (2014)
smo-miR1081TGAGGCTTGCCTTTGATTCTCMayer et al (2014)
smo-miR1088-5pCAGAAGAAAGAGAGCACGCATMayer et al (2014)
smo-miR1090TGAAAGCCATTCTCAACAAAAMayer et al (2014)
smo-miR1092TGACAGGAATGCATTGGTGTTMayer et al (2014)
smo-miR1094bTACTTCTCTGTTCCACAGTACMayer et al (2014)
smo-miR1103-3pTGGAAAAAGGAGGTGCATTCTTGTMayer et al (2014)
smo-miR396TTCCACGGCTTTCTTGAACCMayer et al (2014)
sof-miR159eTTTGGATTGAAAGGAGCTCTTMayer et al (2014)
ssl-miR1078CTTGATTGATTCAATTGTGATMayer et al (2014)
ssl-miR164aTGGAGAAGYAGGGCACGTGCAMayer et al (2014)
ssl-miR171bTTGAGCCGCGCCAATATCACTMayer et al (2014)
ssl-miR398TGTGTTCTCAGGTCACCCCTCMayer et al (2014)
ssl-miR828TCTTGCTCAAATGAGTATTCCAMayer et al (2014)
tcc-miR169fAAGCCAAGAATGACTTGCCTGMayer et al (2014)
tcc-miR169gTAGCCAGGGATGACTTGCCTAMayer et al (2014)
tcc-miR169iTAGCCAAGGATGAGTTGCCTGMayer et al (2014)
tcc-miR169nTGAGTCAAGAATGACTTGCCGMayer et al (2014)
tcc-miR172dAGAATCCTGATGATGCTGCATMayer et al (2014)
tcc-miR399aCGCCAAAGGAGAGTTGCCCTGMayer et al (2014)
tcc-miR399cTGCCAATGGAGATTTGCCCAGMayer et al (2014)
tcc-miR399eCGCCAAAGGAGAATTGCCCTGMayer et al (2014)
tcc-miR399fTGCCAGAGGAGATTTGCCCTGMayer et al (2014)
vun-miR164TGGAGAAGGGGAGCACGTGCAMayer et al (2014)
vun-miR319bCTTGGACTGAAGGGAGCTCCTMayer et al (2014)
vvi-miR156hTGACAGAAGAGAGAGAGCATMayer et al (2014)
vvi-miR159aCTTGGAGTGAAGGGAGCTCTCMayer et al (2014)
vvi-miR166aTCGGACCAGGCTTCATTCCMayer et al (2014)
vvi-miR169bTGAGCCAAGGATGGCTTGCCGMayer et al (2014)
vvi-miR169iGAGCCAAGGATGACTGGCCGTMayer et al (2014)
vvi-miR169lGAGCCAAGGATGACTTGCCGTMayer et al (2014)
vvi-miR169oGAGCCAAGGATGACTTGCCGCMayer et al (2014)
vvi-miR169rTGAGTCAAGGATGACTTGCCGMayer et al (2014)
vvi-miR169tCGAGTCAAGGATGACTTGCCGMayer et al (2014)
vvi-miR169vAAGCCAAGGATGAATTGCCGGMayer et al (2014)
vvi-miR169yTAGCGAAGGATGACTTGCCTAMayer et al (2014)
vvi-miR171gTTGAGCCGAACCAATATCACCMayer et al (2014)
vvi-miR171hTGGTTGAGCCGCGCCAATATCMayer et al (2014)
vvi-miR172aTGAATCTTGATGATGCTACATMayer et al (2014)
vvi-miR172bTGAATCTTGATGATGCTACACMayer et al (2014)
vvi-miR3632TTTCCCAGACCCCCAATACCAAMayer et al (2014)
vvi-miR396bTTCCACAGCTTTCTTGAACTMayer et al (2014)
vvi-miR399fTGCCGAAGGAGATTTGTCCTGMayer et al (2014)
vvi-miR399gTGCCAAAGGAGATTTGCCCCTMayer et al (2014)
vvi-miR479TGTGGTATTGGTTCGGCTCATCMayer et al (2014)
vvi-miR845aTAGCTCTGATACCAATTGATAMayer et al (2014)
zma-miR156aQGCTCACTTCTCTCTCTGTCAGTMayer et al (2014)
zma-miR156bQGCTCACCCTCTATCTGTCAGTMayer et al (2014)
zma-miR156dQGCTCACTTCTCTTTCTGTCAGCMayer et al (2014)
zma-miR156eQGCTCACTGCTCTCTCTGTCATCMayer et al (2014)
zma-miR156hQGCTCACTGCTCTTTCTGTCATCMayer et al (2014)
zma-miR156iQGCTCACTGCTCTATCTGTCATCMayer et al (2014)
zma-miR159bQGTGCTCCCTTCAAACCAATAAMayer et al (2014)
zma-miR159cQGAGCTCCCTTCGATCCAATCCMayer et al (2014)
zma-miR159eATTGGTTTGAAGGGAGCTCCAMayer et al (2014)
zma-miR159gTTTGGAGTGAAGGGAGTTCTGMayer et al (2014)
zma-miR159hTTTGGAGTGAAGGGAGCTCTGMayer et al (2014)
zma-miR160dQGCGTGCGTGGAGCCAAGCATGMayer et al (2014)
zma-miR164cQCATGTGCCCTTCTTCTCCATCMayer et al (2014)
zma-miR164dQCACGTGGTCTCCTTCTCCATMayer et al (2014)
zma-miR164fQCACGTGCGCTCCTTCTCCAACMayer et al (2014)
zma-miR164hTGGAGAAGCAGGGCACGTGTGMayer et al (2014)
zma-miR166hQGGAATGACGTCCGGTCCGAACMayer et al (2014)
zma-miR167bQGATCATGCTGTGACAGTTTCACTMayer et al (2014)
zma-miR167cQGATCATGCTGTGGCAGCCTCACTMayer et al (2014)
zma-miR167eQGATCATGCTGTGCAGTTTCATCMayer et al (2014)
zma-miR167hQGATCATGTTGCAGCTTCACMayer et al (2014)
zma-miR167jQGATCATGTGGCAGTTTCATTMayer et al (2014)
zma-miR169aQGGCAAGTTGTTCTTGGCTACAMayer et al (2014)
zma-miR169cQGGCAAGTCTGTCCTTGGCTACAMayer et al (2014)
zma-miR169dTAGCCAAGGAGACTGCCTATGMayer et al (2014)
zma-miR169eTAGCCAAGGAGACTGCCTACGMayer et al (2014)
zma-miR169fQGGCATGTCTTCCTTGGCTACTMayer et al (2014)
zma-miR169lTAGCCAGGGATGATTTGCCTGMayer et al (2014)
zma-miR169oQGGCAGGTCTTCTTGGCTAGCMayer et al (2014)
zma-miR171aTGATTGAGCCGCGCCAATATMayer et al (2014)
zma-miR171aQTATTGGCGAGGTTCAATCAGAMayer et al (2014)
zma-miR171bTTGAGCCGTGCCAATATCACMayer et al (2014)
zma-miR171bQGATATTGGCGCGGTTCAATCMayer et al (2014)
zma-miR171cQTATTGGTGCGGTTCAATCAGAMayer et al (2014)
zma-miR171dQTGTTGGCTCGGCTCACTCAGAMayer et al (2014)
zma-miR171fQCGATGTTGGCATGGCTCAATCMayer et al (2014)
zma-miR171hQTGGTATTGTTTCGGCTCATGTMayer et al (2014)
zma-miR171lQTATTGGCGTGCCTCAATCCGAMayer et al (2014)
zma-miR171mQTATTGGCGCGCCTCAATCCGAMayer et al (2014)
zma-miR172bQCAGCACCATCAAGATTCACAMayer et al (2014)
zma-miR172cQCAGCACCACCAAGATTCACAMayer et al (2014)
zma-miR2118gTTCCTGATGCCTCCTATTCCTAMayer et al (2014)
zma-miR2275a-3pTTTGTTTTCCTCCAATATCTCAMayer et al (2014)
zma-miR2275b-5pAGGATTAGAGGCAACTGAACCMayer et al (2014)
zma-miR2275d-3pTTTGTTTTCCTCTAATATCTCAMayer et al (2014)
zma-miR319aQGAGCTCTCTTCAGTCCACTCMayer et al (2014)
zma-miR319bQAGAGCGTCCTTCAGTCCACTCMayer et al (2014)
zma-miR393aQATCAGTGCAATCCCTTTGGAATMayer et al (2014)
zma-miR393bQATCAATGCGATCCTTTTGGAGGMayer et al (2014)
zma-miR393cQGTCAGTGCAATCCCTTTGGAATMayer et al (2014)
zma-miR395bQGTTCCCTACAAGCACTTCACAAMayer et al (2014)
zma-miR395cQGTTCCCTGCAAACACTTCACCAMayer et al (2014)
zma-miR395eQGTTCCCTTCAAGCACTTCACATMayer et al (2014)
zma-miR395iQGTTCCCTACAAGCACTTCACGAMayer et al (2014)
zma-miR395kGTGAAGTGTTTGAGGAAACTCMayer et al (2014)
zma-miR395kQGTTTCCTTCAAGCACTTCACATMayer et al (2014)
zma-miR395lQGTTCCTTCCAAACACTTCACCAMayer et al (2014)
zma-miR395mQGTTCCTTTCAAACACTTCACATMayer et al (2014)
zma-miR395nQGTTCTCTACAAGCACTTCACGAMayer et al (2014)
zma-miR395oGTGAAGTGTTTGGGTGAACTCMayer et al (2014)
zma-miR395oQGTTCTCTTCAAGCACTTCACGAMayer et al (2014)
zma-miR396eQGGTCAAGAAAGCCGTGGGAAGMayer et al (2014)
zma-miR396gTCCCACAGCTTTATTGAACTGMayer et al (2014)
zma-miR396gQGTTCAAGAAAGCTGTGGAAGAMayer et al (2014)
zma-miR398aQGGGGCGAACTGAGAACACATGMayer et al (2014)
zma-miR398bQGGGGCGGACTGGGAACACATGMayer et al (2014)
zma-miR399bTGCCAAAGGAGAGCTGTCCTGMayer et al (2014)
zma-miR399fQGGGCAACTTCTCCTTTGGCAGAMayer et al (2014)
zma-miR399hQGTGCAGTTCTCCTCTGGCACGMayer et al (2014)
zma-miR827QTTTGTTGGTGGTCATTTAACCMayer et al (2014)
wheat-miR-201AUUGGGCCAUACGGGAAUAGAXingli Ma et al (2015)
wheat-miR-202GCCUUGAAGACUUUGGCCAUGUXingli Ma et al (2015)
wheat-miR-203ACUUGUGUGUCUAUGGGGUGCCXingli Ma et al (2015)
wheat-miR-204UUAUAUUUUGAUACAGAGGAXingli Ma et al (2015)
wheat-miR-205ACAAUUAUCGUCAUAGAAGUGUCAXingli Ma et al (2015)
wheat-miR-206UCCGUCCCAUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-207UUUGGAUCACGACGAGUACGACXingli Ma et al (2015)
wheat-miR-208AUAGAACUUGGCUUGUAUAUUCCXingli Ma et al (2015)
wheat-miR-209GUUCAUGAACCGGGACUAAAGGCCXingli Ma et al (2015)
wheat-miR-211ACGGCACCACAUACGAUGUAGAUAXingli Ma et al (2015)
wheat-miR-212UCUGUAAAGAAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-213UACCCAAGGACAUCUCUAGAAGAXingli Ma et al (2015)
wheat-miR-214CCCCUACCUGGCGUGCCAXingli Ma et al (2015)
wheat-miR-215GGUGAUCAUGAGGAGUAGAXingli Ma et al (2015)
wheat-miR-216AUAUAAGAACGUUUUUGGCACUXingli Ma et al (2015)
wheat-miR-217GUCCGGACAGCUGUGGUAGUGUUXingli Ma et al (2015)
wheat-miR-218UAGCAGACGGCAAAGAAAGUGGCCXingli Ma et al (2015)
wheat-miR-219AAACUGGAUCAAACACUUGGCAUUXingli Ma et al (2015)
wheat-miR-220UUCUUAUAUUGUGGGAUAGAGXingli Ma et al (2015)
wheat-miR-221UCUGUAAACUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-222UGAGCCGAACCAAUAUCACUCXingli Ma et al (2015)
wheat-miR-223UGGGCACAACCCACCAGGGCGXingli Ma et al (2015)
wheat-miR-224CUCCGUUCCAAAAUAGAUGACXingli Ma et al (2015)
wheat-miR-225AGGGAUGGAGCGCAGAUUXingli Ma et al (2015)
wheat-miR-226AUGAUACGUCGACACGUGGCACGGXingli Ma et al (2015)
wheat-miR-227UCUUCUAUAGAAAUAGGCACCAXingli Ma et al (2015)
wheat-miR-228AGGACCUUAGGUAGGACGUAUAGXingli Ma et al (2015)
wheat-miR-229UUCCUCGUCGGAAUCCGGAACCUXingli Ma et al (2015)
wheat-miR-230CCAUGAUGAGGUCGUUCAACCXingli Ma et al (2015)
wheat-miR-231UUCCAAAGGGAUCGCAUUGAUXingli Ma et al (2015)
wheat-miR-232UCCGUCCGAAAAUACUUGUCAXingli Ma et al (2015)
wheat-miR-233UCCGUAAACUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-234GAUCUUGAUCGUACACAUUUGCGUXingli Ma et al (2015)
wheat-miR-235CCUCUGUAAACUAAUAUAAGAXingli Ma et al (2015)
wheat-miR-236UAUAUUAGUUUACAGAGGGAGXingli Ma et al (2015)
wheat-miR-237ACAAGUAUUUUCGGACGGAGGXingli Ma et al (2015)
wheat-miR-238UGAAAGCAAUGUCGCAAGUUAGGXingli Ma et al (2015)
wheat-miR-239ACAUAGUUCUCGAACCCGUAGGGUXingli Ma et al (2015)
wheat-miR-240AAUGGUUUGUGAUUUGUGAAUGCCXingli Ma et al (2015)
wheat-miR-241UCCGUAAACUAAUAUAAGAGUXingli Ma et al (2015)
wheat-miR-242AGAGAAUUCCUUAUUUGACACUACXingli Ma et al (2015)
wheat-miR-243AAAACGUCUUACAUUAUGGGAXingli Ma et al (2015)
wheat-miR-244AUCAGUACCCAGGGGACACGGUACXingli Ma et al (2015)
wheat-miR-245UCCGUCCCACAAUAUAAGAUCXingli Ma et al (2015)
wheat-miR-246CGCCCCACGGUGGGCGCCAXingli Ma et al (2015)
wheat-miR-247GCGGUUAUGCCUCUAAGUCGUGCCXingli Ma et al (2015)
wheat-miR-248AUCUCCGCGUUGUAUUUUCUAGAAXingli Ma et al (2015)
wheat-miR-249AUCUUAUAUUGUGGGACAGAGXingli Ma et al (2015)
wheat-miR-250CGCGGCACCCACGAAUGUUAUXingli Ma et al (2015)
wheat-miR-251GCCCCUACCGUCUCGUGGXingli Ma et al (2015)
wheat-miR-252AAAUGGAUGUAUCUAGACGUAUUXingli Ma et al (2015)
wheat-miR-253UACACCAACCGGGACAGAUGGGCCXingli Ma et al (2015)
wheat-miR-254GAAGAAGGUUGUGUAGUAGACAUCXingli Ma et al (2015)
wheat-miR-255CAUUAGUAACUCGCCACACAGAUXingli Ma et al (2015)
wheat-miR-256UCUCCUGUAGAAAUAGGCACCXingli Ma et al (2015)
wheat-miR-257AGGUAUGUCUGUGUAGUCCGAAUCXingli Ma et al (2015)
wheat-miR-258CAAAUUUGAAGGGAGACAACUAGXingli Ma et al (2015)
wheat-miR-259CCGUGGCCAAGGUCUCUUGAGGCUUXingli Ma et al (2015)
wheat-miR-260ACUAAGAGUUAGCUGUAGCGCCUXingli Ma et al (2015)
wheat-miR-261GACCGCGUGGCCUAAUGGXingli Ma et al (2015)
wheat-miR-262AAAAAUUGUUAGUAGUGGCGCACCXingli Ma et al (2015)
wheat-miR-263AUCUAUUUUGGAACGGAGGGAXingli Ma et al (2015)
wheat-miR-264AUCGAGAUUAGGAUUUGUCACUCCXingli Ma et al (2015)
wheat-miR-265CUUGCCGGCGCGUGCGUGCAUCCGXingli Ma et al (2015)
wheat-miR-266AUGACGAGAACCACUUAGUAGUAGXingli Ma et al (2015)
wheat-miR-267AGUAAAGUUACCGAUGAACGAAGXingli Ma et al (2015)
wheat-miR-268UUAUAAUUUGGGACAGAGGAXingli Ma et al (2015)
wheat-miR-269UUGGGUCAUCUAUUUUGGAACXingli Ma et al (2015)
wheat-miR-270UUUGCAUGACCGAGGAGCCGCXingli Ma et al (2015)
wheat-miR-271AUGAAUACCGGAGUCCUGUUAGCCXingli Ma et al (2015)
wheat-miR-272GAUGCGGGGUCUGCUAGAGUUGCUXingli Ma et al (2015)
wheat-miR-273GUGCCGGAGUUGAACUAUAGCUUCUXingli Ma et al (2015)
wheat-miR-274UCCAAACCUGUAUGCGGACGXingli Ma et al (2015)
wheat-miR-275AGAGCAGAGAUUGAAGAAGCACGAXingli Ma et al (2015)
wheat-miR-276UCCGUAAAGAAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-277UAGUGAUCUAAACGCUCUXingli Ma et al (2015)
wheat-miR-278AUCGGGAUUUGUCGGCACAUCXingli Ma et al (2015)
wheat-miR-279CCCGGGACAUGCCAUAGUAGUAGXingli Ma et al (2015)
wheat-miR-280AUUCCGAGAACUUUUAUUUCUGCAXingli Ma et al (2015)
wheat-miR-281UCCGUUCCUAAAUAUUUGUCUXingli Ma et al (2015)
wheat-miR-282ACGAAGACCGAAGACUGCACCCGUXingli Ma et al (2015)
wheat-miR-283AGAACAGCGGGGAGGUGCUGCXingli Ma et al (2015)
wheat-miR-284AUAAUAUAAGAGCGUUUUUGACACXingli Ma et al (2015)
wheat-miR-285ACUCCCGGAUACCGUAGGAAUGCUXingli Ma et al (2015)
wheat-miR-286GCUAUGGUGUUGAUGUAGAAGCCCXingli Ma et al (2015)
wheat-miR-287ACAUUCGUGGAAGUCGUGGCAXingli Ma et al (2015)
wheat-miR-288AAAACAUCCUAGCUCAACUGXingli Ma et al (2015)
wheat-miR-289ACGUUACUUGCCCGAGAUUCGAUCXingli Ma et al (2015)
wheat-miR-290AAGGCAGGUGCCUUAAGGCACXingli Ma et al (2015)
wheat-miR-291AUGGGGUAAUCUCAUCUCAACXingli Ma et al (2015)
wheat-miR-293UGCAUGCCGUCGUCUGUACUCCCUXingli Ma et al (2015)
wheat-miR-294CAGAUCCGAGACCGUGGAAGACGXingli Ma et al (2015)
wheat-miR-295GCACACAUUGGACUGGAAGGCUGXingli Ma et al (2015)
wheat-miR-296AAAGAAUCUUUGCCGUCUGCUGGCAXingli Ma et al (2015)
wheat-miR-297AAAUUGUAGCCAAGAGAUUCAACGXingli Ma et al (2015)
wheat-miR-298UGCCCUACCCAAACGGACAGAAUCXingli Ma et al (2015)
wheat-miR-299UUCUAGGACUCUUCUUUUXingli Ma et al (2015)
wheat-miR-300GUUCCAGAACCGGUACUAAAGGUCXingli Ma et al (2015)
wheat-miR-301UUCCGCGAGAGGCACGGUUGUGAUXingli Ma et al (2015)
wheat-miR-302CAUCAACCGUGGUAACCUXingli Ma et al (2015)
wheat-miR-303UUAUGGAACGGAGGGAGUACUXingli Ma et al (2015)
wheat-miR-304UUACAUUAUGGGACGGAGGGAGUXingli Ma et al (2015)
wheat-miR-305UAUAGUGACCUAUCAUGGCAAUUXingli Ma et al (2015)
wheat-miR-306AUGUCAAGUGAACUCGGUGGCGCCXingli Ma et al (2015)
wheat-miR-307GACAUCCGGAGUCCUGCCUAGCCUXingli Ma et al (2015)
wheat-miR-308AAUAUGGACAUUAAUGGCGCACCAXingli Ma et al (2015)
wheat-miR-309CCCAGACAACCAGUCGGAAGCGGCXingli Ma et al (2015)
wheat-miR-310AAUGGAGCAGUUGGUAGUCUCGCUXingli Ma et al (2015)
wheat-miR-311GAUAAGAUAGUGAUUGAUAGAGUXingli Ma et al (2015)
wheat-miR-312GUGAAGUGCUUGGGGGAACUXingli Ma et al (2015)
wheat-miR-313AUAUUCGGACAUCGGAAAGGUUCCXingli Ma et al (2015)
wheat-miR-314ACAAGUAUUUCCGGACGGAGGXingli Ma et al (2015)
wheat-miR-315ACAUCAAUCGACAAACCUGAGGCAUXingli Ma et al (2015)
wheat-miR-316UCACUGAAUGGUCACUGUUUXingli Ma et al (2015)
wheat-miR-317UGUCUACCGUGAAGUUGUGCACUCXingli Ma et al (2015)
wheat-miR-318AGUUUGGACCAACACUCAGAGGAGXingli Ma et al (2015)
wheat-miR-319CACGAGAUCGUAAUGGCUAAACCCXingli Ma et al (2015)
wheat-miR-320AUGAUACGUCGACACGUGGCACGXingli Ma et al (2015)
wheat-miR-321GCUUAGGCUUUUGGUUGUCCUXingli Ma et al (2015)
wheat-miR-322ACUUGUGCACGGGCAGUCAGAGCCXingli Ma et al (2015)
wheat-miR-323AAAGGCUGCAGCGGUACUACCXingli Ma et al (2015)
wheat-miR-324CACCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-325AUUUGACGGUAUGCUUUGUGUAACXingli Ma et al (2015)
wheat-miR-326AUCCGAGUGGCGGCAGCAXingli Ma et al (2015)
wheat-miR-327UUGUGGUGGCCUUCGGGAXingli Ma et al (2015)
wheat-miR-328AAGGAAGUCACCUCGGUCUCGAGAXingli Ma et al (2015)
wheat-miR-329AAUUAGAGCACGUGGCUGXingli Ma et al (2015)
wheat-miR-330AACUGAAUUUGAAAUGAUXingli Ma et al (2015)
wheat-miR-331AGAGGAGAACCCAAAACAXingli Ma et al (2015)
wheat-miR-332UGGGAAGCUGCAUCUGCAXingli Ma et al (2015)
wheat-miR-333GCACCCUAGAACACACAAGUUGAUXingli Ma et al (2015)
wheat-miR-334AUAAAUACAUGGGUAUGGGCACUCXingli Ma et al (2015)
wheat-miR-335CACGUGGGAGAUAUAGCCGCAXingli Ma et al (2015)
wheat-miR-336AACGCUUGUGUCUGUACUGAUGCUXingli Ma et al (2015)
wheat-miR-337AUUCCAGAACCGGGACUAAAGGCCXingli Ma et al (2015)
wheat-miR-338GCCAAAUUGGAAGGGUGUUGGGCUXingli Ma et al (2015)
wheat-miR-340UGGACCUGCCUCGACGUCAUCUXingli Ma et al (2015)
wheat-miR-341UCUAGUCUAGUCCCUGUAACCAAAXingli Ma et al (2015)
wheat-miR-342GGGCCCAUGUAGGUGGCAUGACAAXingli Ma et al (2015)
wheat-miR-343UUUCCCGGCUAGUGCACCXingli Ma et al (2015)
wheat-miR-344AUCUAUUUUGGAACGAAGGGAXingli Ma et al (2015)
wheat-miR-345UCGGACCCGGCGUCAUUCCCCXingli Ma et al (2015)
wheat-miR-346UUGGUGGCUUGAACCGGGACCXingli Ma et al (2015)
wheat-miR-347CCCCCCUGACUGCUGGGACCXingli Ma et al (2015)
wheat-miR-349ACAUGUCAGUGACCCAAAGGCXingli Ma et al (2015)
wheat-miR-350UGUGUUUCGUUGGCUCCCXingli Ma et al (2015)
wheat-miR-351UUACAGACGGCAAAGUGAGCUCUUXingli Ma et al (2015)
wheat-miR-352AUCCGUAUUUAGACAAAUCUAAGAXingli Ma et al (2015)
wheat-miR-353GGGACCUUUCUUUGGAUAXingli Ma et al (2015)
wheat-miR-354UGUUGACUAAGUUGACAAAGCCCUXingli Ma et al (2015)
wheat-miR-355GCUGGCUCUGUUACCGGCGUGAACXingli Ma et al (2015)
wheat-miR-356AAACGUUCUUAUAUUAUGGGAXingli Ma et al (2015)
wheat-miR-357AUUAACGGGCCAGAUCUGGCUUCGXingli Ma et al (2015)
wheat-miR-358UUUUGUCACGGCAGAUGUCCUAGXingli Ma et al (2015)
wheat-miR-359UUGCAACUGGGACAACAACAAXingli Ma et al (2015)
wheat-miR-360GUUUGAGAAACGGAUGACCGAGACXingli Ma et al (2015)
wheat-miR-361UUCCUCAGACCCAAUACCCAUUXingli Ma et al (2015)
wheat-miR-362UAGUUCAAGGAGAAUACGGUGAGGXingli Ma et al (2015)
wheat-miR-363UCCCCAGCGGAGUCGCCAXingli Ma et al (2015)
wheat-miR-364AAGAUAUGACUCUAUAUGAAUGCCXingli Ma et al (2015)
wheat-miR-365UCGACCACAGUCUCGGGGACUXingli Ma et al (2015)
wheat-miR-366AGCCCAGCAGCCGCACCAXingli Ma et al (2015)
wheat-miR-367CCCUUCGGCCGUAGUACCGCAXingli Ma et al (2015)
wheat-miR-368ACGGGUGCGCUGCGACCGGCCXingli Ma et al (2015)
wheat-miR-369GACAAGUAUUUUCGGACGGAGGGAXingli Ma et al (2015)
wheat-miR-370AAAAAUUGUUACUAGUGGCGCACCXingli Ma et al (2015)
wheat-miR-371CGAGUGCUUGUAACCUGAGXingli Ma et al (2015)
wheat-miR-372AGCCUUUGUUGGGCAUGUCGAGAAXingli Ma et al (2015)
wheat-miR-373AUCCUACUUGGGGCGCCUXingli Ma et al (2015)
wheat-miR-374AAUUAACUGAUGCUGAAAUGXingli Ma et al (2015)
wheat-miR-375ACGGUAUAUGUGGAUUGCACUAGCXingli Ma et al (2015)
wheat-miR-376UUCGCCGGAGCAGCGUGCUGUGAXingli Ma et al (2015)
wheat-miR-377AAUUUCCGUGCCAAAAACUAUACAXingli Ma et al (2015)
wheat-miR-378AGUCCCGAGGCACCCACGAGXingli Ma et al (2015)
wheat-miR-379AAUGUAAGACGUUUUUUGACACUAXingli Ma et al (2015)
wheat-miR-380CCUCCGUCCCAUAAUGUAAGAXingli Ma et al (2015)
wheat-miR-381GAGUGUAUGCGCGUGUAUAUGAGCXingli Ma et al (2015)
wheat-miR-382UCCGUCCGGAAAUACUUGUCCXingli Ma et al (2015)
wheat-miR-383CUCAGCCCCUCUUAUAGCGUXingli Ma et al (2015)
wheat-miR-384AUGAACCGGGACUAAAGGGCAGCCXingli Ma et al (2015)
wheat-miR-385AAUGUAAGACGUUUUUUGACACUXingli Ma et al (2015)
wheat-miR-386GGGGGCCGCAGUGACCAGGCCCGGGXingli Ma et al (2015)
wheat-miR-387UUGAAACUGUAGAUGUGCGGUXingli Ma et al (2015)
wheat-miR-388GUUUUUUGUUCGUUUGGAUCGGCCXingli Ma et al (2015)
wheat-miR-389AGGUUUCACUAUAGACCACAUACGXingli Ma et al (2015)
wheat-miR-390GACCUGUAUGGGGCACCAXingli Ma et al (2015)
wheat-miR-391AAAACGGACAAACCAGACAGCCCXingli Ma et al (2015)
wheat-miR-392UCGUCUCUGAAUCGUCCAAGAXingli Ma et al (2015)
wheat-miR-393GGUGGCUGUAGUUCGGUGGUXingli Ma et al (2015)
wheat-miR-394AAAUAUUGGCUAGAGAUUGGUUGCXingli Ma et al (2015)
wheat-miR-395AGGGUUUAGUCCGUAGAGGCAAUCXingli Ma et al (2015)
wheat-miR-396UCCCGACUGCCAGGCACUUCCXingli Ma et al (2015)
wheat-miR-397AAUUAAUAUGGAUCGGAGGGAXingli Ma et al (2015)
wheat-miR-398AGCCCAGAGAUCGAGGAGAAGUCUXingli Ma et al (2015)
wheat-miR-399UCCGUUCCUAAAUGUAAGUCUXingli Ma et al (2015)
wheat-miR-400AGACACUUAUUUUGGGACGGAXingli Ma et al (2015)
wheat-miR-401CGGAUUGUGACUGAACGCCGXingli Ma et al (2015)
wheat-miR-402AACUAACUCUAACCCAUGGAUCCAXingli Ma et al (2015)
wheat-miR-403AAUAGAUGACCCAACUUUGUXingli Ma et al (2015)
wheat-miR-404GAGGAAACGGACUUGUGUUGGAGCXingli Ma et al (2015)
wheat-miR-405UUCGCCGGUGACGCGUUUCCCUXingli Ma et al (2015)
wheat-miR-406AAACGUCUGGGCUGACCGGCACCCXingli Ma et al (2015)
wheat-miR-407AUAUUAUGGGACGGAGGGAGUXingli Ma et al (2015)
wheat-miR-408UAAACCGGAUUUUUCUGAAGCACCXingli Ma et al (2015)
wheat-miR-409AUAUACUAAUGGCGCAUCUGAGGUXingli Ma et al (2015)
wheat-miR-410AAAAGUCCCUGUAAACAAACACCCXingli Ma et al (2015)
wheat-miR-411AUGUAGAACCACCCCGAUUXingli Ma et al (2015)
wheat-miR-412GCCCGGGCAGUUAGGUAAAGUCACAXingli Ma et al (2015)
wheat-miR-413UCGUAAACUGAAAUUAACGACCUXingli Ma et al (2015)
wheat-miR-414UCCAUGACUGAAUAAUAAAUACGXingli Ma et al (2015)
wheat-miR-416AUUCUUGUCUUAGAUUUGUCUAGAXingli Ma et al (2015)
wheat-miR-417AGCGUGACUGGGAGCUAGGUCGCCXingli Ma et al (2015)
wheat-miR-418AGUAGAACCAAGUCGACUGCCXingli Ma et al (2015)
wheat-miR-419GCGACUGGGCCGAUUUUUUGGCGCXingli Ma et al (2015)
wheat-miR-420UCACCGGCGCUGCACACAAUGXingli Ma et al (2015)
wheat-miR-421UAUCCUGUACAAAUAAGCACCXingli Ma et al (2015)
wheat-miR-422ACGAUGUGGUAGAUGCAUXingli Ma et al (2015)
wheat-miR-423AAAAAAAGUUACUAAUGGCGCACCXingli Ma et al (2015)
wheat-miR-424AGAUAUCAUGACCAAGGGCUUGCCXingli Ma et al (2015)
wheat-miR-425CACCAAGAUGUACGAGUUCAGGCCXingli Ma et al (2015)
wheat-miR-426GCCGGACUCAUCGUCAUUGAAGCCXingli Ma et al (2015)
wheat-miR-427GAAAUGUUGGGUGGCUGUGGCACAXingli Ma et al (2015)
wheat-miR-428AAUUACUUGUCGCAGAAAUUAAUGXingli Ma et al (2015)
wheat-miR-429AGGAUAUUUUACUGCCGGCGCCCAXingli Ma et al (2015)
wheat-miR-430AGUGAAAUCUCUCCAAAGACUXingli Ma et al (2015)
wheat-miR-431AACCUAGAGACUCGUAGUAGCACGXingli Ma et al (2015)
wheat-miR-432UCCGCGAUCAUCAUGACCAAAXingli Ma et al (2015)
wheat-miR-433AGACACAACAAUUGAUCGXingli Ma et al (2015)
wheat-miR-434GAUCCGGUCGGUCUUGAGCUCGCCXingli Ma et al (2015)
wheat-miR-435CGGGGAGCUUUGUCCCAUUXingli Ma et al (2015)
wheat-miR-437CAAGAAUAAAGUUGCGUAGUAGACXingli Ma et al (2015)
wheat-miR-438AGGGCACCAAUAGUGGAAUCACGGXingli Ma et al (2015)
wheat-miR-439ACAUAUCUGGUUGUUGCCUGCUGAXingli Ma et al (2015)
wheat-miR-440AGUAGUAUACUUUUGACAUGCACCXingli Ma et al (2015)
wheat-miR-441AACGCGGUUGAUGUAGUCGXingli Ma et al (2015)
wheat-miR-442UCCGUCCCAAAAUAAUUGUCUXingli Ma et al (2015)
wheat-miR-443GUUUCUACGGCCCGUAGAAGGCCCXingli Ma et al (2015)
wheat-miR-444UGAAGCAGUCUGGACCGACAUUXingli Ma et al (2015)
wheat-miR-445UGCGUCAUUAGUGUGAACUAAGAXingli Ma et al (2015)
wheat-miR-446GCAGGCACACCAUCAUCACCXingli Ma et al (2015)
wheat-miR-447AGUGGAACUCUCAAUGAAAGCACCAXingli Ma et al (2015)
wheat-miR-448CGGGUUCAGUUAGAGCCAACGCCUXingli Ma et al (2015)
wheat-miR-449CACCCCCUACCUGGCGCGCCAXingli Ma et al (2015)
wheat-miR-450ACUGGGCUCAGUCGGCCUGCAGCGXingli Ma et al (2015)
wheat-miR-451GUUCACUAGUUCGGCUGCGGUGUGXingli Ma et al (2015)
wheat-miR-452UGACAGAAAAGAGAGAGCACXingli Ma et al (2015)
wheat-miR-453AAAGAUCGAUAUAUUGGACGACUXingli Ma et al (2015)
wheat-miR-454UUUCGUCGACUCCCCUAGGGUUUCXingli Ma et al (2015)
wheat-miR-455AUAGCCGGUAUCAUGCACUCGGGAXingli Ma et al (2015)
wheat-miR-456UGCAGAUGAGGAGACAUGXingli Ma et al (2015)
wheat-miR-457AAAAAGUCCCUAGGAACCAAACGXingli Ma et al (2015)
wheat-miR-458AACGGUAGUACCGUAGGCAUCCAXingli Ma et al (2015)
wheat-miR-459CUUCGCCGGCUGCGCGUUCGCCUXingli Ma et al (2015)
wheat-miR-460GGGCACCGCACACGGCUAAGGAAXingli Ma et al (2015)
wheat-miR-461CUCUUAUAUUAUGGGACGGAXingli Ma et al (2015)
wheat-miR-462CGAAAUGGACUUUUCGGCCUUGCCXingli Ma et al (2015)
wheat-miR-463ACUGAUGUGAUGGGUCAUUGUAAAXingli Ma et al (2015)
wheat-miR-464GCACCCCAUGACACACAAGUUGAUXingli Ma et al (2015)
wheat-miR-465AUGUAUAUUGUAUAGCCUGGCCCAXingli Ma et al (2015)
wheat-miR-466AAAUCGUGUCCGCCUGGCGUCCGCXingli Ma et al (2015)
wheat-miR-467AAAAAUUGUUAGCAGUGGCACACCXingli Ma et al (2015)
wheat-miR-468UGGUUAGAGGGACUGUGGUAUCCCXingli Ma et al (2015)
wheat-miR-469GCCCCUCGCGUCUAGUGGXingli Ma et al (2015)
wheat-miR-470UUUGUAACCGACCUUGUGUAACCCXingli Ma et al (2015)
wheat-miR-471UCCUCAGUAGCUCAGUGGXingli Ma et al (2015)
wheat-miR-472UCGGUUGGCCACCGUGGCACCXingli Ma et al (2015)
wheat-miR-473GAUUUUUUGUCAUAGAAGUAGGAGXingli Ma et al (2015)
wheat-miR-474ACCCACUGGGUGUAGCCCCCGAGAXingli Ma et al (2015)
wheat-miR-475CACUAGUAGAAAAAGGGCCUAAUGXingli Ma et al (2015)
wheat-miR-476AUAUCCAAUCCGCAUGUUUGUGCUXingli Ma et al (2015)
wheat-miR-477AAAAAAUAUUGAGCCGAGUXingli Ma et al (2015)
wheat-miR-478AUACGUCCUACCCAAGGUCACUXingli Ma et al (2015)
wheat-miR-479AAAUAGAUGACUCAACUUUGUACUXingli Ma et al (2015)
wheat-miR-480AGGGCACUGCAUGCUCUGGCCUGCXingli Ma et al (2015)
wheat-miR-481GCCCGAUCCUCUGGUAGAUCAGAXingli Ma et al (2015)
wheat-miR-482UCAUUGUCCUGCUGCUCACUGUXingli Ma et al (2015)
wheat-miR-483AGAGACCACUUAGUAGUAGCGAGGXingli Ma et al (2015)
wheat-miR-484GGGGUUGUAGCUCAGAUGGUAGAAXingli Ma et al (2015)
wheat-miR-485UUACCACGAGUGAUUGGGCGAGXingli Ma et al (2015)
wheat-miR-486AUAUAAGAGCGUUUAGAUCACXingli Ma et al (2015)
wheat-miR-487ACGAGAAGGGAGUAGUUCACCCUCXingli Ma et al (2015)
wheat-miR-488UGGCCCAGAGGUUGUCUGACAGACXingli Ma et al (2015)
wheat-miR-489UGAGGAAGGACUUCAUCAUCAXingli Ma et al (2015)
wheat-miR-490UAGCCGUCGGCAUACCUGCGCXingli Ma et al (2015)
wheat-miR-491UAUGUUACUCCCACUAUGACCXingli Ma et al (2015)
wheat-miR-492AAAAACCACUGAUCGGCGGAUUUGXingli Ma et al (2015)
wheat-miR-493CCAACCGGGACUAAAGGUUAGACCXingli Ma et al (2015)
wheat-miR-494CACAUCUUGCCAAUUUUGGACAGCAXingli Ma et al (2015)
wheat-miR-495CGACCGAGUUUGGUGAAUUGUGUGXingli Ma et al (2015)
wheat-miR-496UUUACUUGUGCAUGGGCAGUCAGXingli Ma et al (2015)
wheat-miR-497AGAUACCUUAAGCUUCUGACCXingli Ma et al (2015)
wheat-miR-498UUGGAGUCGGUGCUGUGCUCGAGCAXingli Ma et al (2015)
wheat-miR-499GGGGCUGUAGCUCCGUGGAXingli Ma et al (2015)
wheat-miR-500ACGGACGCGUCGGGUCUACACGGXingli Ma et al (2015)
wheat-miR-501AUGUGAUAGAUCUUCCAAGCGAUAXingli Ma et al (2015)
wheat-miR-503AUGUCACCUAGAUACUCCAAUGUCXingli Ma et al (2015)
wheat-miR-504UCACUGAAAGGUCGCUGUUUXingli Ma et al (2015)
wheat-miR-505AUUGGACCCGGUUCGUGAGCCXingli Ma et al (2015)
wheat-miR-506AAGUCUGUGUUGGAUGGCAAACCGXingli Ma et al (2015)
wheat-miR-507CGUUCAACUCGAUGACGUCCCXingli Ma et al (2015)
wheat-miR-509CAGCCCGCUGUGGAAGCGCCUXingli Ma et al (2015)
wheat-miR-510AUACGGAUGUAUCUAGACAXingli Ma et al (2015)
wheat-miR-511CAUAGUUACUCUGAUAGGGXingli Ma et al (2015)
wheat-miR-512AUGUGAUCACGGACAUGACGAGGAXingli Ma et al (2015)
wheat-miR-513AAAAAUUGUUAGUAAUGGCGCACCXingli Ma et al (2015)
wheat-miR-514UAUUAGAGCGGAAAGGACCCGCGGAXingli Ma et al (2015)
wheat-miR-515ACACUGUAUAGUGUGGCGCXingli Ma et al (2015)
wheat-miR-516ACACCGCAUUUGUCGAUAGACGGGXingli Ma et al (2015)
wheat-miR-517CCGAACUGUGCGUCUAGGCGGAUGXingli Ma et al (2015)
wheat-miR-518AGGUCCUGUUGAUCGGGAGGGGUGXingli Ma et al (2015)
wheat-miR-519UCGCUUCGGGACCCCAAAACXingli Ma et al (2015)
wheat-miR-520GAAACGGACGCGCGCGGACGGCCAXingli Ma et al (2015)
wheat-miR-521UCCUACGAUCGAAACGGGGGUCCUXingli Ma et al (2015)
wheat-miR-522UCCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-523GUGCAUCAGAAUUGUAACUXingli Ma et al (2015)
wheat-miR-524UUGCCUCCGCCUCGGCAUCGXingli Ma et al (2015)
wheat-miR-525GAUCCGGCCCGACUGCUCAGCAGUXingli Ma et al (2015)
wheat-miR-526CCGCUGAGGAGUCACAAGCGGCAGXingli Ma et al (2015)
wheat-miR-527GCAUAGGAGGUGAGCUAGAGCACCXingli Ma et al (2015)
wheat-miR-528CCCUGGUGGGUUAUGCUCACCXingli Ma et al (2015)
wheat-miR-529AGGUGGGGCUGUGACAUGUUGAUCXingli Ma et al (2015)
wheat-miR-530CGGGAUCCCAAGUCUGAUCGGAUXingli Ma et al (2015)
wheat-miR-531GAAAUGUUGGGCGGCUGUGGCACAXingli Ma et al (2015)
wheat-miR-532AGCAAAACCGUGCCUCUCGAGGAAXingli Ma et al (2015)
wheat-miR-533AAUUUGUCUUUUUUGCUGAGAGCUXingli Ma et al (2015)
wheat-miR-534UCGGGGGGCAUUCCGAUUUCXingli Ma et al (2015)
wheat-miR-535CUUAUAUUAUGGAACGGAGGGAGXingli Ma et al (2015)
wheat-miR-536AUGGCACCAACCGGUACUAAAGCCXingli Ma et al (2015)
wheat-miR-537CAUUCAUGCCCGGCCAGAGCGGACXingli Ma et al (2015)
wheat-miR-538CACGCCUGUUUGGUUGUCACCUGXingli Ma et al (2015)
wheat-miR-539CUAUAUCACUUGACUGAGACUXingli Ma et al (2015)
wheat-miR-540GAGUCCCUGAUCUUGAUCGUACACXingli Ma et al (2015)
wheat-miR-541AGUGAUCGUCCGUGUCUUUGGUCCXingli Ma et al (2015)
wheat-miR-543UUCCAAAUUACUCGUCGUGGUXingli Ma et al (2015)
wheat-miR-544GGAAAAUAAGAAACUACCAGGAAXingli Ma et al (2015)
wheat-miR-545UAUCUCGUUCUCAGGGCACACXingli Ma et al (2015)
wheat-miR-546AGUCACUUGUUGAAAUCUCUAGAXingli Ma et al (2015)
wheat-miR-547GCUCGAUGAUGGCUACUUXingli Ma et al (2015)
wheat-miR-548UCUUCUUGUAGACGUUGUUGGGCCXingli Ma et al (2015)
wheat-miR-549UAGGACUAGGGUUCCUACCGXingli Ma et al (2015)
wheat-miR-550CUCUGGGCGUUAAUGUUACAACAUXingli Ma et al (2015)
wheat-miR-551AAUACUUGUCGGAGAAAUGGXingli Ma et al (2015)
wheat-miR-552UUAUAUUAUGGGACCGAGGGXingli Ma et al (2015)
wheat-miR-554UUAGUACCGGUUCGUGGCACCAACXingli Ma et al (2015)
wheat-miR-555AUCUUAUAUCAUGGGACGGAGXingli Ma et al (2015)
wheat-miR-556AUGUUACUAGUCUAUGUUACUACCXingli Ma et al (2015)
wheat-miR-557AGGACAACGCUAACGCCCACACGUXingli Ma et al (2015)
wheat-miR-558GUGAUUCACUUCGUUCCUGUXingli Ma et al (2015)
wheat-miR-559UGGUUUGGUCAGGGCUGGAAUAUXingli Ma et al (2015)
wheat-miR-560AGAACUAUGUAGACAUGACCGAGAXingli Ma et al (2015)
wheat-miR-561AAAGUUAGUAAUGGCGCACCGUGGXingli Ma et al (2015)
wheat-miR-562AGCCAGUGACUGUAUAAUCAUGACXingli Ma et al (2015)
wheat-miR-563UCGUCCCCGGCAAUGGAGCCAXingli Ma et al (2015)
wheat-miR-564AAGAAUAACUAUUCCUCACCCAGXingli Ma et al (2015)
wheat-miR-565AGUCUCUGCCAAUUCUUCGUGXingli Ma et al (2015)
wheat-miR-566UUGGAUUCCAGUCGGCCUACAGCUXingli Ma et al (2015)
wheat-miR-567AACUGCAGUUGCCAUCCACAACGUXingli Ma et al (2015)
wheat-miR-568AUGCGGGGUCUGCUAGAGAUGCUXingli Ma et al (2015)
wheat-miR-569AUUCCUUCGCUACUGCUGCUAACUXingli Ma et al (2015)
wheat-miR-570AUCUCGUGGUAGAUCAACUCUUGUXingli Ma et al (2015)
wheat-miR-571UCUUAUAUUAUUGGACGGAGAXingli Ma et al (2015)
wheat-miR-572UCUUAUACUGUGGAACGGAGGXingli Ma et al (2015)
wheat-miR-573AAUGGACUCGUAUAAAAGGAUAUUXingli Ma et al (2015)
wheat-miR-574AUCGGAUUGUCUUGGGAGAAGGAAUXingli Ma et al (2015)
wheat-miR-575CCGGUUUUGACACCGACAUUGGUXingli Ma et al (2015)
wheat-miR-576CCGUUCCGAAUUACUUGUCGCXingli Ma et al (2015)
wheat-miR-577UUCGGUUGAGAAUCGGGCACCXingli Ma et al (2015)
wheat-miR-578UUGGGGAACGUUGCAGAAAAUUAXingli Ma et al (2015)
wheat-miR-579AAGGAAGUGAGGAGGCUGGAXingli Ma et al (2015)
wheat-miR-580GCUCCCCCGUCGAGCGUGGCUXingli Ma et al (2015)
wheat-miR-581GCGGGGAUCGGAUUGCAGUXingli Ma et al (2015)
wheat-miR-582AGACGCCCGACUGUGGCAUGCUUXingli Ma et al (2015)
wheat-miR-583ACAAACCGGGACUAAAGAGAGGCCXingli Ma et al (2015)
wheat-miR-584UAUUCCAAUGAUGGGCUUCCUCAAXingli Ma et al (2015)
wheat-miR-585UCAAAACUACUAAUGGCGCACCGUXingli Ma et al (2015)
wheat-miR-586AUUUUGGCCCGGUACUAAUGGUACXingli Ma et al (2015)
wheat-miR-587GUGUCUACGACUGUGGCCGGCGGCXingli Ma et al (2015)
wheat-miR-588AGAUGAUGGUAGCAACUACACGXingli Ma et al (2015)
wheat-miR-589GCGGACCCAGGCCGAACCCGGCGCXingli Ma et al (2015)
wheat-miR-590UACGGCAAAGCCGUCGGCAUAXingli Ma et al (2015)
wheat-miR-591GUUGAAGUGUAUAUGUGGAUUGCCXingli Ma et al (2015)
wheat-miR-592UCGUGGCCGCCUUGGAGACCCCXingli Ma et al (2015)
wheat-miR-593AAGGAGAACUACUGCGAUUGUGACXingli Ma et al (2015)
wheat-miR-594CCAGUCUGGACCGCAUACXingli Ma et al (2015)
wheat-miR-595AAUGGGUAGGGUAUGGGCGGGUACXingli Ma et al (2015)
wheat-miR-596ACUAGGCCCAGUCGGCCUGCAGCGXingli Ma et al (2015)
wheat-miR-597AAUGGAGCAGUUGGUGAAUAGUCCXingli Ma et al (2015)
wheat-miR-598GCCGAAGAAGCCUGUGCUCGAAAUXingli Ma et al (2015)
wheat-miR-599ACUGGAAUCCAAUCGGCCUGCUGUXingli Ma et al (2015)
wheat-miR-600AACAAAUGGGGCUCAAAGAUUXingli Ma et al (2015)
wheat-miR-601CCUACGUCACGCAGGCGCCCGACAXingli Ma et al (2015)
wheat-miR-602AAAUACGAUGUCAACUACAUGAUCXingli Ma et al (2015)
wheat-miR-603ACAGACAAUCUAGCUCGACAACCCXingli Ma et al (2015)
wheat-miR-604AGCGUACGUAGCGUUGUCAUUCUXingli Ma et al (2015)
wheat-miR-605GCCUUUGGUCCCGGUUGGUGGCACXingli Ma et al (2015)
wheat-miR-606UCUUUAGUCAGGGGUGCUUGGAACXingli Ma et al (2015)
wheat-miR-607ACAGACCUCGGUCGUCGUGGCACCXingli Ma et al (2015)
wheat-miR-608AAAGGGACUGGUCACUGGAAGCGGXingli Ma et al (2015)
wheat-miR-609CGUGAUGUAGCUCAGAUGXingli Ma et al (2015)
wheat-miR-611AAAAAAGAUUGAGCCGAAUXingli Ma et al (2015)
wheat-miR-612GAGGACCCCUUAGUCCAGGXingli Ma et al (2015)
wheat-miR-613AUUGUGCAAGAGCUUGGCAACXingli Ma et al (2015)
wheat-miR-614GACAAGUAAUUCCGAACGGAGGGAXingli Ma et al (2015)
wheat-miR-615UCACUGAAAGGUCAUUGUUUXingli Ma et al (2015)
wheat-miR-617AGACCCAUAGGGCAGUGCGCCXingli Ma et al (2015)
wheat-miR-618UCACUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-619UCUUAUAUUGUGGGACGGAGGXingli Ma et al (2015)
wheat-miR-620AAUAGUGGUCCACUGAGGAUAGAUXingli Ma et al (2015)
wheat-miR-621ACGGAACUUGACAGGUGGUCUACCXingli Ma et al (2015)
wheat-miR-622UGGGCUCUAUAUUAUGAGXingli Ma et al (2015)
wheat-miR-623UUUUUGUAGUUUGCAAAAGCACCCXingli Ma et al (2015)
wheat-miR-624UCACUUUAGAUAGGUUGGGAAUGCXingli Ma et al (2015)
wheat-miR-625AGGACUCCGCCGACACCGXingli Ma et al (2015)
wheat-miR-626UUGAAUUUCCUCUAUAAGCGCAUCXingli Ma et al (2015)
wheat-miR-627AUCUUCCCGUGAGUCCUUGAUCUXingli Ma et al (2015)
wheat-miR-628UUCGUCGGACGAGCGUGCCUAXingli Ma et al (2015)
wheat-miR-629UUCAUGAACCGGGACUAAUGGGUCXingli Ma et al (2015)
wheat-miR-630GAGAGUCCUAAAGGGGGAAGGCACXingli Ma et al (2015)
wheat-miR-631UUCGAGCACAGGCUUCUUCGGUAXingli Ma et al (2015)
wheat-miR-632GAACCGUAUGCUGUAUAUUGCACAXingli Ma et al (2015)
wheat-miR-633AAACGAGAGAACUUAAUGUUUAUXingli Ma et al (2015)
wheat-miR-634GACCCCAUUGCCCUACCCAAACGGXingli Ma et al (2015)
wheat-miR-635AAAGGAUACUAAUGGCGCAUCACCXingli Ma et al (2015)
wheat-miR-636CGUUUGGGGGUACGUAGGXingli Ma et al (2015)
wheat-miR-637AAGUGCUCGUGUUGCAUUCCCXingli Ma et al (2015)
wheat-miR-638UCACGAGGAGUUCCGGAAUGGUCCXingli Ma et al (2015)
wheat-miR-639UGUGAAACACUGUGUGAGAGAXingli Ma et al (2015)
wheat-miR-640UGACACAACAUAGAGGAAGUAGUXingli Ma et al (2015)
wheat-miR-641AUGUUGUAGUCCAUUUGAAAUGUCXingli Ma et al (2015)
wheat-miR-642UGGAACUCUCAAUGAAAGCACCAXingli Ma et al (2015)
wheat-miR-643UGCAUUCAAGUUUAACCGGXingli Ma et al (2015)
wheat-miR-644AGCUCUUGUCGCUCAGUGUGUACCXingli Ma et al (2015)
wheat-miR-645ACGAGUUUUGGCUUGAGAGCAAACUXingli Ma et al (2015)
wheat-miR-646GAUGCUUUGUGAUUUGUGAAUGCCXingli Ma et al (2015)
wheat-miR-647GUUUAUACUGGUUCGGCCCCUUXingli Ma et al (2015)
wheat-miR-648AAGACGGCAAAAUGAGCUCUUUGCXingli Ma et al (2015)
wheat-miR-649AUUUCCUCUAUAGGUGCAUCUAUUXingli Ma et al (2015)
wheat-miR-650UCACUGUUUGGAAUGGUAGGACXingli Ma et al (2015)
wheat-miR-651UUGUCGCAACCUGAGAGUUXingli Ma et al (2015)
wheat-miR-652CUGGGUGUAGUCCCCAAGGCUXingli Ma et al (2015)
wheat-miR-653AUUCAAUUGUCUCACUCAUGAXingli Ma et al (2015)
wheat-miR-654UCAUCUAUUUUGGAACGGAGGXingli Ma et al (2015)
wheat-miR-655CCCUGGUGGGUUAUGCCCUCCXingli Ma et al (2015)
wheat-miR-656GAGAGCUUUGUGGUGCUCUAGCUXingli Ma et al (2015)
wheat-miR-657GCGCCACUUGUCGCAACCUGAGAAXingli Ma et al (2015)
wheat-miR-658UAUUCUGGUGUGCUAGGCGCXingli Ma et al (2015)
wheat-miR-659CAUUACCCAUGUACUCUGCGGGUXingli Ma et al (2015)
wheat-miR-660AUUCCACGACAGUUGGCGCCCACCXingli Ma et al (2015)
wheat-miR-661UGGCCGUAGGCAUAGCCCUGXingli Ma et al (2015)
wheat-miR-662AUUGGACCCGGUUCGUGAGCCCCGXingli Ma et al (2015)
wheat-miR-663AGAGAUUCCACUAUGAACCACAUAXingli Ma et al (2015)
wheat-miR-664UGCGUUUGAACUUUGAACXingli Ma et al (2015)
wheat-miR-665GAUUUUGUGUGCCACGUAGGACAXingli Ma et al (2015)
wheat-miR-666AUGUGACUUUACUUAACUGCCXingli Ma et al (2015)
wheat-miR-667AACCUAGAUAUGUGUGAUGUUACUXingli Ma et al (2015)
wheat-miR-668GCUCACCGGGCUUCGAGGUACCUUXingli Ma et al (2015)
wheat-miR-669UAAGGGGAUUGUUGCGUAXingli Ma et al (2015)
wheat-miR-670AAACGCUCGGACUGACCGGCACCCXingli Ma et al (2015)
wheat-miR-671AAGGGCAGCCCGGUGCAUGUAGCUXingli Ma et al (2015)
wheat-miR-672ACUAAAGGGUCGUUACUAAAGCCUXingli Ma et al (2015)
wheat-miR-673UUUAGUCCCGGUUGGUAACACCAAXingli Ma et al (2015)
wheat-miR-674UCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-675AGAGGAACUUCCUUGUAGAAGUGXingli Ma et al (2015)
wheat-miR-676AUGAGCACCUUCGAGAGACUGAGCXingli Ma et al (2015)
wheat-miR-677ACAUUUGGACCGUCUAUUGGAGAXingli Ma et al (2015)
wheat-miR-678UUAGCACGACGACUUCCCGACUGUXingli Ma et al (2015)
wheat-miR-679AUAGCCUAGUGGUGGGAAGGGGUUXingli Ma et al (2015)
wheat-miR-680AAGUUAUCUUAUCGGAUUGAGUCUXingli Ma et al (2015)
wheat-miR-681UAAAAAGUCCCUGAACCAAACACCXingli Ma et al (2015)
wheat-miR-682UCACCCUUUAGUCCCGGUUCAUACXingli Ma et al (2015)
wheat-miR-683GCCCCACGGUGGGCGCCAXingli Ma et al (2015)
wheat-miR-684AAAGGCCUGCUAGUGGCGCACCUGXingli Ma et al (2015)
wheat-miR-685AUCCUACUUGGGGAGCCCXingli Ma et al (2015)
wheat-miR-686AUAGCAUCAUCCAUCCUGCCAXingli Ma et al (2015)
wheat-miR-687GUAAAAUCAUCAUUGGCUAGAGGAXingli Ma et al (2015)
wheat-miR-688UAUCAUGACCAAGGGCUUGCCXingli Ma et al (2015)
wheat-miR-689AGUCUAGUUGGCAUGCAUGAUACCXingli Ma et al (2015)
wheat-miR-690UUCAUGUCGGGUUCACCAXingli Ma et al (2015)
wheat-miR-691AUUGUCAUCAAUUACCAAAACCAXingli Ma et al (2015)
wheat-miR-692CCUGUUUGUCAUUAAGUUUCUXingli Ma et al (2015)
wheat-miR-693CAUCAAACUUCACAUCUACCGUCUXingli Ma et al (2015)
wheat-miR-694AUGAACCGGGACUAAUGUGAGCAUXingli Ma et al (2015)
wheat-miR-695UAAUGUCACAGAGCAACACUXingli Ma et al (2015)
wheat-miR-696UCUUAGCAGUAGCGCGGGAGCXingli Ma et al (2015)
wheat-miR-697UACCGAAAUACUUGUAGUUGGGXingli Ma et al (2015)
wheat-miR-698GCGCCAUUAGUAUGUUUGGACAGXingli Ma et al (2015)
wheat-miR-699AUUUUGCUUCGUAUGUAGUCACUXingli Ma et al (2015)
wheat-miR-700UGCAGCAUCAUCAAGAUUCUXingli Ma et al (2015)
wheat-miR-701ACGAUUGUACGAGGGUUUACUXingli Ma et al (2015)
wheat-miR-702UUUUUUCAGUAGUAAUUCXingli Ma et al (2015)
wheat-miR-703AGGGAUGUAGGGCUGCACCAXingli Ma et al (2015)
wheat-miR-704GGGACUGUAGUACUGUGAAGAXingli Ma et al (2015)
wheat-miR-705CGCGGCUCCGUCGAACUCGCCCXingli Ma et al (2015)
wheat-miR-706AAUCGAGCACUGCCUUCAAAXingli Ma et al (2015)
wheat-miR-707AACGAUUUGAAAUUUGAACGCXingli Ma et al (2015)
wheat-miR-708CAUUACGGUCACUGUAUACGCGXingli Ma et al (2015)
wheat-miR-709AUCCUUCUGGCUCUGGUAGCAAUCXingli Ma et al (2015)
wheat-miR-710AACCGUUUUUACGGGCUGGCUCAGXingli Ma et al (2015)
wheat-miR-711AUAGGACUUAGAUGUGCAAUAACUXingli Ma et al (2015)
wheat-miR-712UGGUCGUUGGUAGAGUAGGAGAXingli Ma et al (2015)
wheat-miR-713CAGAGGAUUAAGAGCCAUUAGAUCXingli Ma et al (2015)
wheat-miR-714AUUGGCACCCUGUAUGUUUAAGCAXingli Ma et al (2015)
wheat-miR-715ACCCAUUACCGCCUUAAACGAACGXingli Ma et al (2015)
wheat-miR-716AGUAAUGACGCACCUGUGGACAGUXingli Ma et al (2015)
wheat-miR-717AGUGCAGAACCGGGCUUUAGCGCCXingli Ma et al (2015)
wheat-miR-718AAACUAGUGAACUUGGUCAGACCGXingli Ma et al (2015)
wheat-miR-719UGUUGAGUUGAGAUUACCCCAXingli Ma et al (2015)
wheat-miR-721AAGCAUGCGACGCCUGCGCCAXingli Ma et al (2015)
tae-miR9666c-5pGCCAUCAUACGUCCAACCGUGmiRBase 21
tae-miR9657c-3pCGUGCUUCCUCGUCGAACGGUmiRBase 21
tae-miR118a_nprAAAAAAUAUGGGUUCAAGAUUPNRD
tae-miR2058a_nprAAAAUAAGUGACUCAAUUUUGUACPNRD
tae-miR2074_nprUAGCUCCACUAAAUUUGGAGCUPNRD
tae-miR175a_nprAAAAUAAGUGUCGCAGUUUUPNRD
tae-miR185a_nprAAAAUUAUGGAACGGAGGGAAPNRD
tae-miR164a_nprAAACCACUUCACUUAUUUAUGPNRD
tae-miR141a_nprAAAGAAGUUGAACUAAGGCUAPNRD
tae-miR139a_nprAAAGAUAAAAAGUUUGAGUGGPNRD
tae-miR078a_1_nprAAAUAAGUGUCGUGGUUUUAPNRD
tae-miR9667-5pAAAUAUGGCAAACAAUGAAUGPNRD
tae-miR046a_nprAACAAAUAUAAGAGCGUUUAGPNRD
tae-miR011b_nprAACAUUGACGAAUACUCAACAPNRD
tae-miR158a_nprAAGACAACUAAUUUGGGACGGPNRD
tae-miR2056a_nprAAGACAAGUAAUUCAGAACGGAUGPNRD
tae-miR2039a_nprAAGCGACGAGUAAUAUGGAACGGAPNRD
tae-miR9652-3pAAGCUUAAUGAGAACAUGUGPNRD
tae-miR072b_nprAAGUUUGACCAUAUUUAUAUAPNRD
tae-miR009a_1_nprAAUAAGUGUCGUGGUUUUAGUPNRD
tae-miR051a_nprAAUAAGUGUGUGAUUGCUACUPNRD
tae-miR038a_1_nprAAUACUUGUCGGAGAAAUGGAPNRD
tae-miR048a_nprAAUAGGCACCGGUGCUUCAGAPNRD
tae-miR2054a_nprAAUAUGGAACGGAGGGAGCAAPNRD
tae-miR030a_nprAAUAUGGAUCAGAGGAGGUAAPNRD
tae-miR5049-3pAAUAUGGAUCGGAGGGAGUACPNRD
tae-miR011a_1_nprAAUGAACUUUGCACGCAUGUAGAPNRD
tae-miR024a_nprAAUGGAUAAAAAAAGAUGUAUCUPNRD
tae-miR2071a_nprAAUUAGUUGACACUCAAACGGPNRD
tae-miR179a_nprAAUUAUUGUCGUGGUUUUAGUPNRD
tae-miR163a_nprAAUUCUUGUCUUAGAUUCGUCPNRD
tae-miR085a_nprACAAAUGAUGAUAGCAAGACAGPNRD
tae-miR1127b-3pACAAGUAUUUCUGGACGGAGGPNRD
tae-miR049a_nprACAAGUAUUUGGGAACGGAGGPNRD
tae-miR157a_nprACAAGUUUUUUCGGACAGAGPNRD
tae-miR027a_nprACAAUUAAUUUGGAUCGGAGGPNRD
tae-miR184a_nprACACUCUUACUUAUCGAAAGGACPNRD
tae-miR2020a_2_nprACACUUAUUUUGGACGGAGGGPNRD
tae-miR015a_nprACAGAGUCGAAUUAGAGGGUAPNRD
tae-miR055a_nprACAUUUGAGGAGCUCGUGGCAPNRD
tae-miR116a_nprACCCUUAUUAUGGAUCGGAGGPNRD
tae-miR134a_nprACUGGACGCGUCGGGCGCGUPNRD
tae-miR146a_nprACUUAUAUUUGGGAACAGAGGGPNRD
tae-miR182a_nprACUUAUUUUGGAUCAGAGGGAPNRD
tae-miR104a_1_nprACUUAUUUUGGGAUGGAGGGAPNRD
tae-miR007a_nprAGAAGAUUAGAAGAUUAAGCAPNRD
tae-miR2010a_nprAGACAAAUAUUUAGGAACGGAPNRD
tae-miR2031a_nprAGACAAAUAUUUAGGAACGGAGGPNRD
tae-miR160a_nprAGACAAGAAUUUUGGAACGGAPNRD
tae-miR010a_nprAGACACUUACUUUGGGACGGAPNRD
tae-miR1122b-3pAGACUUAUAUGUAGGAACGGAPNRD
tae-miR013a_nprAGACUUAUAUUUAGAAACGGAPNRD
tae-miR2008a_2_nprAGACUUAUAUUUAGGAACGGAPNRD
tae-miR126a_nprAGAGAGAAGGAAGGAGAGGAGAPNRD
tae-miR161a_nprAGAGAUUUCACUAUGGACUACAPNRD
tae-miR098a_nprAGAUGAUUUUCGAUAUUAUACUPNRD
tae-miR169a_nprAGAUGGAUGGAUGGAUGGAUGGAPNRD
tae-miR2021a_nprAGCAUGAGGCGACAACUGCAUPNRD
tae-miR020a_nprAGGACAAGUAUUUCCGGACGGPNRD
tae-miR043a_nprAGGAGGAAGGAGGAAGAAGAGPNRD
tae-miR035a_nprAGGAGGGGAGGGAAGGGAAGGPNRD
tae-miR2064a_nprAGGAUUGUAAAACAAAUGGGGCPNRD
tae-miR034a_nprAGGGGGCAAUCUCACCUCAACPNRD
tae-miR053a_nprAGGUGGUUAGGAUACUCGGCUPNRD
tae-miR178a_nprAGUAGUUUUAUGCUAUUUACUPNRD
tae-miR083a_nprAGUCUGUUCAGAUCGGAGGGGPNRD
tae-miR095a_nprAGUGUUGGAUGGGACCAAAUCPNRD
tae-miR021a_1_nprAGUUUAUGUCCCCGGCAGACGPNRD
tae-miR003a_1_nprAUAAAAGGGGAUGUAUCUAGAPNRD
tae-miR008a_nprAUACUUGUCGAAGAAAUGGAUPNRD
tae-miR142a_nprAUAGAUAAGUUGGAAUACAGUAPNRD
tae-miR9674b-5pAUAGCAUCAUCCAUCCUACCCPNRD
tae-miR181a_nprAUAUAAGACGUUUUAGAUCAPNRD
tae-miR176a_nprAUAUAAGAGCAUUUUUGACACPNRD
tae-miR188a_nprAUAUAAGUCUUUGUAGAGAUUUCPNRD
tae-miR029a_nprAUAUUAGUUUACGGAGGGAAUPNRD
tae-miR099a_nprAUAUUAUGCAGAUUGAAGAUPNRD
tae-miR9658-3pAUCGUUCUGGGUGAAUAGGCCPNRD
tae-miR100a_nprAUCUGGGACGCCUUCGCGGCCPNRD
tae-miR111a_nprAUCUUCUAUCGUGGGACGAAGPNRD
tae-miR032a_nprAUCUUGCUUAAGGCGUUACUPNRD
tae-miR086a_nprAUGACUCAACUUUAUACUAACPNRD
tae-miR120b_nprAUGUCCUAUUUUUAGCAAAGPNRD
tae-miR064a_nprAUUAAUAUGAAUCGGAGGGAGPNRD
tae-miR136a_nprAUUAAUAUGGAUCGAAGGGAGPNRD
tae-miR070a_nprAUUAAUAUGGAUCUGAGGGAGPNRD
tae-miR2052a_nprAUUAGUUUACAGAGGGAGUAUPNRD
tae-miR2055a_nprAUUAUGGAAAGGAGGGAGUAPNRD
tae-miR077a_nprAUUAUGGGACAGAGGGAGUAAPNRD
tae-miR077b_nprAUUAUGGGACAGAGGGAGUAGPNRD
tae-miR077c_1_nprAUUAUGGGACAGAGGGAGUAUPNRD
tae-miR137a_nprAUUCGAGAAUCAUUGGACGAUPNRD
tae-miR054a_nprAUUUCUGGACAGAGGGAGUAUPNRD
tae-miR147a_nprCAAAUGUUGGCUAGUGAUUGGUUPNRD
tae-miR2028a_2_nprCAAGAAUUUUGGGACGGAGGUPNRD
tae-miR073a_1_nprCAAUAACGUUCCUAUAUUAUGPNRD
tae-miR2068a_nprCACUUAUUAUGGAUCGGAGGUPNRD
tae-miR2067_nprCACUUAUUUUGAGACGGAGGGPNRD
tae-miR9679-5pCAGAACCAGAAUGAGUAGCUCPNRD
tae-miR088b_nprCAGCGUUGAUGAACCGUCCGGPNRD
tae-miR091a_nprCAGGAGGUCGCCGCAGACGCUPNRD
tae-miR069a_nprCAGGGAUGGAGCAGAGCAAGGPNRD
tae-miR037a_nprCAUCAAAAUGGACAAAAAGGPNRD
tae-miR151a_nprCAUCGUUCUGAUGCAGAGACCGGPNRD
tae-miR2038a_nprCAUCUAUUUUAGAACGGAGGGAGUPNRD
tae-miR123a_nprCAUGGCCAAGGCCUCUGAGGUUCPNRD
tae-miR9668-5pCCAAUGACAAGUAUUUUCGGAPNRD
tae-miR9672a-3pCCACGACUGUCAUUAAGCAUCPNRD
tae-miR106a_nprCCAUCCCUCAACUCCGCCGCCPNRD
tae-miR082a_nprCCCCCUCUGGUACUUAUUGGCUPNRD
tae-miR100b_1_nprCCGCGUCGGCGUACCAGGUGGPNRD
tae-miR111b_nprCCGUCCCACAAUAGAAGAUUGPNRD
tae-miR067b_nprCCUGCGGGGUCGAACUGGGAAPNRD
tae-miR9652-5pCCUGUUUGUCAUUAAGUUUCUUPNRD
tae-miR089a_nprCGCAAAACUGUAACCAUAGAGPNRD
tae-miR093a_nprCGGGCGCGGCCGAGGCGGUGGAPNRD
tae-miR081a_nprCGGGCUUGAUGUCGUAGUGCACGPNRD
tae-miR106b_nprCGGUGGAGCUGGUUGAUGGACPNRD
tae-miR180a_nprCGGUGGCGGCAAAGGGGACCAPNRD
tae-miR160b_nprCGUCCCAAAAUUCUUGUCUUAPNRD
tae-miR068b_nprCUCUCUCGGGAGGGCUGAUCPNRD
tae-miR076a_nprCUGCUGAAGUUACUCCCAUUGPNRD
tae-miR007b_nprCUUAAUUUUGUAAUCUUCUGGPNRD
tae-miR142b_nprCUUAUUUUGAUGAAUCUAUGAPNRD
tae-miR101a_nprCUUAUUUUGGGAUGGAGGGAGPNRD
tae-miR9656-3pCUUCGAGACUCUGAACAGCGGPNRD
tae-miR103a_nprCUUGGGACAAGCUUUUUCGGAPNRD
tae-miR073c_nprGAAUAACGUUCCUAUAUUAUGPNRD
tae-miR189b_nprGACACGAGGCGCAGGACCUACAAGPNRD
tae-miR088a_nprGAGCGGUUCACCGGCGCUGCAPNRD
tae-miR006a_nprGAGGCAUCAUUAGGAAUACUPNRD
tae-miR2062a_nprGAGUCAUCUAUUUUGGAACGGAPNRD
tae-miR9674a-5pGCAUCAUCCAUCCUACCAUUCPNRD
tae-miR122a_nprGCCCGGUCAUAGUCAGGUAUCPNRD
tae-miR122b_nprGCCCGGUCAUAGUCAGGUAUCUPNRD
tae-miR135a_nprGCGAGGUGAUGAUGUUAUGUAUGPNRD
tae-miR9665-3pGCUAGCAGUGUAAACUCAAAUCAPNRD
tae-miR170b_nprGGAAUAAUAAAAUAGGACGPNRD
tae-miR154b_nprGGCGAGGGACAUACACUGUACAPNRD
tae-miR145a_nprGGUGUUUCGUCAAUAUGCAACPNRD
tae-miR020b_nprGUCCGGAAAUACUUGUCCUAGPNRD
tae-miR128a_nprGUGGAUGAUGAGAUCACAAGUAAPNRD
tae-miR074a_nprUAAAAACAUUCUUAUAUUUUCPNRD
tae-miR2033a_2_nprUAAACUGAGAGAGAGGGAGUAPNRD
tae-miR102a_nprUAAGCGCGUUGGCGUCGAACGPNRD
tae-miR131a_nprUAAGUUUCUUAGAUACUGGUAPNRD
tae-miR1120c-5pUAAUAUAAGAACGUUUUUGACPNRD
tae-miR074b_nprUAAUAUAAGAACGUUUUUUACPNRD
tae-miR153b_nprUAAUAUAAGAGUGUUUAGAUAPNRD
tae-miR073b_1_nprUAAUAUAGGAACGUUAUUGACPNRD
tae-miR154a_nprUACAGUUUAUGUCCCCGGCAGPNRD
tae-miR148a_nprUACUCCUAAUGGAGCAGUUGGUAPNRD
tae-miR9669-5pUACUGUGGGCACUUAUUUGACPNRD
tae-miR017a_nprUAGCCAAGGAUGAUUUGCCUPNRD
tae-miR132a_nprUAUAAACUUGGUCAAAGUUUGPNRD
tae-miR072a_1_nprUAUAAAUUUGGUCAAACUUUAPNRD
tae-miR164b_nprUAUAUAAGUGACGUGGUUUUAPNRD
tae-miR2049a_nprUAUAUUCUGGGACAGAGGGAGPNRD
tae-miR125a_nprUAUGGAUGAAGAUAUGCACUPNRD
tae-miR041a_nprUAUGGGACAGAGGGAGUAGUAGPNRD
tae-miR2048a_nprUAUUAGUUUACAGAGGGAGUAPNRD
tae-miR155a_1_nprUAUUUCGGUACAGAGGGAGUAPNRD
tae-miR155b_nprUAUUUCGGUACAGAGGGAGUAAPNRD
tae-miR173a_nprUAUUUGAACGACAAGUAGUAUPNRD
tae-miR033a_nprUCAAAGGAUGAGCAAAUACUPNRD
tae-miR031a_nprUCAAUUAAUUUGGAUCGGAGGPNRD
tae-miR004a_1_nprUCACAAAUAUAAGAUGUUCUPNRD
tae-miR2009b_nprUCAGAUGAGAAGGCAGAUCAUAPNRD
tae-miR2012a_nprUCAUCUAUUUUGGAACGGAGGPNRD
tae-miR9659-3pUCCAAUGGUUGUUCACGGCAUCPNRD
tae-miR2017a_nprUCCGUCCGGAAAUACUUGUCAPNRD
tae-miR1137b-5pUCCGUUCCAGAAUAGAUGACCPNRD
tae-miR023a_nprUCGCAAAUAAUGGUGGCCCUPNRD
tae-miR023b_nprUCGCAAAUAAUGGUGGCCCUCGPNRD
tae-miR075a_nprUCGCUGUAGUACGCGCAGUCCPNRD
tae-miR068a_nprUCGGGGCUCCGGAGAGGGGGPNRD
tae-miR1122c-3pUCUAAUAUUAUGGGACGGAGGPNRD
tae-miR079a_1_nprUCUAUCUCAAAAUGUAAGACAPNRD
tae-miR2022a_nprUCUAUUUUAGAACGGAGGGAGPNRD
tae-miR9678-3pUCUGGCGAGGGACAUACACUGUPNRD
tae-miR6197-5pUCUGUAAACAAAUGUAGGACGPNRD
tae-miR109a_nprUCUGUAAACUUGUAUAAGAGCPNRD
tae-miR186a_nprUCUGUACCGAAAUACUUGUAGPNRD
tae-miR1130b-3pUCUUAUAUUAUGGGACGGAGGPNRD
tae-miR5062-5pUGAACCUUAGGGAACAGCCGCAUPNRD
tae-miR045a_nprUGAAGACUAGUUUAUUACAUPNRD
tae-miR167c-5pUGAAGCUGCCAGCAUGAUCUGCPNRD
tae-miR2059a_nprUGACAAGUAUUUCCGGACGGAGGPNRD
tae-miR032b_nprUGACAGUAGGGGUAGCGAGGCPNRD
tae-miR152a_nprUGACCAAGUUUGUAGAGAAAAPNRD
tae-miR9671-5pUGACUUUACACAACUGUCCGGCPNRD
tae-miR2005a_2_nprUGAGAAGGCAGAUCAUAAUAGCPNRD
tae-miR5384-3pUGAGCGCGCCGCCGUCGAAUGPNRD
tae-miR165a_nprUGAUGCCUGAAGAUUGCACUGPNRD
tae-miR001a_1_nprUGCAGCGCCGGUGAACCGCUCPNRD
tae-miR012a_1_nprUGCAGGGUGAGGGUGGGAUUCPNRD
tae-miR444c_1_nprUGCAGUUGCUGUCUCAAGCUUPNRD
tae-miR138a_1_nprUGGACAUGUAUAACAUGGUGGPNRD
tae-miR113a_nprUGGCUACUUCCUUUCCCUUGCCPNRD
tae-miR056a_nprUGGCUGUUGGUAGAGUGGAAGPNRD
tae-miR2035a_nprUGGGCACAACCCACCAGGGCGCGCPNRD
tae-miR190a_nprUGGGGGCGCGGCUGGAGAUGPNRD
tae-miR159a_nprUGUAGAAAUAGGCACCGGUGCPNRD
tae-miR9657a-3pUGUGCUUCCUCGUCGAACGGUPNRD
tae-miR108a_nprUGUGUCUCAACUGCGGGUCGCPNRD
tae-miR044c_nprUGUUAUGAUCUGCUUCUCAUCPNRD
tae-miR044b_nprUGUUAUGAUCUGCUUCUCAUUPNRD
tae-miR042a_nprUGUUGGCUCGACUCACUCAGAPNRD
tae-miR025a_nprUUAAUUGACGCAGCCUCUAUAPNRD
tae-miR187a_nprUUACUUGUUUUAGAUUUGUCUPNRD
tae-miR065a_nprUUAGGAAACAUGUAGUUUAGAPNRD
tae-miR189a_nprUUAGGCACUCGUCAGUGACCAPNRD
tae-miR2046a_nprUUAUAUUAGUUUACAGAGGGAPNRD
tae-miR094a_1_nprUUCAGUUUUCUCCAACAUCUUAPNRD
tae-miR057a_nprUUCCACUCUACCAACAGCCACGPNRD
tae-miR050b_nprUUCGCCGGAGAAGCAUGUUGCPNRD
tae-miR102b_nprUUCGCCGGUAGCGCGUUUUCCPNRD
tae-miR9657b-5pUUCGUCGGAGAAGCAUGUUGCPNRD
tae-miR170a_nprUUCUAUUUUGUUGGUUUCUAPNRD
tae-miR035b_nprUUCUCUUCUCUUCUCUCCUCUPNRD
tae-miR9654a-3pUUCUGAAAGGCUUGAAGCGAAUPNRD
tae-miR1120b-3pUUCUUAUAUUGUGGGACAGAGPNRD
tae-miR2014a_nprUUCUUAUAUUUUGGGACGGAGPNRD
tae-miR133a_nprUUCUUCCAGGAUCGUUCAUUAPNRD
tae-miR127a_nprUUGACGCUCAAACGGAUGUAUPNRD
tae-miR112a_1_nprUUGAGACAUUUAUUUUGGGACPNRD
tae-miR047a_nprUUGAGGUGGAUUUGAAGGGGAUPNRD
tae-miR022a_nprUUGCACUACAGAGGACAUCAAPNRD
tae-miR9660-5pUUGCGAGCAACGGAUGAAUCPNRD
tae-miR120a_nprUUGCUAAAAAUAGGACAUAUPNRD
tae-miR028a_nprUUGCUGGAAGAGUUUUAUUCAAPNRD
tae-miR076b_nprUUGGGACAUGUGAUGUUACAGUAPNRD
tae-miR058a_nprUUGUACAAUGGGAGAUGCUUAPNRD
tae-miR117a_nprUUUAGACUAGAAAUAGAGCAGPNRD
tae-miR9675-3pUUUAUGAUCACUCUCGUUUUGPNRD
tae-miR2034a_nprUUUGACCAAAGCUAAUAUGCGGACPNRD
tae-miR9653a-3pUUUGAGACUUUGGCCAUGGCCPNRD
tae-miR5048-5pUUUGCAGGUUUUAGGUCUAAGUPNRD
tae-miR2275-3pUUUGGUUUCCUCCAAUAUCUCGPNRD
tae-miR129a_nprUUUGUAAACUUUCAUAAGACGPNRD
tae-miR191a_nprUUUUUGUAUCUCGAGCAAUGUPNRD

2330 NR rice miRNA IDsmiRNA_sequencedatabase name
osa-miR156aUGACAGAAGAGAGUGAGCACmiRBase.V20
osa-miR156b-3pGCUCACUCUCUAUCUGUCAGCmiRBase.V20
osa-miR156c-3pGCUCACUUCUCUCUCUGUCAGCmiRBase.V20
osa-miR156f-3pGCUCACUUCUCUUUCUGUCAGCmiRBase.V20
osa-miR156j-3pGCUCGCUCCUCUUUCUGUCAGCmiRBase.V20
osa-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase.V20
osa-miR160a-3pGCGUGCAAGGAGCCAAGCAUGmiRBase.V20
osa-miR160c-3pGCGUGCACGGAGCCAAGCAUAmiRBase.V20
osa-miR160d-3pGCGUGCGAGGAGCCAAGCAUGmiRBase.V20
osa-miR162aUCGAUAAACCUCUGCAUCCAGmiRBase.V20
osa-miR164aUGGAGAAGCAGGGCACGUGCAmiRBase.V20
osa-miR166a-5pGGAAUGUUGUCUGGUUCAAGGmiRBase.V20
osa-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase.V20
osa-miR166b-5pGGAAUGUUGUCUGGCUCGGGGmiRBase.V20
osa-miR166c-5pGGAAUGUUGUCUGGUCCGAGmiRBase.V20
osa-miR166d-5pGGAAUGUUGUCUGGCUCGAGGmiRBase.V20
osa-miR166e-3pUCGAACCAGGCUUCAUUCCCCmiRBase.V20
osa-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
osa-miR167a-3pAUCAUGCAUGACAGCCUCAUUUmiRBase.V20
osa-miR167c-3pGGUCAUGCUGCGGCAGCCUCACUmiRBase.V20
osa-miR169aCAGCCAAGGAUGACUUGCCGAmiRBase.V20
osa-miR171aUGAUUGAGCCGCGCCAAUAUCmiRBase.V20
osa-miR393aUCCAAAGGGAUCGCAUUGAUCmiRBase.V20
osa-miR394UUGGCAUUCUGUCCACCUCCmiRBase.V20
osa-miR395bGUGAAGUGUUUGGGGGAACUCmiRBase.V20
osa-miR395tGUGAAGUGUUUGGGGAAACUCmiRBase.V20
osa-miR395cGUGAAGUGUUUGGAGGAACUCmiRBase.V20
osa-miR395aGUGAAGUGCUUGGGGGAACUCmiRBase.V20
osa-miR395fGUGAAUUGUUUGGGGGAACUCmiRBase.V20
osa-miR395uGUGAAGCGUUUGGGGGAAAUCmiRBase.V20
osa-miR396a-5pUUCCACAGCUUUCUUGAACUGmiRBase.V20
osa-miR396a-3pGUUCAAUAAAGCUGUGGGAAmiRBase.V20
osa-miR396c-5pUUCCACAGCUUUCUUGAACUUmiRBase.V20
osa-miR396c-3pGGUCAAGAAAGCUGUGGGAAGmiRBase.V20
osa-miR397aUCAUUGAGUGCAGCGUUGAUGmiRBase.V20
osa-miR397bUUAUUGAGUGCAGCGUUGAUGmiRBase.V20
osa-miR398aUGUGUUCUCAGGUCACCCCUUmiRBase.V20
osa-miR398bUGUGUUCUCAGGUCGCCCCUGmiRBase.V20
osa-miR399aUGCCAAAGGAGAAUUGCCCUGmiRBase.V20
osa-miR399dUGCCAAAGGAGAGUUGCCCUGmiRBase.V20
osa-miR399eUGCCAAAGGAGAUUUGCCCAGmiRBase.V20
osa-miR399hUGCCAAAGGAGACUUGCCCAGmiRBase.V20
osa-miR399iUGCCAAAGGAGAGCUGCCCUGmiRBase.V20
osa-miR399jUGCCAAAGGAGAGUUGCCCUAmiRBase.V20
osa-miR399kUGCCAAAGGAAAUUUGCCCCGmiRBase.V20
osa-miR156kUGACAGAAGAGAGAGAGCACAmiRBase.V20
osa-miR156l-5pCGACAGAAGAGAGUGAGCAUAmiRBase.V20
osa-miR159a.2UUGCAUGCCCCAGGAGCUGCAmiRBase.V20
osa-miR159a.1UUUGGAUUGAAGGGAGCUCUGmiRBase.V20
osa-miR159cAUUGGAUUGAAGGGAGCUCCAmiRBase.V20
osa-miR159dAUUGGAUUGAAGGGAGCUCCGmiRBase.V20
osa-miR159eAUUGGAUUGAAGGGAGCUCCUmiRBase.V20
osa-miR159fCUUGGAUUGAAGGGAGCUCUAmiRBase.V20
osa-miR319a-5pAGCUGCCGAAUCAUCCAUUCAmiRBase.V20
osa-miR319a-3pACUGGAUGACGCGGGAGCUAAmiRBase.V20
osa-miR319a-3p.2-3pUUGGACUGAAGGGUGCUCCCmiRBase.V20
osa-miR160e-5pUGCCUGGCUCCCUGUAUGCCGmiRBase.V20
osa-miR160e-3pGCGUGCGAGGUGCCAAGCAUGmiRBase.V20
osa-miR160f-5pUGCCUGGCUCCCUGAAUGCCAmiRBase.V20
osa-miR160f-3pGCAUUGAGGGAGUCAUGCAGGmiRBase.V20
osa-miR162bUCGAUAAGCCUCUGCAUCCAGmiRBase.V20
osa-miR164cUGGAGAAGCAGGGUACGUGCAmiRBase.V20
osa-miR164dUGGAGAAGCAGGGCACGUGCUmiRBase.V20
osa-miR164eUGGAGAAGCAGGGCACGUGAGmiRBase.V20
osa-miR166k-5pGGUUUGUUGUCUGGCUCGAGGmiRBase.V20
osa-miR166k-3pUCGGACCAGGCUUCAAUCCCUmiRBase.V20
osa-miR166l-5pGGAUUGUUGUCUGGUUCAAGGmiRBase.V20
osa-miR167d-5pUGAAGCUGCCAGCAUGAUCUGmiRBase.V20
osa-miR167d-3pGAUCAUGCUGUGCAGUUUCAUCmiRBase.V20
osa-miR167e-3pAGAUCAUGUUGCAGCUUCACUmiRBase.V20
osa-miR167h-3pAGGUCAUGCUGUAGUUUCAUCmiRBase.V20
osa-miR168a-5pUCGCUUGGUGCAGAUCGGGACmiRBase.V20
osa-miR168a-3pGAUCCCGCCUUGCACCAAGUGAAUmiRBase.V20
osa-miR168bAGGCUUGGUGCAGCUCGGGAAmiRBase.V20
osa-miR169bCAGCCAAGGAUGACUUGCCGGmiRBase.V20
osa-miR169dUAGCCAAGGAUGAAUUGCCGGmiRBase.V20
osa-miR169eUAGCCAAGGAUGACUUGCCGGmiRBase.V20
osa-miR169f.2UGAGGACAAGAGCUGAUUCGGmiRBase.V20
osa-miR169f.1UAGCCAAGGAUGACUUGCCUAmiRBase.V20
osa-miR169hUAGCCAAGGAUGACUUGCCUGmiRBase.V20
osa-miR169i-5p.2UGGUGAUAAGGGUGUAGCUCUGmiRBase.V20
osa-miR169i-3pUGAGUCGCUCUUAUCACUCAUGmiRBase.V20
osa-miR169nUAGCCAAGAAUGACUUGCCUAmiRBase.V20
osa-miR169pUAGCCAAGGACAAACUUGCCGGmiRBase.V20
osa-miR169qUAGCCAAGGAGACUGCCCAUGmiRBase.V20
osa-miR171bUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
osa-miR171c-5pGGAUAUUGGUGCGGUUCAAUCmiRBase.V20
osa-miR171d-5pUGUUGGCCCGGCUCACUCAGAmiRBase.V20
osa-miR171e-5pUGUUGGCUCGGCUCACUCAGAmiRBase.V20
osa-miR171f-5pUGUUGGCAUGGUUCAAUCAAAmiRBase.V20
osa-miR171gGAGGUGAGCCGAGCCAAUAUCmiRBase.V20
osa-miR172aAGAAUCUUGAUGAUGCUGCAUmiRBase.V20
osa-miR172bGGAAUCUUGAUGAUGCUGCAUmiRBase.V20
osa-miR172cUGAAUCUUGAUGAUGCUGCACmiRBase.V20
osa-miR166g-5pAAUGGAGGCUGAUCCAAGAUCmiRBase.V20
osa-miR166g-3pUCGGACCAGGCUUCAUUCCUCmiRBase.V20
osa-miR166h-5pGGAAUGUUGGCUGGCUCGAGGmiRBase.V20
osa-miR166i-5pAAUGCAGUUUGAUCCAAGAUCmiRBase.V20
osa-miR166i-3pUCGGAUCAGGCUUCAUUCCUCmiRBase.V20
osa-miR171hGUGAGCCGAACCAAUAUCACUmiRBase.V20
osa-miR393b-5pUCCAAAGGGAUCGCAUUGAUCUmiRBase.V20
osa-miR393b-3pUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
osa-miR408-5pCAGGGAUGAGGCAGAGCAUGGmiRBase.V20
osa-miR408-3pCUGCACUGCCUCUUCCCUGGCmiRBase.V20
osa-miR172d-5pGCAGCACCAUCAAGAUUCACmiRBase.V20
osa-miR171i-5pAGGUAUUGGCGUGCCUCAAUCmiRBase.V20
osa-miR171i-3pGGAUUGAGCCGCGUCAAUAUCmiRBase.V20
osa-miR166mUCGGACCAGGCUUCAUUCCCUmiRBase.V20
osa-miR166j-5pGAAUGACGUCCGGUCUGAAGAmiRBase.V20
osa-miR413CUAGUUUCACUUGUUCUGCACmiRBase.V20
osa-miR414UCAUCCUCAUCAUCAUCGUCCmiRBase.V20
osa-miR415AACAGAACAGAAGCAGAGCAGmiRBase.V20
osa-miR416UGUUCGUCCGUACACUGUUCAmiRBase.V20
osa-miR417GAAUGUAGUGAAUUUGUUCCAmiRBase.V20
osa-miR418UAAUGUGAUGAUGAAAUGACGmiRBase.V20
osa-miR419UGAUGAAUGCUGACGAUGUUGmiRBase.V20
osa-miR426UUUUGGAAGUUUGUCCUUACGmiRBase.V20
osa-miR435UUAUCCGGUAUUGGAGUUGAmiRBase.V20
osa-miR437AAAGUUAGAGAAGUUUGACUUmiRBase.V20
osa-miR438UUCCCACGCGUUAUAGUGAAAmiRBase.V20
osa-miR390-5pAAGCUCAGGAGGGAUAGCGCCmiRBase.V20
osa-miR390-3pCGCUAUCUAUCCUGAGCUCCmiRBase.V20
osa-miR439aUGUCGAACCGCGGUUGUUCGAmiRBase.V20
osa-miR440AGUGUCUCCUGAUGAUCGGGACAAmiRBase.V20
osa-miR396e-5pUCCACAGGCUUUCUUGAACUGmiRBase.V20
osa-miR396e-3pAUGGUUCAAGAAAGCCCAUGGAAAmiRBase.V20
osa-miR443AUCACAAUACAAUAAAUCUGGAmiRBase.V20
osa-miR444a-5pGCUAGAGGUGGCAACUGCAUAmiRBase.V20
osa-miR444a-3p.2UGCAGUUGCUGCCUCAAGCUUmiRBase.V20
osa-miR444a-3p.1UUGCUGCCUCAAGCUUGCUGCmiRBase.V20
osa-miR528-5pUGGAAGGGGCAUGCAGAGGAGmiRBase.V20
osa-miR528-3pCCUGUGCUUGCCUCUUCCAUUmiRBase.V20
osa-miR529aCUGUACCCUCUCUCUUCUUCmiRBase.V20
osa-miR530-5pUGCAUUUGCACCUGCACCUAmiRBase.V20
osa-miR530-3pAGGUGCAGAGGCAGAUGCAACmiRBase.V20
osa-miR531aCUCGCCGGGGCUGCGUGCCGCCAUmiRBase.V20
osa-miR535-5pUGACAACGAGAGAGAGCACGCmiRBase.V20
osa-miR535-3pGUGCUUUCUCCCGUUGUCACUmiRBase.V20
osa-miR395oAUGAAGUGUUUGGAGGAACUCmiRBase.V20
osa-miR395vGUGAAGUAUUUGGCGGAACUCmiRBase.V20
osa-miR395wGUGAAGUGUUUGGGGGAUUCUCmiRBase.V20
osa-miR810aUCAUAAGCCCACCACAUGUGGmiRBase.V20
osa-miR812aGACGGACGGUUAAACGUUGGACmiRBase.V20
osa-miR814aCACUUCAUAGUACAACGAAUCUmiRBase.V20
osa-miR815aAAGGGGAUUGAGGAGAUUGGGmiRBase.V20
osa-miR816GUGACAUAUUUUACUACAACmiRBase.V20
osa-miR817UCCAACUUGAGGCCCGAUUGAmiRBase.V20
osa-miR818aAAUCCCUUAUAUUAUGGGACGGmiRBase.V20
osa-miR820aUCGGCCUCGUGGAUGGACCAGmiRBase.V20
osa-miR821aAAGUCAUCAACAAAAAAGUUGAAUmiRBase.V20
osa-miR529bAGAAGAGAGAGAGUACAGCUUmiRBase.V20
osa-miR1423-5pAGGCAACUACACGUUGGGCGCUCGmiRBase.V20
osa-miR1423-3pAGCGCCCAAGCGGUAGUUGUCmiRBase.V20
osa-miR1424AUGCACACUGAUGCUGAUUGUmiRBase.V20
osa-miR1425-5pUAGGAUUCAAUCCUUGCUGCUmiRBase.V20
osa-miR1425-3pCAGCAAGAACUGGAUCUUAAUmiRBase.V20
osa-miR1426AGAAUCUUGAUGAUGAUUAAAmiRBase.V20
osa-miR1427UGCGGAACCGUGCGGUGGCGCmiRBase.V20
osa-miR1428a-5pCGUUUUGCAAAUUCGCAGGCCmiRBase.V20
osa-miR1428a-3pUAAGAUAAAGCCGUGAAUUUGmiRBase.V20
osa-miR1429-5pGUAAUAUACUAAUCCGUGCAUmiRBase.V20
osa-miR1429-3pGUUGCACGGGUUUGUAUGUUGmiRBase.V20
osa-miR1430UGGUGAGCCUUCCUGGCUAAGmiRBase.V20
osa-miR1431UUUGCGAGUUGGCCCGCUUGCmiRBase.V20
osa-miR1432-5pAUCAGGAGAGAUGACACCGACmiRBase.V20
osa-miR1432-3pCAGGUGUCAUCUCCCCUGAACmiRBase.V20
osa-miR169r-5pUAGCCAAGGAUGAUUUGCCUGmiRBase.V20
osa-miR169r-3pUGGCAAGUCUCCUCGGCUACCmiRBase.V20
osa-miR444b.2UGCAGUUGUUGUCUCAAGCUUmiRBase.V20
osa-miR444b.1UGUUGUCUCAAGCUUGCUGCCmiRBase.V20
osa-miR444d.3UUGUGGCUUUCUUGCAAGUUGmiRBase.V20
osa-miR444fUGCAGUUGUUGCCUCAAGCUUmiRBase.V20
osa-miR810b.1UGAACACCGAUAUGCGUCAUCmiRBase.V20
osa-miR810b.2AAGUGAUUUAAUUAUGCCGUUmiRBase.V20
osa-miR1435UUUCUUAAGUCAAACUUUUUmiRBase.V20
osa-miR1436ACAUUAUGGGACGGAGGGAGUmiRBase.V20
osa-miR1437UCCGGCGCCGCACUAGGCACUGmiRBase.V20
osa-miR1438AGGGUAAUUUUAUCAUUUUUAAmiRBase.V20
osa-miR1440aUGCUCAAAUACCACUCUCCUmiRBase.V20
osa-miR1441ACCGGAUGUCGGAAAAGGUUUmiRBase.V20
osa-miR1442AUUCAUAGUACUAGAUGUGUmiRBase.V20
osa-miR1439UUUUGGAACGGAGUGAGUAUUmiRBase.V20
osa-miR531bCUCGCCGGGGCUGCGUGCCGmiRBase.V20
osa-miR1846d-5pUCCCACCGAGCAGCCGGAUCUCmiRBase.V20
osa-miR1846d-3pUAUCCGGCGCCGCAGGGAGGmiRBase.V20
osa-miR1847.1UGCAGUUUGCAGUUGUGGCACmiRBase.V20
osa-miR1847.2UGGCCCACAUGUUAGUGCCACAACmiRBase.V20
osa-miR1848CCUCGCCGGCGCGCGCGUGCAmiRBase.V20
osa-miR1849UAUCGUAUCCUAGGUUGGUUUmiRBase.V20
osa-miR1850.1UGGAAAGUUGGGAGAUUGGGGmiRBase.V20
osa-miR1850.2UUGUGUGUGAACUAAACGUGGmiRBase.V20
osa-miR1850.3CUGUUUAGUUCACAUCAAUCUUmiRBase.V20
osa-miR1851CGUCUGGGAUGGCAUUUUGGCmiRBase.V20
osa-miR1852AUAUGGAUUCAGAAUGCAGGUmiRBase.V20
osa-miR1853-5pAGCAUUCAAACAUUCCCAAUUACCmiRBase.V20
osa-miR1853-3pUAAUUGGGGAUGUUCGGUUGCUmiRBase.V20
osa-miR1854-5pUGGUGAAAUUUGUAGAUUGGAmiRBase.V20
osa-miR1854-3pUCCAAUUUGGGGAUUUGCUGAUmiRBase.V20
osa-miR1855AGCACUGGAGUAGCCAAGAGAmiRBase.V20
osa-miR1856UAUGCGUAAGACGGAUUCGUAmiRBase.V20
osa-miR1857-5pUGGUUUUUUUGGAGCAUGAGGmiRBase.V20
osa-miR1857-3pUCAUGCUCCAAGAAAACCAGGmiRBase.V20
osa-miR1428bUAAGAUAAUGCCAUGAAUUCGmiRBase.V20
osa-miR1428e-5pAAUUCACAGGCCCUAUCUUGUGmiRBase.V20
osa-miR1428e-3pUAAGAUAAUGCCAUGAAUUUGmiRBase.V20
osa-miR1858aGAGAGGAGGACGGAGUGGGGCmiRBase.V20
osa-miR1846a-5pAGUGAGGAGGCCGGGGCCGCUmiRBase.V20
osa-miR1846a-3pUGACCCCGUUCUCCUCGCCGGmiRBase.V20
osa-miR1859UUUCCUAUGACGUCCAUUCCAAmiRBase.V20
osa-miR1860-5pAGAAAACCAGCUUCCAGAUCUmiRBase.V20
osa-miR1860-3pAUCUGGAAGCUAGGUUUUCUCUmiRBase.V20
osa-miR1861aUGAUCUUGAGGCAGAAACUGAGmiRBase.V20
osa-miR1861bCGAUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861cCGAUCUUGUAGCAAGAACUGAGmiRBase.V20
osa-miR1861dUGGUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861eCGGUCUUGUGGCAAGAACUGAGmiRBase.V20
osa-miR1861gCAGUCUUGUGGCAAGAACUGAGmiRBase.V20
osa-miR1861hCGGUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861nCGAUCUUGUGGCAGGAGCUGAGmiRBase.V20
osa-miR1862aACGAGGUUGGUUUAUUUUGGGACGmiRBase.V20
osa-miR1863aAGCUCUGAUACCAUGUUAGAUUAGmiRBase.V20
osa-miR1864UUGUAGUAACGUGAUGGUCAAUGUmiRBase.V20
osa-miR1865-5pUGCUAGUGAUGGUGAUUCUUCGACmiRBase.V20
osa-miR1865-3pCGAAGAAUCGCAGUCACUAGUUGUmiRBase.V20
osa-miR1866-5pGAGGGAUUUUGCGGGAAUUUCACGmiRBase.V20
osa-miR1866-3pUGAAAUUCCUGUAAAAUUCUUGmiRBase.V20
osa-miR1868UCACGGAAAACGAGGGAGCAGCCAmiRBase.V20
osa-miR812fACGGAUGAUUAAAGUUGGACACGGmiRBase.V20
osa-miR1869UGAGAACAAUAGGCAUGGGAGGUAmiRBase.V20
osa-miR1870-5pUGCUGAAUUAGACCUAGUGGGCAUmiRBase.V20
osa-miR1870-3pUUUAGGGCUAAUUCAGCAUGAACAmiRBase.V20
osa-miR1871AUGGCUCUGAUAUCAUGUUGGUUUmiRBase.V20
osa-miR1872GAACUGUAAGUCUGUGACGGGUAAmiRBase.V20
osa-miR1873UCAACAUGGUAUCAGAGCUGGAAGmiRBase.V20
osa-miR1874-5pUAGGGCUACUACACCAUCCAUAAGmiRBase.V20
osa-miR1874-3pUAUGGAUGGAGGUGUAACCCGAUGmiRBase.V20
osa-miR1875ACAAUGGAGUGAAGUGCAACAGAAmiRBase.V20
osa-miR1862dACUAGGUUUGUUUAUUUUGGGACGmiRBase.V20
osa-miR1876AUAAGUGGGUUUGUGGGCUGGCCCmiRBase.V20
osa-miR1862eCUAGAUUUGUUUAUUUUGGGACGGmiRBase.V20
osa-miR1877AGAUGACAUGUGAAUGAUGAGGGGmiRBase.V20
osa-miR1878ACUUAAUCUGGACACUAUAAAAGAmiRBase.V20
osa-miR1879GUGUUUGGUUUAGGGAUGAGGUGGmiRBase.V20
osa-miR1880UUCCAAGCGGGCCACUUAAGCAUUmiRBase.V20
osa-miR1881AAUGUUAUUGUAGCGUGGUGGUGUmiRBase.V20
osa-miR1882aAGAUUGCUUUCAAGGUCAUUUCUUmiRBase.V20
osa-miR1882e-3pGAAAUGAUCUUGGACGUAAUCUAGmiRBase.V20
osa-miR812gAAGACGGAUGAUUAAAGUUGGACAmiRBase.V20
osa-miR1883aACCUGUGACGGGCCGAGAAUGGAAmiRBase.V20
osa-miR1319aAACCGGCAUCUGUAAUAUAUUAUAmiRBase.V20
osa-miR1320-5pUGGAACGGAGGAAUUUUAUAGmiRBase.V20
osa-miR1320-3pUGUAAAAUUCAUUCGUUCCAAmiRBase.V20
osa-miR1846c-3pUGACCCCGGUCUGCUCGCUGGmiRBase.V20
osa-miR2055UUUCCUUGGGAAGGUGGUUUCmiRBase.V20
osa-miR827UUAGAUGACCAUCAGCAAACAmiRBase.V20
osa-miR1846eCAACGAGGAGGCCGGGACCAmiRBase.V20
osa-miR2090AACUCUGAUUCUAGAAUUUUUGmiRBase.V20
osa-miR2091-5pUCAACCGAGCCGAGGAGGAGGmiRBase.V20
osa-miR2091-3pCAUACAUUGCCUCCUAGGCUUGmiRBase.V20
osa-miR2092-5pCAACUGAAGUCGGUGUUUACUmiRBase.V20
osa-miR2092-3pACCAGCAUUCCAUUGGCAGAGGmiRBase.V20
osa-miR2093-5pGUGCAUUAAUUGGAAGAACAmiRBase.V20
osa-miR2093-3pACAUCUUCCAAUUAAUGCAUmiRBase.V20
osa-miR2094-5pUGGCUGCUAGGCUCCUGGGUGmiRBase.V20
osa-miR2094-3pCAGAGCUGUGGCAUCCACGUCGmiRBase.V20
osa-miR2095-5pCUGAUAAUUUUACGAUGAAUAGmiRBase.V20
osa-miR2095-3pCUUCCAUUUAUGAUAAGUAUmiRBase.V20
osa-miR2096-5pUGCCGAUUUCCCCCUCGGGCGmiRBase.V20
osa-miR2096-3pCCUGAGGGGAAAUCGGCGGGAmiRBase.V20
osa-miR2097-5pAGAGAUGGGACGGGCAGGGAAGmiRBase.V20
osa-miR2097-3pUUCUCUUCUUCGUGUCGCAUUUmiRBase.V20
osa-miR2098-5pUCCCGUGGAGGCAGCCGAUGmiRBase.V20
osa-miR2098-3pCGGUUUGUCAAGCGGAGUGCmiRBase.V20
osa-miR2099-5pUGAAUAUGUUUGUACAAGCUUUmiRBase.V20
osa-miR2099-3pACAAAGCUGUAGCGUUAUUCmiRBase.V20
osa-miR2100-5pUUCUCUCAAGUUGCCAAACAAGmiRBase.V20
osa-miR2100-3pAACCGCUGUUUAGGCGGAGUGGmiRBase.V20
osa-miR2101-5pACAUGUUUACAAGUUAAAAUGUmiRBase.V20
osa-miR2101-3pAUUUAACUCAAGUGAGCAUUGUmiRBase.V20
osa-miR2102-5pGGGCAAGCCGCCGCCGCCACmiRBase.V20
osa-miR2102-3pCAUGGUGCCGGUUCCGGUGGCGmiRBase.V20
osa-miR396f-5pUCUCCACAGGCUUUCUUGAACUmiRBase.V20
osa-miR396f-3pAUAGUUCAAGAAAGUCCUUGGAAAmiRBase.V20
osa-miR2103UUUCCCUCUCCGUGCGCGCUCGmiRBase.V20
osa-miR2104GCGGCGAGGGGAUGCGAGCGUGmiRBase.V20
osa-miR2105UUGUGAUGUGAAUGAUUCAUmiRBase.V20
osa-miR2106CCGAGGUUUUCUGGAUACAUUmiRBase.V20
osa-miR2120AAAGAUCUUUAGUCCCGGUUGUUCmiRBase.V20
osa-miR2121aAAAACGGAGCGGUCCAUUAGCGCGmiRBase.V20
osa-miR2122UUUCAAAAAUAACCUUUUGUUCmiRBase.V20
osa-miR2118aUUCUCGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118bUUCCCGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118cUUCCCGAUGCCUCCUAUUCCUAmiRBase.V20
osa-miR2118dUUCCUGAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2118eUUCCCAAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2118fUUCCUGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118gUUCCUAAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118hUUCCUGAUGCCUCUCAUUCCUAmiRBase.V20
osa-miR2118iUUCCUAGUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118lUUCCUAAUGCUUCCCAUUCCUAmiRBase.V20
osa-miR2118oCUCCUGAUGCCUCCCAAGCCUAmiRBase.V20
osa-miR2118pUUCCCGAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2275aUUUGGUUUCCUCCAAUAUCUCAmiRBase.V20
osa-miR2863aUUGUCCCAUUCUAGUUUAGCUmiRBase.V20
osa-miR2864.1UUUUGCUGCCCUUGUUUUGCAmiRBase.V20
osa-miR2864.2UUGUUUUGCAUUGUAUAGGUAmiRBase.V20
osa-miR2865CUCAGCAGUCGACUGUACCGUGmiRBase.V20
osa-miR2866UCUAGUUUGUGUUCAGCAUCmiRBase.V20
osa-miR2867-5pUGUGCCAUCCCACACAUCCCGAmiRBase.V20
osa-miR2867-3pCCAGGACGUGUGGGAUGGCAmiRBase.V20
osa-miR2868UUGGUUUUGUGUAGUAGAAAmiRBase.V20
osa-miR2869UCCCGACAUUAAAUUCUGGGCmiRBase.V20
osa-miR2870UAAUCAGUUUGGGGAGACAAAmiRBase.V20
osa-miR2863bUUCGUUUAUUUGGACUAGAGUmiRBase.V20
osa-miR2905UACAUGUCAGUGACAAAGGCAmiRBase.V20
osa-miR2871a-5pGACCGUAGAAACUAGCAUAGAAAAmiRBase.V20
osa-miR2871a-3pUAUUUUAGUUUCUAUGGUCACmiRBase.V20
osa-miR2872UGGGGUUCUACAAACCGAACUmiRBase.V20
osa-miR2873aAAGUUUGGACUUAAAUUUGGUAACmiRBase.V20
osa-miR2874AUGUGAACAGUGUCAAACAGUGUCmiRBase.V20
osa-miR2875AUUUACAGUCAUAUACAGUUUAUAmiRBase.V20
osa-miR2876-5pAAUUGCUGGCAGCACUGUUUAmiRBase.V20
osa-miR2876-3pUUCCUAUAUGAACACUGUUGCmiRBase.V20
osa-miR2877UUGCAUCCUCUGCACUUUGGGCCUmiRBase.V20
osa-miR2878-5pUACAUGUAUAAAAUUCUGAGGAUGmiRBase.V20
osa-miR2878-3pCAGGAUUUUAUACAUGUAAAGAAUmiRBase.V20
osa-miR1863cUAGAAACUUGGCUGAUGCAUUACUmiRBase.V20
osa-miR2879GCCAGAUGUGUUAAAAUAAUGACCmiRBase.V20
osa-miR2880ACGGUAUCCCGUUCGGACAGGAUGmiRBase.V20
osa-miR396gUCCACAGGCUUUCUUGAACGGmiRBase.V20
osa-miR1863bAGCUCUGAUACCAUGUUAACUGUUmiRBase.V20
osa-miR1863b.2AGAGACUUGGCUGAUGCAUUACUmiRBase.V20
osa-miR2907aGGCAGCCGAGCGAGGGCCUCGGmiRBase.V20
osa-miR2918AUCCGUGUUGUCUGCGCUUUAmiRBase.V20
osa-miR2919AAGGGGGGGGGGGGAAAGAmiRBase.V20
osa-miR2920AAACAACAAUAUAACAUUUCAAAmiRBase.V20
osa-miR2921AAGAACUUAAUAUAACUUUAAAGCmiRBase.V20
osa-miR2922AAUAAGUGAUUACCGAAAUUmiRBase.V20
osa-miR2923AGACAAAAAUAUAAAUAACAAAmiRBase.V20
osa-miR2924CUCGCUUGCUCCGGCCGCCACmiRBase.V20
osa-miR2925UGGCGGCCGCGGGCUUCGUmiRBase.V20
osa-miR2926AGGUCGUCGACGUUGGUGCUmiRBase.V20
osa-miR2927UGUCGUCGUCGAUGGAGCCCAUGmiRBase.V20
osa-miR2928AAGAAGACGACAUUUUGUUGmiRBase.V20
osa-miR2929CUCAAGGGUGUUUGUGAAAUAmiRBase.V20
osa-miR2930UUCUCUUCUCUCGCGCGUGGCCmiRBase.V20
osa-miR2931CUUUAUUGUUGAUGUCAAAAmiRBase.V20
osa-miR2932AGUAUGCCCACUACCUAUCmiRBase.V20
osa-miR395xGUGAAGUGUUUGGAGUAGCUCmiRBase.V20
osa-miR812kACGAACGGUUAAAGUUGGACGCGGmiRBase.V20
osa-miR1862fAUGAGGUUGGUUUAUUUUGGmiRBase.V20
osa-miR3979-5pUCUCUCUCUCCCUUGAAGGCmiRBase.V20
osa-miR3979-3pCUUCGGGGGAGGAGAGAAGCmiRBase.V20
osa-miR3980a-5pAAUCGACGGCCUCAGUCAGGGmiRBase.V20
osa-miR3980a-3pCUGGCCGAGGCCGUCGAUUCUmiRBase.V20
osa-miR812n-5pAAGUGCAGCCAUGAGUUUCCGUGCmiRBase.V20
osa-miR812n-3pACGGAAAAUCAUGGCUGCACUUAAmiRBase.V20
osa-miR812o-5pCGUGUUCAACGUUUGACUGUCmiRBase.V20
osa-miR812o-3pGAACGGUCAAAUGUUAGACACGGAmiRBase.V20
osa-miR3981-5pUGGGACGUAUCCUAUUACUAUmiRBase.V20
osa-miR3981-3pAGUAUUAGGAUACGUCUCAUCmiRBase.V20
osa-miR2873bUUGGACUUGAGAUUUGGUAUGmiRBase.V20
osa-miR3982-5pGCGCUCCACGUAGGCAACAAUmiRBase.V20
osa-miR3982-3pAGUUGCCUACAUGGAGCGCCAmiRBase.V20
osa-miR5071UCAAGCAUCAUAUCGUGGACAmiRBase.V20
osa-miR5072CGAUUCCCCAGCGGAGUCGCCAmiRBase.V20
osa-miR5073GUUUGGUGAAUCGGAAACUAUUUmiRBase.V20
osa-miR5074GAAGGCCACCGUCGGGAUCGCmiRBase.V20
osa-miR5075UUCUCCGUCGCCGCCGUCCGCmiRBase.V20
osa-miR5076GAAAUGGGAGCAGAGCAGGUUUmiRBase.V20
osa-miR5077GUUCGCGUCGGGUUCACCAmiRBase.V20
osa-miR5078CCUCGUUCGACCGUGGCAUUUmiRBase.V20
osa-miR5079aUUUGGAUCUGUUAUUUUGGUAUmiRBase.V20
osa-miR5080AAAAGGAUCAUACCGUGACAGmiRBase.V20
osa-miR5081UAAUUUGUAGCAAAUUGAUAGUmiRBase.V20
osa-miR5082UGCGAUGAUGGCCGCGCGGGUUCAmiRBase.V20
osa-miR5083AGACUACAAUUAUCUGAUCAmiRBase.V20
osa-miR5143aUGUGGUAUGUUGGCAAUGUAGGAAmiRBase.V20
osa-miR5144-5pUUCUUGUGCUGCUGAAGAGACmiRBase.V20
osa-miR5144-3pUCUCCUCAGCAGCACAAGAAGmiRBase.V20
osa-miR5145ACCUGUUUGGAUUCUUGAGGGCUAmiRBase.V20
osa-miR5146UUUAACUAAUGAACCGGCACCUAUmiRBase.V20
osa-miR5147ACAACUCUUGUGGAUGGAGGGmiRBase.V20
osa-miR2863cUUAGUAGGACUAGAAUGGGCCAAAmiRBase.V20
osa-miR5148aUGAGGGGUAGAAAUGUCAUAUCAUmiRBase.V20
osa-miR5149GAGGAGCUGUGACGAUUUGGGAmiRBase.V20
osa-miR5150-5pAGCUUCUGACAGCUGCAGUUUCUCmiRBase.V20
osa-miR5150-3pAGAAGCUGCAGCUGUCAGAAGCUCmiRBase.V20
osa-miR5151UAAUGAUGUGGGUACGAAUGAAmiRBase.V20
osa-miR5152-5pGUAGGGAUAGGCAUGAUCUCUmiRBase.V20
osa-miR5152-3pAGACCAUGCCUAUACCUACCAmiRBase.V20
osa-miR5153UGGAUUCCACUGACACGUAGACGUmiRBase.V20
osa-miR5154AGCACCAGUUGACGUGACGCUGAGmiRBase.V20
osa-miR5155ACUUUAAUACCAUUGGAAGAUUGCmiRBase.V20
osa-miR5156AGCCUGUAAAACUGCAAAAAGGAAmiRBase.V20
osa-miR5157a-5pAACUUUUUAAUAGCUACAACUUCUmiRBase.V20
osa-miR5157a-3pAGAAGUUGUGGCUAUCAAAAAGUUmiRBase.V20
osa-miR5158UGAGCCACUGGGAUGAGGAUGAAUmiRBase.V20
osa-miR5159AACUAGAGUGGGUCAACGGGUACCmiRBase.V20
osa-miR5160CGAGAUCGAUGGUAUAUUUCUGmiRBase.V20
osa-miR5161UCUGGAUCAGAGGGAGUAUAmiRBase.V20
osa-miR5162AAAUGACCAAAAUACCCCUAGAACmiRBase.V20
osa-miR5337aAAAUUACUUGUCGUUCUAGCUmiRBase.V20
osa-miR5338UGAAGCUUCAGUUGGUUGUAUmiRBase.V20
osa-miR5339CAGAUAGAGAAUCUUCUCAGAmiRBase.V20
osa-miR5340UGAUGACGUGGAUGAAUUUCAAAmiRBase.V20
osa-miR5484AACCGAGCGCGCUGUUGAUUAmiRBase.V20
osa-miR5485UGACAACUGGUAGCAGAGCAAmiRBase.V20
osa-miR5486AGGGGCUUGCAUAUUCUACCAmiRBase.V20
osa-miR5487AAAGAUGUGCAUGUAGUUCCGmiRBase.V20
osa-miR5488UGAAGGCGACUGAUGAUUUCAmiRBase.V20
osa-miR5489CAGGUGUUCUCGAUGGCUUCCmiRBase.V20
osa-miR5490UUGGAUUUUUAUUUAGGACGGmiRBase.V20
osa-miR5491UGAAAUGGAGGCUCGUUGUACmiRBase.V20
osa-miR5492AGAAGGAGAAUAGAUAUGGUUmiRBase.V20
osa-miR5493AGCCGGGCUCGGUCGCGCGUGmiRBase.V20
osa-miR5494UUAUAGGAGGUAUAGACGGUAmiRBase.V20
osa-miR5495AGAGGUCCGGAUCGAACGUAGmiRBase.V20
osa-miR5496CCAGCCGGUGGCAUAGUUCUCmiRBase.V20
osa-miR5497CAGAAUAUCUGGGACGAGCAUmiRBase.V20
osa-miR5498UGAGCUGUAACACUUGAAGACmiRBase.V20
osa-miR5499GAAGGAAGAAUCGUUAUGGAAmiRBase.V20
osa-miR5500AUCACUGAUGAAAUCUUGCGGCmiRBase.V20
osa-miR5501UCUUGUGGCUAGAAGGGUGAGmiRBase.V20
osa-miR5502UACGGAUACGGAUACGCGAUACmiRBase.V20
osa-miR5503UUCGGAUCUUUCUAGAGGCAUUmiRBase.V20
osa-miR5504AGUGACGGGAGGACUGCAAGGmiRBase.V20
osa-miR5505GAGGAUUCGGUAUUGAUCGCUAmiRBase.V20
osa-miR5506UGGAUCGCUUCGUCUGAUGGUmiRBase.V20
osa-miR5507AAUGAGAAUGAUGACCCGGUGmiRBase.V20
osa-miR5508UAGAUGGCUGAUCUGGUGUGGmiRBase.V20
osa-miR5509UAGGCAUUUUCUCUUGGCAUGmiRBase.V20
osa-miR5510AGGCUGAUCCACUCCAGAGGAmiRBase.V20
osa-miR5511CAUAUCCCAGCUGUUUCGGCCmiRBase.V20
osa-miR5512aUAGGAUAUGGUAAUGCUAAAAmiRBase.V20
osa-miR5513UAACAAAGGACAACAGACUGAmiRBase.V20
osa-miR2275cAGAAUUGGAGGAAAACAAACUGAmiRBase.V20
osa-miR5514UCCCAGAGCUUUGGCCGUCGCmiRBase.V20
osa-miR5515CCGAUGGUUGUUCUACAGGUGmiRBase.V20
osa-miR5516aCUCAUUGCUUCGGUAGGCUGGmiRBase.V20
osa-miR5517UGCAUCACGGCGCAUAUGUAGmiRBase.V20
osa-miR5518AUACUCAAACAGGGCAUUGCAmiRBase.V20
osa-miR5519UGGCAGAAGUACUGGACUUAGmiRBase.V20
osa-miR5521AGUGGCUGCAUAUCUGAUGAGmiRBase.V20
osa-miR5522AACAAUAGGAAUGGGAGGCAUmiRBase.V20
osa-miR5523UGAGGAGGAACAUAUUUACUAGmiRBase.V20
osa-miR2275dCUUGUUUUUCUCCAAUAUCUCAmiRBase.V20
osa-miR5524UGGAAAAUGUGUUCAUGACGGmiRBase.V20
osa-miR5525UGAACCUUGGGAGCGAUCUGAAmiRBase.V20
osa-miR5526AAAGGUAGAGUCAGGUAUGAGmiRBase.V20
osa-miR5527UCUCAGCCAGGGCAGUAACAGmiRBase.V20
osa-miR5528AAGACGGUUUUAGAUGUUGCCmiRBase.V20
osa-miR5529GUUUCAUCCAUGGACACCGCAmiRBase.V20
osa-miR5530AGUGGUGUCGUAUUACCUGCCmiRBase.V20
osa-miR5531ACUGACUGCCUUGAGCUCCGGGmiRBase.V20
osa-miR5532AUGGAAUAUAUGACAAAGGUGGmiRBase.V20
osa-miR5533CUUUGCCAGAAGCCCUCAUGGmiRBase.V20
osa-miR5534aUGACGACAACAGCUAGAAUGGmiRBase.V20
osa-miR5534bCGAUGACAACAGCUAGAAUGGmiRBase.V20
osa-miR5535UCUGCGUGAUUGAAGUCUGCAUmiRBase.V20
osa-miR5536AAUGGUAGUGACAUUAUGGUAGmiRBase.V20
osa-miR5537AAUGUUUGUAUGGAUCGUUUGUmiRBase.V20
osa-miR5538ACUGAACUCAAUCACUUGCUGCmiRBase.V20
osa-miR5539aAAGAAAACGGAUGCGCGUGCUAmiRBase.V20
osa-miR5540UUGUGCGAGAUCGACGGUAUAmiRBase.V20
osa-miR5541UCAAGUGGUGUACUCUAAAGAmiRBase.V20
osa-miR5542UUUGAGAAGGUAUCAUGAGAUmiRBase.V20
osa-miR5543UAUGAAUGGUAUAUUUUCUUGmiRBase.V20
osa-miR5544AGAACACGGAGUAGAAGUUGGUmiRBase.V20
osa-miR5788UGGAUGUGACAUACUCUAGUAmiRBase.V20
osa-miR812pGACGGACGAUUAAAGUUGGGCAUGmiRBase.V20
osa-miR812qACGUUGGGUACGAAUAUCUACGGCmiRBase.V20
osa-miR5789UGACUGAGCUUCGUUCGGUAUmiRBase.V20
osa-miR5790AAGACGAUCCUAGCAGAGCUUCAUmiRBase.V20
osa-miR5791UUGCAGGAGACUAGAGACCAGmiRBase.V20
osa-miR5792GAUGACAGCGGUGGUUCGGACAUCmiRBase.V20
osa-miR5793CGAGGACGAGAUACAGUGCAGmiRBase.V20
osa-miR5794UGAGGAAUCACUAGUAGUCGUmiRBase.V20
osa-miR812rACGUUAGACACGAAUUUCUACGGCmiRBase.V20
osa-miR5795AUGUCGAGGUCGAGUUCCCGGCmiRBase.V20
osa-miR5796UCAUUCAGGAUUGAAGCCGCCmiRBase.V20
osa-miR5797UCGUGGGAUUUAUGCAGUUAAmiRBase.V20
osa-miR5798CUGGACUACAAGAUCCCGGAUmiRBase.V20
osa-miR812sAAGACGGACAAUCAAACGUUGGACmiRBase.V20
osa-miR5799AAGACGAAUAAUCAAACGUUGGACmiRBase.V20
osa-miR5800CCCGGCUAUCGGAACGGCUGCmiRBase.V20
osa-miR5801ACCAAAUCGUUUUCGAUCGUUGGAmiRBase.V20
osa-miR5802AUGGACUGUACUUUGUAAAGCGGAmiRBase.V20
osa-miR5803ACCACUGUAGACGCUACGUGUGAGmiRBase.V20
osa-miR5804UGCGAAGUAGAGAUGCCGACUmiRBase.V20
osa-miR5805ACGAGUGAUGGCGGCGUAUACCUGmiRBase.V20
osa-miR5806ACAGGCAAAGACAAUGACGGCmiRBase.V20
osa-miR812vAUGGCUGCACUUAAAAUGGGACGGmiRBase.V20
osa-miR5807AGGAGGUCUGGAGAGUUAUGUGGCmiRBase.V20
osa-miR5808ACUAAAUCGUUUCUGAUCGUUGGAmiRBase.V20
osa-miR5809UCGUCGCCGGCGACCACAGCmiRBase.V20
osa-miR5810ACGGAACCCUAAUGGCGAUGGCAUmiRBase.V20
osa-miR5811CCUAACCUAGGAGUUCGAUGGGACmiRBase.V20
osa-miR5812AGCAACGAUUUUAAGAUUGUGGCAmiRBase.V20
osa-miR5813AAGCAGCGACUCUGGUCAUGGAmiRBase.V20
osa-miR5814AAUCAAGUUAGGAACCAUGCAAGUmiRBase.V20
osa-miR5815AAUGUUAUGGACACUAGAUGACAUmiRBase.V20
osa-miR5816UAGGAGUGUUUGUAGGAGCGCCACmiRBase.V20
osa-miR5817AUCGAAUUUGAAAGAAAAAGGUAUmiRBase.V20
osa-miR5818UCGAACUAGAAGGGCCAGGUUmiRBase.V20
osa-miR5819AGGACGAGGGGAACGGCGGCGmiRBase.V20
osa-miR5820UGGCAGAGAUUGAUCGAGGAAmiRBase.V20
osa-miR5821UGGACGGAGCGAUGGUGGGCGmiRBase.V20
osa-miR5822UGUCUGCUCGAUGUCAGGUUGmiRBase.V20
osa-miR5823AAGGAAUUGGGUCUAAUCUCUUCCmiRBase.V20
osa-miR5824AGUCUGAUAAGAAGUCAAUGGCGUmiRBase.V20
osa-miR1319bCCUUUAAUAUAUUAUAGGUGUCGGmiRBase.V20
osa-miR5825AAAACAUCUGAUAACCUGAAACGGmiRBase.V20
osa-miR5826UAGCCCAAAGUGAGAAGAGUGGGUmiRBase.V20
osa-miR5827UUUGUUGCAAUUUGGACUACCmiRBase.V20
osa-miR5828UUACGGCAUUAAAAGUAAAUCmiRBase.V20
osa-miR5829AUCAGGACCAGUAGGCGAUGGUAAmiRBase.V20
osa-miR5830AUGUAGAUGAGGUGAUGUUACACAmiRBase.V20
osa-miR5831UAGUCAAACUUAGAAUAGUUGGACmiRBase.V20
osa-miR5179UUUUGCUCAAGACCGCGCAACmiRBase.V20
osa-miR5832UUGGCGGAGCGGUUGCUGUCAmiRBase.V20
osa-miR5833UCCUCCUCGGGCUCAUCGGGCmiRBase.V20
osa-miR5834ACGGAUGUAGAAAUUGGUGAUmiRBase.V20
osa-miR5835ACGAAACCAUAGGGAUUUUGGCAUmiRBase.V20
osa-miR2873cCAAAUGAAGUUGAGUUUGGACmiRBase.V20
osa-miR5836UGAGCAGCCGGACCAUGGGAUmiRBase.V20
osa-miR5837.2GGUGAUGUGGAGCGUUCGGCAmiRBase.V20
osa-miR5837.1AUGUUGGAAUGACAUGCAGCUmiRBase.V20
osa-miR6245AGUAUAGGUGUCGGCUCUAUUmiRBase.V20
osa-miR1440bUUUAGGAGAGUGGUAUUUGAGmiRBase.V20
osa-miR6246UUGGGGAUUUCCUGCCGGAGGAAmiRBase.V20
osa-miR6247UGGCUGAUUGACCUAAUGGCAmiRBase.V20
osa-miR6248UAUUUGAGGAUGGAGGUAGUAmiRBase.V20
osa-miR5337bCUAGAACGGCAAGCAAUUUGAmiRBase.V20
osa-miR6249aCGUGAAGAGCUCGCCGGCGGCmiRBase.V20
osa-miR6250GGGGAUAGAUCGACGCGUCAAGmiRBase.V20
osa-miR6251UGUGUAGCCACAUUGUAAGGGmiRBase.V20
osa-miR6252AUUCGUUGUAUUAAGAGAGGGUUmiRBase.V20
osa-miR6253GAGGAAAGUGGGCAGUUGGGUUmiRBase.V20
osa-miR6254UGCUCCGGAUAUUAUGGCAUGmiRBase.V20
osa-miR6255UGGGAAAAAUGGGCAGUUGAGUmiRBase.V20
osa-miR6256GUAGUACUCGGUUGUAGGUGUAmiRBase.V20
osa-miR818fGGGAGCAUGUAGGAUGGCCAUmiRBase.V20
osa-miR1437b-5pGGGAGGAAACAGUGCCUAGUGmiRBase.V20
osa-miR1437b-3pGUGCUGGCGAGCUCCGGUGCCGCAmiRBase.V20
osa-miR7692-5pGAUCCAAAAAAGUGCCACGUGAGCmiRBase.V20
osa-miR7692-3pUGACUUGGCAUGCUUACGUGGCACmiRBase.V20
osa-miR7693-5pGUUUCCGCUCUUCAUCGAUGGCUGmiRBase.V20
osa-miR7693-3pGACGUCCAUCGAUGAAGAGCGAmiRBase.V20
osa-miR7694-5pAACCUAGUACUGGAUUAGUCACCAmiRBase.V20
osa-miR7694-3pCCAUAUUCGUAGUGCUAGGUGGmiRBase.V20
osa-miR7695-5pUGCCUAUGUGGCACGCCACGUGAAmiRBase.V20
osa-miR7695-3pACGUGAUGUGCCACGUAGGCAmiRBase.V20
osa-miR1317UAGGGAACCCCAUUCCCAUAAAPMRD
osa-miR1318UCAGGAGAGAUGACACCGACPMRD
osa-miR1423-3p.2AGCGCCCAAGCGGUAGUUGUCUCCPMRD
osa-miR1423bCAACUACACGUUGGGCGCUCGAPMRD
osa-miR1429-3p.2GUUGCACGGGUUUGUAUGUUGCAGPMRD
osa-miR1429-5p.2GUAAUAUACUAAUCCGUGCAUCCAPMRD
osa-miR156oUGACAGAAGAGAGUGAGCAUPMRD
osa-miR156pUGACAGAAGAGAGUGAGCUCPMRD
osa-miR156qUGACAGAACAGAGUGAGCACPMRD
osa-miR156rUGACAGAAGAGAGAGAGCACPMRD
osa-miR163mUGAAGAGGACUUGGAACGUUCPMRD
osa-miR168aQCCCGCCUUGCACCAAGUGAAUPMRD
osa-miR172mAGAAUCCUGAUGAUGCUGCAGPMRD
osa-miR1849.2AAUGCCCUAUCGUAUCCUAGGUUGPMRD
osa-miR1857-5p.2UGGAGCAUGAGGUUAUCUCUCPMRD
osa-miR1867UUUUUUUUCUAGGACAGAGGGAGUPMRD
osa-miR1868.2AAGCGUGCUCACGGAAAACGAGGGPMRD
osa-miR1873.2ACCUCAACAUGGUAUCAGAGCUGGPMRD
osa-miR1873QUCUAGCUCUGAUACCAUGUUGAGUPMRD
osa-miR1884aUGUGACGCCGUUGACUUUUCAUPMRD
osa-miR1884bAAUGUAUGACGCUGUUGACUUUUAPMRD
osa-miR2123aUAAAAAGUCAACGGUGUCAAACPMRD
osa-miR2124aACUUUAAAUGUGUGUCCGUAUAUUPMRD
osa-miR2125UUUUUCUCUAUAGACUAUCUCCAGPMRD
osa-miR2862UCCAACAGCUUAGAUUCGUCCPMRD
osa-miR2876.2UCCUAUAUGAACACUGUUGCCAGCPMRD
osa-miR2906aAACGGGCCGCCGCACUGCUGGPMRD
osa-miR395a.2UGAAGUGCUUGGGGGAACUCPMRD
osa-miR396eQGUUCAAGAAAGCCCAUGGAAAPMRD
osa-miR396fQGUUCAAGAAAGUCCUUGGAAAPMRD
osa-miR397a.2UUGAGUGCAGCGUUGAUGAACPMRD
osa-miR420UAAAUUAAUCACGGAAAUGAUPMRD
osa-miR437-3p.2AAAGUUAGAGAAGUUUGACUUAGGPMRD
osa-miR437-3p.3AGAAGUUUGACUUAGGACAAAACUPMRD
osa-miR441aUACCAUCAAUAUAAAUGUGGGAAAPMRD
osa-miR442UGACGUGUAAAUUGCGAGACGAAUPMRD
osa-miR445aUAAAUUAGUGUAUAAACAUCCGAUPMRD
osa-miR446CAUCAAUAUGAAUAUGGGAAAUGGPMRD
osa-miR5520GGCUAGUACAUUGGGUAGGCAPMRD
osa-miR806aAUGUGCUAAAAAGUCAACGGUGPMRD
osa-miR807aCGUCAUCUCACAGGUGAAUCCPMRD
osa-miR808AUGAAUGUGGGAAAUGUAAGAAPMRD
osa-miR809aUGAAUGUGAGAAAUGUUAGAAUPMRD
osa-miR811aACCGUUAGAUCGAGAAAUGGACGUPMRD
osa-miR813GGGUUAUGGAAUGGGUUUUACCPMRD
osa-miR819aUCAGGUUAUAAGACUUUCUAGCPMRD
osa-miR820a-5p.2UCGGCCUCGUGGAUGGACCAGGAGPMRD
osa-miRf10000-akrAGAGGAUAUCCCCUCGAGGGAUGAPMRD
osa-miRf10001-akrGAGGGGAUAUUCCCUCAAGGPMRD
osa-miRf10002-akrAGGAUGCCACAUUCUCAUCCPMRD
osa-miRf10003-akrGAUCUUUAGUCCCGGUUGGUAAPMRD
osa-miRf10004-akrAACUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf10005-akrUCCCGGUUGGACAACCGGGACUAAAPMRD
osa-miRf10006-akrAGUCCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf10007-akrCAUCUUUAGUCCCGGUUCGAPMRD
osa-miRf10008-akrGAUAUCUUUACUCCUGGUUGPMRD
osa-miRf10009-akrCUCUUAAGACGCUGCUUGCAPMRD
osa-miRf10010-akrUCCCGGUUGUUGAGAACAACCGGGAPMRD
osa-miRf10012-akrACGGGCUCACCAUUGCAGGAGGAAUGPMRD
osa-miRf10013-akrGGAGUUGGCCGUUUGCCUGCPMRD
osa-miRf10014-akrAGUCCCGAUUGGUAACACCAACCGGPMRD
osa-miRf10015-akrCCGGUUGGUGUUACCAAUCGGGACUPMRD
osa-miRf10016-akrGGCUCACCAUUGCAGGAGGAAPMRD
osa-miRf10017-akrAGUCAUCUGUGACGGGUUAGPMRD
osa-miRf10018-akrUAGGAUGUGUCAUAUCCCACPMRD
osa-miRf10019-akrAAGAGAGGGGUUUCCUCGGAGPMRD
osa-miRf10020-akrCAGCGCCAGUUGACAUGGCGCUGAPMRD
osa-miRf10021-akrUCAGCGCCAUGCUAUUUGGCGCPMRD
osa-miRf10022-akrAUAAGGGAUCUUGGGUGGAUGUPMRD
osa-miRf10023-akrUCCCGGUUUUUUAUACCAACCGGGAPMRD
osa-miRf10024-akrUUGUACUAGGAUGUGUCCCAUCCPMRD
osa-miRf10025-akrGUACUAGGAUGUGUCCUAUCPMRD
osa-miRf10026-akrGUACUAGGAAAUGUCACAUCCPMRD
osa-miRf10027-akrAUGGCCAAAUGCUUUGGCUGPMRD
osa-miRf10029-akrUGCUUUGGCUGAUCAGCCAUPMRD
osa-miRf10030-akrAACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10031-akrCGCAGGCGGACCAGUUGUCCPMRD
osa-miRf10032-akrGCUGGAGCUCAGUCAAACAGPMRD
osa-miRf10033-akrGUGUUCGGCUGCAGCAGUGCPMRD
osa-miRf10034-akrUCGGUUGGUGUUACGAACCGGPMRD
osa-miRf10035-akrCCUGUGAAGAUGGAUCUUCGCAGGPMRD
osa-miRf10036-akrUUUGCAGGCGGACAGCUGGUCCPMRD
osa-miRf10037-akrUGGACCAGUUGUCCGCCUGUPMRD
osa-miRf10038-akrCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10039-akrAUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10040-akrCUGCAGCUACAGACAAGUUGCPMRD
osa-miRf10041-akrGACCUCUUAAGUGGUCUGCGPMRD
osa-miRf10043-akrUCAGCGCCACGCUAUUUGGCGCUGPMRD
osa-miRf10044-akrUGUCGAACUGCGUCAGUUCGACAGGPMRD
osa-miRf10045-akrGUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf10046-akrUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10047-akrAGUCCCGGUUGGUAACACAAACUGGPMRD
osa-miRf10048-akrCGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf10049-akrUCAUCAUCGCCGCCGAGUCCUCPMRD
osa-miRf10050-akrUAGUCCCGGUUGAAAAACCGGPMRD
osa-miRf10053-akrAAAACACGCUUUCGGGUAUGCPMRD
osa-miRf10054-akrGGUGUUACUAACCGGGACUAPMRD
osa-miRf10055-akrCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10056-akrUGGUAACUCCAACCGGGACUAAAGUUPMRD
osa-miRf10058-akrAUAGUCCCGGUUGGACAACCGGGAPMRD
osa-miRf10059-akrAACUUUAGUCCCGGUUGGUGPMRD
osa-miRf10060-akrGAAGACGAGGUUGGCGAUGCCGAPMRD
osa-miRf10061-akrUAUCGCUCCGUUUUCCGUGCPMRD
osa-miRf10062-akrCUCGAUCUUCGCUUGAAUGGCCPMRD
osa-miRf10063-akrUUGCCGCUGCUACCGCCUUCGPMRD
osa-miRf10065-akrCUGGUGCAGGAUGGCGCCGAUGCPMRD
osa-miRf10066-akrUCCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf10067-akrCAAUGGUCGUAUCCAUAGUAGCCAUGPMRD
osa-miRf10068-akrCCGUAGUAGCCAUGGUCACAUCAGUUCPMRD
osa-miRf10069-akrAGUAGCCAUGGUCACAUCAGUPMRD
osa-miRf10070-akrUGAUGUGAUCAUGGCUACUAPMRD
osa-miRf10071-akrACUCACAUGUUACGUGUGAGGPMRD
osa-miRf10072-akrACUCACACGUUACGUGUGAGGPMRD
osa-miRf10073-akrGAUGAGUCAUCUGUGACGGGCPMRD
osa-miRf10074-akrCCUGUCGAACUGCGGUAGUUCGACAGGPMRD
osa-miRf10075-akrUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf10076-akrUCCAGGAGUUGGGUUUGAAGUPMRD
osa-miRf10077-akrCCCGGUUGUUUAUACCAACCPMRD
osa-miRf10079-akrCUUCUUCCCGGUCAUGGGGUPMRD
osa-miRf10080-akrGAUCUUUAGUCCCGGUUGGUAAUPMRD
osa-miRf10082-akrCCCACGUGGGUUCUACGCUGAGUCAPMRD
osa-miRf10083-akrUAGGACCCACGUAGGCCCCACAUGUPMRD
osa-miRf10084-akrUUAGGGUUCCGUCCAUUCCAPMRD
osa-miRf10085-akrGGAUCUCUUAAGUGGUCCGCCUGPMRD
osa-miRf10086-akrCACGGCUGGCCUAUUAUGCCGCCGPMRD
osa-miRf10089-akrUCCGUCCCAUAAUGUUGCAACPMRD
osa-miRf10090-akrGAUGAUCUUUAGUCCCGGUUGPMRD
osa-miRf10091-akrUAGUCCCGGGUGGUAACACCAACPMRD
osa-miRf10092-akrCAUGGUACCUUCUCAAGGACPMRD
osa-miRf10093-akrCUCGGGUCCACAUGUCAGCCPMRD
osa-miRf10094-akrACAUGUGGACCCGAGUGCCAPMRD
osa-miRf10095-akrUGACGUGGCGCUGAGGUGUCUAAPMRD
osa-miRf10096-akrCUUAGACACCUCAGCGCCAAAPMRD
osa-miRf10097-akrCACAGUUGCCAGAAGCUUUUPMRD
osa-miRf10098-akrAGGUGGGCCCCACGGGUCAGUGAPMRD
osa-miRf10099-akrUAGUACUCCCUCCGUCCCAAAAUPMRD
osa-miRf10100-akrAGGUAUCAGGACCUGAUAUCUPMRD
osa-miRf10101-akrGGUCUACAUGUCAGCCUCACPMRD
osa-miRf10103-akrACCUGGGUCCACAUGUCAGCCUCPMRD
osa-miRf10104-akrCAGCCGCAUGCGAAAAUAGGPMRD
osa-miRf10105-akrUUGGCCUCGUCGAAGAAGGAGAPMRD
osa-miRf10106-akrCCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10107-akrCCGCAUGCGAAGAUCGAUUUUCGCPMRD
osa-miRf10108-akrCUAAUGCCCGUCACUGAUGAGPMRD
osa-miRf10109-akrUCAUCUUUAGUCCCGGUUCGPMRD
osa-miRf10110-akrAACUUUAGUCCCGGUUGGUAPMRD
osa-miRf10111-akrGGUGACAGAAGAGAGUGAGCAPMRD
osa-miRf10112-akrCCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10113-akrUUGGUGUUACUAACCGGGACUAAAPMRD
osa-miRf10114-akrGAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10115-akrUAACACCAACCGGGACUAAAGPMRD
osa-miRf10116-akrGAAGGUCCCUCAACUUGUCAUCGPMRD
osa-miRf10117-akrUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf10118-akrUACAUUCCUUGAGGAGGUACCAUGPMRD
osa-miRf10119-akrACAGUCCUUGAGGAGGUACCAUGAGPMRD
osa-miRf10120-akrUGGUACCUCCUCAAGGACUGPMRD
osa-miRf10121-akrUCCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10122-akrACCACGUGGGCCCCACAAGUCPMRD
osa-miRf10123-akrCGGUGAUCCCUGUCAGAGGUAAPMRD
osa-miRf10124-akrGGCGCCGUUUAAGUGGUCCACCCGPMRD
osa-miRf10126-akrAACCUGAUCUUGCGUUAGCCGAUUCPMRD
osa-miRf10127-akrUGUUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf10128-akrGAGUGGCACGGUUCCAAUUUCCPMRD
osa-miRf10129-akrGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10130-akrGUGGCAAUGCCACAUGGACAUGPMRD
osa-miRf10131-akrUUAGUCCCGGUUGGUAACACCAACCPMRD
osa-miRf10132-akrGCGAGCUUCUCGAAGAUGUCGUUGAPMRD
osa-miRf10133-akrGGUGUUACCAACCGGGACUAPMRD
osa-miRf10134-akrCCGUUUGGUGUUACCAACCAGGAPMRD
osa-miRf10135-akrUCUCCCUCUGAAUGCAGUGUPMRD
osa-miRf10136-akrCAGCAAGUGCAGCUACUGCAPMRD
osa-miRf10137-akrGUAGCUGCACUUGCUGCAUAGPMRD
osa-miRf10138-akrAGUCCCGGUUAGUAACACCAACCGGPMRD
osa-miRf10139-akrAGAGAGGCUGGCACUGUCCUPMRD
osa-miRf10140-akrUAUGGUGGUGUUCAGCAGCAGCAUPMRD
osa-miRf10141-akrAUGCCCCUGUCCAGAUUCGUPMRD
osa-miRf10142-akrGGACAUGCCCCUGUCCAGAUPMRD
osa-miRf10143-akrCAUGCGGUUGCCCCAACCGCAUPMRD
osa-miRf10144-akrGGCGAGCUUCUCGAAGAUGUCGUPMRD
osa-miRf10145-akrCGUGAUACUCACGAGGUAUCAUGPMRD
osa-miRf10146-akrAUGUGGGCAAUGCUAGAAAGUPMRD
osa-miRf10147-akrCAUGGUACCUGUAGGUACCAGPMRD
osa-miRf10148-akrUGAUACCUGAUAGGUAUCACAPMRD
osa-miRf10149-akrUCUGAUACCUAACAGGUAUCACPMRD
osa-miRf10150-akrUCGUUGCCACUUGCCAGUUCPMRD
osa-miRf10151-akrUGGCUAUAUUUUGGGACGGAGPMRD
osa-miRf10152-akrCUUGUCCGCCUGCGAAAAUAUGPMRD
osa-miRf10153-akrUGCUGCUGCUGCAUGACGAGPMRD
osa-miRf10154-akrAAUGACUUACGUUGUGAAACGGAGGPMRD
osa-miRf10155-akrAUACUCCCUUCGUCCCAAAAAAPMRD
osa-miRf10156-akrGGUGUUACAAACCGGGACUAPMRD
osa-miRf10157-akrUAGUCCCGGUUUGUAACACCPMRD
osa-miRf10158-akrGCUGCCAAAGGAGAUUUGCCPMRD
osa-miRf10159-akrUCUGAUACCUCGCGGGUAUCACGUGAUPMRD
osa-miRf10160-akrGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10161-akrUCUCGGACGUCUAUUUCUCGAUCCAACPMRD
osa-miRf10162-akrCACAUGUCAGUGACCACGUCPMRD
osa-miRf10163-akrGUCAUGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf10164-akrUCUUCUCUUCUUCAGUGAGGGAGGCPMRD
osa-miRf10165-akrUGCUAGAAGCUCACCCAAACAGPMRD
osa-miRf10166-akrCUGCUAGAAGCUCCCCCAAAUAGPMRD
osa-miRf10167-akrGCUGUUUGGGUGAGCUUCUAGCPMRD
osa-miRf10168-akrAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf10169-akrAUCGAUCUUCGCAUGCGGCUGGGPMRD
osa-miRf10170-akrAGUCCCGGUUGAUAACACCAACCGGPMRD
osa-miRf10171-akrAGAAGAAGAUGUGACCCCUCPMRD
osa-miRf10172-akrUGUCCAGAUUCGUAGUGCUAPMRD
osa-miRf10173-akrCUUACAUUGUGAAACGGAGGGAGUAGPMRD
osa-miRf10174-akrUCUCGCGCAAUGGUUAUGCGAPMRD
osa-miRf10175-akrAAAAAACUUAACCUAGGAGGGGPMRD
osa-miRf10176-akrUAGGUAUCAGGUAUCAGGUACCAGPMRD
osa-miRf10177-akrUAACGAGCCAGCUCGGGUCGPMRD
osa-miRf10178-akrAGCACUGCAGCAGCUAUAGGPMRD
osa-miRf10179-akrUACUACUUCCUCCGUCCCAAAAUAUPMRD
osa-miRf10180-akrACUACUUCCUCCGUCCCAAGAUAUPMRD
osa-miRf10181-akrGAAGAUGUAGUUGCUGCUCCCUPMRD
osa-miRf10182-akrAUGUAGUUGCUGCUCCCUAAPMRD
osa-miRf10183-akrUCCCGGUUGAAAAACCGGGACUAPMRD
osa-miRf10184-akrGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf10185-akrCGUUGGUGUUGAGCACGGCGAPMRD
osa-miRf10186-akrUGGCCCACAUGUCAAUGGCAAAAPMRD
osa-miRf10187-akrCCGGUUGGUGUUACCAAUCGGGAPMRD
osa-miRf10188-akrUAGUCCCGAUUGGUAACACCAACCGGGAPMRD
osa-miRf10189-akrUUACUCCCGGUUGGUGUUACCPMRD
osa-miRf10190-akrUUUUUCCCGGUUGGUGUUACCPMRD
osa-miRf10191-akrGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10193-akrGCAUGUGUCCAAAGAUUCGAUGUPMRD
osa-miRf10194-akrCAUGUGUCCAAACAUUCGAUGUGAAAPMRD
osa-miRf10195-akrGCGUGUCACAUCAGGUAUACPMRD
osa-miRf10197-akrUUAGUUCCGGUUGGUGUUACCPMRD
osa-miRf10198-akrUAACUUUAGUCCCGGUUGGUGPMRD
osa-miRf10199-akrCACAGGUGAGUCAUCUGUGAPMRD
osa-miRf10200-akrGGUGAUACCUGUAAGGUAUCAPMRD
osa-miRf10201-akrAUGAAUGUGGGCAAUGCUAGAAPMRD
osa-miRf10202-akrGUACCUCGAGGUACCGGUACCPMRD
osa-miRf10203-akrCGUGAGGUACCGAUACCUCGAGPMRD
osa-miRf10204-akrGGGUAUGACAUGUGAGUCCCACCGAUPMRD
osa-miRf10205-akrGUAUGACAUGUGAGUCCCACPMRD
osa-miRf10206-akrCUACGCUGCCGGUCGAAGACCAGUCPMRD
osa-miRf10207-akrGACGAGUGGUCAAACAGCGCPMRD
osa-miRf10208-akrACGAUGGCUUGGGAGAUUUGCPMRD
osa-miRf10209-akrUGGGAACAGCUCUUGCGAACAPMRD
osa-miRf10210-akrCAAUAGCAGGCUAUAAGCCAGCUPMRD
osa-miRf10211-akrCUGUUUGGCACAGCUCCAGCUCPMRD
osa-miRf10212-akrAAAUCCCUUGUAUUAGGGGACGGAGPMRD
osa-miRf10213-akrGUAGUUGCUAGAAGCUCCUUPMRD
osa-miRf10214-akrGCAGCUGGCUACAUAUCUGUAGCCPMRD
osa-miRf10215-akrCUUGAGGAGGUAUCAUGAGGUACPMRD
osa-miRf10216-akrCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10218-akrUAUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf10219-akrUGAGGGACCUUCGGUGUACUPMRD
osa-miRf10220-akrUAGGAUGUGUCUCAUCCACCCAPMRD
osa-miRf10221-akrACAGCUGGCCUAUUAUGCCGCUGUUPMRD
osa-miRf10222-akrGCCGCCUCGACUCCUCUCUAPMRD
osa-miRf10223-akrCGACGUCGACGAUGAUGUCGUCGPMRD
osa-miRf10224-akrGGCUUCUUCAAGAAGGCCAGPMRD
osa-miRf10226-akrCCGGCGACCACCUCUUCUUCUCPMRD
osa-miRf10227-akrAUAGAGAGUGAGCACGCACAPMRD
osa-miRf10228-akrGCAUCUCUCAACUGCAAAACCGGGUPMRD
osa-miRf10229-akrGGCUGCACUUAUUUUGGGACGGAGPMRD
osa-miRf10230-akrGCGGGUCGUACGAAUCCGUCGUPMRD
osa-miRf10231-akrGAGAAACCAUCUUUCGUCGGUCGPMRD
osa-miRf10232-akrGAGAAACCAUCUUUGGUCGGUCGPMRD
osa-miRf10235-akrGUAGUGCUACGAUGUGUCACAUCPMRD
osa-miRf10236-akrGGCGUCAGCUAGGUUUGGGGPMRD
osa-miRf10237-akrUGCGGUCGCUUAAGUGGACCGCAPMRD
osa-miRf10238-akrAAGGUCCCUCAACUUGGCAUCGAGPMRD
osa-miRf10239-akrGUACGCUGAAGGUCCCUCAACUUGPMRD
osa-miRf10240-akrCUCAAAAGAUUCGUCUCGCGGUUUPMRD
osa-miRf10241-akrCCGGUUGGAGUUACCAACCGGGAPMRD
osa-miRf10242-akrGACCGUGCCAUUGAUGCCGGUPMRD
osa-miRf10243-akrGGUUCGUGGCUAACCCACUUACACCPMRD
osa-miRf10245-akrUCCUUGAGGUACCAUGAGGUAPMRD
osa-miRf10246-akrUAAGACUUUCUAGCAUUGUCCPMRD
osa-miRf10247-akrCGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10248-akrUCCGGUUGGUGUUAUCAACCPMRD
osa-miRf10249-akrCUUGCAUGCAUGCAGGCUAUPMRD
osa-miRf10250-akrCUGUCGAACUGGGGCAGUUCGACAGGPMRD
osa-miRf10251-akrGGAUUUUGGAGGGAUGUGACPMRD
osa-miRf10252-akrCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10253-akrAGUCCCGGUUAGUAACACCAACCGGGAPMRD
osa-miRf10254-akrCUCGUUAUCCUAACGAGCUUPMRD
osa-miRf10255-akrGGUGUUCUACACCUGGAGGUUCPMRD
osa-miRf10256-akrUAGCCCGCAGCUCUCCUCUCPMRD
osa-miRf10257-akrGGUAUCGGGUACCUGGUACCUPMRD
osa-miRf10259-akrGGAUAUACGGACACACAUUUPMRD
osa-miRf10260-akrCUUGAGGAGGUAACAUGAGGUACPMRD
osa-miRf10261-akrUUACCUCUGUCGUCACCUCCPMRD
osa-miRf10262-akrUGCAAUCGCCACAUCACGUCPMRD
osa-miRf10263-akrGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10264-akrCCUCACCUUUGACGGGUUCCPMRD
osa-miRf10265-akrCCGGUUAGUGUUACCAACCGGGAPMRD
osa-miRf10266-akrCCCGGUUGGUGUUAACAACCGPMRD
osa-miRf10267-akrGGCUGCUCUACAAGCUGCCUPMRD
osa-miRf10268-akrCUUGCAUGGAGUGCCAAACAPMRD
osa-miRf10269-akrCGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10270-akrGGGUCUAGAACCGGCACCUUPMRD
osa-miRf10271-akrUGACCUCAAAACCGGCACCUPMRD
osa-miRf10272-akrUCGACGAUGACGACGUCGUCGUCGPMRD
osa-miRf10273-akrUCGACGAUGACGACGUCGUCPMRD
osa-miRf10274-akrUUAUGGCCCGUCACAGAUGAGPMRD
osa-miRf10275-akrCCGGUGUUCUAGGACAGGAACUUPMRD
osa-miRf10277-akrCUGACGGUGGACACGAUGGUGPMRD
osa-miRf10278-akrAGGUAUCAUCCCGUCUGAACGPMRD
osa-miRf10279-akrGAUCUUUAGUCCCGGUUGUUPMRD
osa-miRf10280-akrGGUUAAGCGUGCUUGGCCUGPMRD
osa-miRf10281-akrGCACGCGUGGUUAGAUGACCPMRD
osa-miRf10282-akrCCCUGUCACAUCGAAUGUUUGGPMRD
osa-miRf10283-akrAAAGUGCACCGAAGGUCCCUCAAPMRD
osa-miRf10284-akrAAGGUCCCUUAACUUGUCAUCGAGPMRD
osa-miRf10285-akrCCGGUUGGUAACACUAACCGGGAPMRD
osa-miRf10286-akrCGUGUCCAGGUUCAUAGCCAGGAUUPMRD
osa-miRf10287-akrACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10288-akrCCGACAUAUGGAGCCCACAUGUCPMRD
osa-miRf10289-akrGCCCACAUGUCAUCCCCUCUCUPMRD
osa-miRf10290-akrUGCUGAUGCUGCUGCACAGCGPMRD
osa-miRf10291-akrCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10292-akrGCCUGCUAUUGUACCUGCUCPMRD
osa-miRf10293-akrGGUGUUUGGGAACAGGGACUAAAPMRD
osa-miRf10294-akrUUACCAACCGGGACUAAAGAPMRD
osa-miRf10295-akrGGUUGGUAACAUCAACCGGGAPMRD
osa-miRf10296-akrUCCCGGUUGGUAGUAACAACCGGGAPMRD
osa-miRf10297-akrCAAUGUCGUUGGCGCCGAGGAPMRD
osa-miRf10298-akrGAUGAUACCUAGAGGUAUCGCPMRD
osa-miRf10300-akrUGGUCCAUCAACAUCUCCUPMRD
osa-miRf10301-akrAUGCUGCAUCAGCAAACGCUPMRD
osa-miRf10302-akrGAAUACUCCCUCCGUCCCAAAAPMRD
osa-miRf10303-akrCGAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10304-akrGUCGCGAACUUGACGUCGUGCGPMRD
osa-miRf10305-akrUGGUACCUCCUCAAGGACAGUPMRD
osa-miRf10306-akrCUGUCCUUGAGGAGGUACCAUPMRD
osa-miRf10307-akrUGUCCAGCUUACAGUCUUCCUPMRD
osa-miRf10308-akrAGCGCCAAUAGCAUUGGCGCUGAGPMRD
osa-miRf10309-akrCUUGAGGAGGUACCAUGAGGUAPMRD
osa-miRf10310-akrUCUCGCAAAAUAGCCUCGAGGPMRD
osa-miRf10311-akrAAGCUCCUCUAAACAGGCCCPMRD
osa-miRf10312-akrUCAUGGUACCUCCUCAAGGACCPMRD
osa-miRf10313-akrCUUGAGAAGGUACCAUGAGAPMRD
osa-miRf10315-akrCGAGUAGUCCUUCGUAUUCUGCPMRD
osa-miRf10317-akrAAAUAAACGGGUGGACGUCCACUCGAPMRD
osa-miRf10318-akrAGCUCGAGUGGACGUCCACCPMRD
osa-miRf10319-akrGGUCGACGGCGUCGACGAUCCCPMRD
osa-miRf10320-akrGGCUUGUCCGCCUGCGAAAAUAPMRD
osa-miRf10321-akrUUAUACUCCCUCCGUCCCAAAAUAUPMRD
osa-miRf10322-akrGUAGUUAUACUCCCUCCGUCCCAAAPMRD
osa-miRf10323-akrCUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10324-akrCACGGCUGGCCUAUUAUGCCACCGUPMRD
osa-miRf10325-akrAAAACCGGGUAUAACACCUCCCCPMRD
osa-miRf10326-akrAAACCGGGAAUAACACCUCCCCPMRD
osa-miRf10327-akrGGGUAUAACACCUCCCCUAUCPMRD
osa-miRf10328-akrUUAGCCCCGGUUGGUGCUACCPMRD
osa-miRf10329-akrAGCUCCAACUCUAGCUCCACPMRD
osa-miRf10330-akrGAAUAAGUUCACCGGAGGUCCCUPMRD
osa-miRf10331-akrCUGCUGGUCAGACCGGCCUUAUPMRD
osa-miRf10332-akrUUGUCGCGUCCCAAAACGACUCUAPMRD
osa-miRf10333-akrUUGUCGCGUCCCAAAACGACPMRD
osa-miRf10334-akrCCAACGUUUGACUGUCCGUCUUAPMRD
osa-miRf10335-akrGAAGACUUGAUCAAGUCCCCCUAPMRD
osa-miRf10336-akrUUCUAGCAUUUCCCACAUUCPMRD
osa-miRf10337-akrUAGGUAUCAGGCCUGGUACCUPMRD
osa-miRf10338-akrCCUGCAGUAGGUGUCACUGAPMRD
osa-miRf10339-akrCCCUCUAAUUUGGGACGGAGGGAPMRD
osa-miRf10340-akrUCAAUCCUGCGAUUCAAAGGGGPMRD
osa-miRf10341-akrCCUGCGAUUCAAAGGGGGCCUUAGPMRD
osa-miRf10342-akrUUGGUGUUACCAACCAGGACUAPMRD
osa-miRf10343-akrCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10344-akrCAUCUAGGACGAGGAUGUGGPMRD
osa-miRf10345-akrAGGAUGAGGACGUGGCAUCCUPMRD
osa-miRf10346-akrAGUCCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10347-akrUCCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10348-akrAGCGCCAAAUGGAUUGGCGCUGPMRD
osa-miRf10349-akrCAUCCGACUGGUUUCCAGUCGGGGGCUCPMRD
osa-miRf10350-akrUGCUCACCACGGCUUGCUUCPMRD
osa-miRf10351-akrGCCCAUCACAGGUAUCCCCUCAPMRD
osa-miRf10352-akrUGAGGGGAUACCUGUGAUGGGCCPMRD
osa-miRf10353-akrAGUCCCAGUUGGUAACACCAACCGGGAPMRD
osa-miRf10354-akrCACCAACCGGGACUAAAGAUCPMRD
osa-miRf10356-akrCGGUCCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10357-akrGUUCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10358-akrUUCUUGAGGAGGUACCAUGAPMRD
osa-miRf10360-akrGGCUUAAGACGGCCACCAGCPMRD
osa-miRf10361-akrACAUCGUCGGCGUCAUCGUCGGCACPMRD
osa-miRf10362-akrGCUGGAGGAUGCGACGGUGCUPMRD
osa-miRf10363-akrUGGCACGGUGCCAGUUUCCCUPMRD
osa-miRf10364-akrUUGUUAGGGUUCCGUCCAUUPMRD
osa-miRf10365-akrAGCGCCAAUUUAUUUGGCGCUGAPMRD
osa-miRf10367-akrUUUCGGUCCCUCAAGUUGUCPMRD
osa-miRf10368-akrUUAGUCCCGGUUGGUAACACCAACPMRD
osa-miRf10369-akrCGGUUGGUGUUACCAACCGGGPMRD
osa-miRf10370-akrGAUUGGUAACACCAACCGGGACUAAAPMRD
osa-miRf10372-akrUCCCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10373-akrGCGUGUCGCAUCGGAUAUACGGAPMRD
osa-miRf10374-akrUCUCCUUAUCGGCACCACUUPMRD
osa-miRf10376-akrAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10377-akrUGCUAGAAGCUCCCCCAAACAGUCPMRD
osa-miRf10378-akrGAGGUGUCUAAGUUCAGCGCPMRD
osa-miRf10379-akrAGAGCAGGUACAAUAGCAGGCUAUPMRD
osa-miRf10380-akrGGUCUGACCGGUGUCCGGUCUGACCGPMRD
osa-miRf10381-akrCCUCCGUCCCAAAAUAAGUGCAGPMRD
osa-miRf10382-akrGGUUGGUAAGAUCAACCGGGAPMRD
osa-miRf10383-akrUCCCUGUUGGUACUACCAACCGGPMRD
osa-miRf10384-akrCUGACCACAGUGUAGUGGCCAGPMRD
osa-miRf10385-akrAUGGUUUCGGCAGGUCCGGCCGAAAGGPMRD
osa-miRf10386-akrCCGGUGUUGUAGGACAGGAACUUPMRD
osa-miRf10387-akrUUCGCCGCGCGAGUCAUGAAPMRD
osa-miRf10388-akrGGGUGUAAGUGGCUAACCCGCGAAACCPMRD
osa-miRf10389-akrUACCGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf10391-akrCUAUUUUUGCAUGCGGGUGGCPMRD
osa-miRf10393-akrGGAAGUUCCGGUACAAGAACACCGGPMRD
osa-miRf10394-akrUCCAGGUUCGUAGCUAGAAGUUGPMRD
osa-miRf10395-akrUAAUGCCCGAUUGAGAUGACPMRD
osa-miRf10396-akrCGCGCUUUGAGUGAGCGAGAPMRD
osa-miRf10399-akrCAGCUGCUAGAAGCUCCCCCAAACAPMRD
osa-miRf10400-akrUAGUACUAGGAUGUGUCCCAUCPMRD
osa-miRf10401-akrUUACUCCCUCCGUCCCAAUAPMRD
osa-miRf10402-akrCUGCACCAUCCGCUUGUGGCUGUGPMRD
osa-miRf10403-akrUAGUCCCGGUUGGUAACACCPMRD
osa-miRf10404-akrCCCUAUCUUUAGUCCCGGUUGGPMRD
osa-miRf10405-akrUACCAACCGGGACUAAAGAUCUPMRD
osa-miRf10406-akrUAUGGGACGGAGGGAGUACAAPMRD
osa-miRf10407-akrCCGGUUGGUGUUACCAACCGGGACAAPMRD
osa-miRf10408-akrUUCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10409-akrUCCCGGUUGGUAACACCAAUCGGPMRD
osa-miRf10410-akrCCGAUUGGUGUUACCAACCGGGAPMRD
osa-miRf10411-akrAAUCCCGGUUGGUAACACCAAPMRD
osa-miRf10412-akrUGGGAUGGGUUGGUUCCAUCCPMRD
osa-miRf10413-akrGUGGUCCGUCUGCGAAAAUCPMRD
osa-miRf10414-akrAAGUACCGGUACCUCGAGAUAPMRD
osa-miRf10415-akrUCCCGGUUGGAAAACCGGGACUAPMRD
osa-miRf10416-akrCCUCCGUCCCAAUAUGUAGCAACPMRD
osa-miRf10417-akrAUCUUUAGUCCCGGUUGGUAUPMRD
osa-miRf10418-akrGGAUCUUUAGUCCCGGUUGAUAPMRD
osa-miRf10419-akrAUCCACUCGUCACAGGUGUCAAPMRD
osa-miRf10420-akrGUGGGGAUGUGACACCACCUPMRD
osa-miRf10421-akrUGUAUACUCCCUCCGUCCAAPMRD
osa-miRf10422-akrUAUAUGUAUACUCCCUCCGUPMRD
osa-miRf10423-akrGCCAGCCAGAUGGCUUGGCCAUPMRD
osa-miRf10424-akrUUUGGCCAGCCAGAUGGCUUGGPMRD
osa-miRf10425-akrGCUCCUUAAGUGGUCCACAUGPMRD
osa-miRf10426-akrGUUGGUAACACCAACCGGGACUPMRD
osa-miRf10427-akrGCAUGCGGUUGUGUUGCCCGCPMRD
osa-miRf10428-akrGGUUGGUAACAUCAAUCGGGAPMRD
osa-miRf10429-akrUACUUCCUCCGUUUCAUAGUGUAAGPMRD
osa-miRf10430-akrUGGUGACGUCACCGCUGACGUCAUCGUPMRD
osa-miRf10431-akrAGAUUCGUUGUACUAGGAUGUGUCPMRD
osa-miRf10433-akrCCGGUUGAUAACACCAACCGGPMRD
osa-miRf10434-akrCCCGGUUGGUAACACCAACCGPMRD
osa-miRf10435-akrUCCCGGUUGGUAACACUAACCGGPMRD
osa-miRf10436-akrCGGUUGGUAACACCAACCAGGAPMRD
osa-miRf10437-akrGCUCAAAAGAUUCGUCUCGCGGUUUPMRD
osa-miRf10438-akrUCCCGGUUGUUUAUACCAACCAPMRD
osa-miRf10439-akrCCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf10441-akrGAGCUGGAGCUGUGCCAAACGPMRD
osa-miRf10442-akrAUGAGCCGAGCUCGAGUAGCPMRD
osa-miRf10443-akrAGUCUACUCCCUCCGUCCCAAAPMRD
osa-miRf10445-akrUUGAGUCACUGACAUGUGGGACCCACPMRD
osa-miRf10446-akrGUAGCUAGCUAGCAAGCUCAUGGPMRD
osa-miRf10447-akrGCGUAGCUAGCUAGCAAGCUCPMRD
osa-miRf10448-akrUGGCGCUGAACUUAGAUACCUCAPMRD
osa-miRf10449-akrAGCUGCUCGAGCUUGGCUCGPMRD
osa-miRf10450-akrGUGUGUGUAUGACAGGUUGAPMRD
osa-miRf10451-akrUACUGCAUGUGCACUACUGCAPMRD
osa-miRf10452-akrCUGUCGAACUGCCCCUGUUCGACAGGPMRD
osa-miRf10453-akrCCUGGCCUCCAUGUAGCCGGUPMRD
osa-miRf10454-akrUGAUACCUCAGAGGUAUCGUCPMRD
osa-miRf10455-akrUGUUUGGUUGGAGGGACUAAPMRD
osa-miRf10456-akrUGAGGGGAUGUGACUCCUCCUPMRD
osa-miRf10457-akrUGUCCCAUCCUUGUCUAGGUUUUPMRD
osa-miRf10458-akrUCGUCGUCAUCGCCAUUGCCGCUGPMRD
osa-miRf10459-akrUCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10461-akrUUGAGCCGUGCCAAUAUCACPMRD
osa-miRf10462-akrGAUGAUGACGUUGUCGGUGAUGPMRD
osa-miRf10463-akrAGGAUGUGUCACAUCUAGUCPMRD
osa-miRf10464-akrGCCACGUCAGGGUCCAUGGCPMRD
osa-miRf10465-akrGAUGUCGAGGUUGAGCUCUGCCUCPMRD
osa-miRf10466-akrGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10467-akrAACACCAACCGGGAGUAAAGUUPMRD
osa-miRf10468-akrAGUCCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf10469-akrUCCCAUGUCAUCGUCCACGUCGUPMRD
osa-miRf10471-akrUGAGUAGCAAGGAACAGGUCPMRD
osa-miRf10472-akrUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10473-akrGUAGUACUAGGAUGUGUCCCAUCCPMRD
osa-miRf10474-akrCGGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf10475-akrCAGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf10476-akrGACGAAUCUCAGACAUCCAUPMRD
osa-miRf10477-akrGCAGCUUCAUCUUCUCAUGGCAGPMRD
osa-miRf10478-akrGCCAUGAGAAGAUGAAGCUGCPMRD
osa-miRf10479-akrAGUGUCACAUCCCGUACUGAGPMRD
osa-miRf10480-akrCCGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10481-akrUCGAUGGUGGCGUCGUAGUCCUUGPMRD
osa-miRf10482-akrUCCCGGUUGGUAACUCCAACCGGGACPMRD
osa-miRf10483-akrACGUGGGUCCCACUGGUCAGCGPMRD
osa-miRf10485-akrCCGGCCUGUACUUAUUGGGCPMRD
osa-miRf10487-akrUUUAGUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10488-akrCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10490-akrGGAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf10491-akrGAGAGCGAGACGGUGCCGCAPMRD
osa-miRf10492-akrGUGAUACUUGCGAGGUAUCAUPMRD
osa-miRf10493-akrGCGUGAUACUUGCGAGGUAUCAGGUPMRD
osa-miRf10494-akrAGUACUAGCUAGUACUACCAPMRD
osa-miRf10495-akrAGCUCUAGCUCCAGCUUCACPMRD
osa-miRf10496-akrCGAUGAGCGCGAACAUGGUGGAPMRD
osa-miRf10497-akrCUCCGUCCCUAAAUAUAAGGGAUUPMRD
osa-miRf10498-akrCACGGUUACCACGGUUACCGCGPMRD
osa-miRf10500-akrAUCCUUUGAAUCAAAGGGCCPMRD
osa-miRf10502-akrGCUCGUUAUCCUAACGAGCUAGAPMRD
osa-miRf10503-akrAACUCGUCGGCGAUGAUGUGAUCPMRD
osa-miRf10504-akrGAUACCUCGUUGGUGUCAUGPMRD
osa-miRf10505-akrUUUGGCCAGCCGGAUGGCUUGGCPMRD
osa-miRf10506-akrGAACUGCCCCUGUUCGACAGGGPMRD
osa-miRf10507-akrUUGGUGUUCCCAACCGGGACPMRD
osa-miRf10508-akrACGAUGACGUAGCUGCCGUUPMRD
osa-miRf10509-akrCCGGUUGGUGUUACUAACCGGGACUAPMRD
osa-miRf10510-akrCAUGCGGUUGCCCCAACCGCAUGPMRD
osa-miRf10511-akrAUUAGGGCACCCACAAUGGUUAUCUGUAPMRD
osa-miRf10512-akrGAUAACCAUUGCAGGUGCCCUUAPMRD
osa-miRf10513-akrAUUAGGGCACCCACAAUGGUUAUPMRD
osa-miRf10514-akrCCAACGUUUGACUGUCCGUCUUAUPMRD
osa-miRf10515-akrCUGCUAGAAGCUCCCCAAAACAGPMRD
osa-miRf10516-akrGGACUGUUUGGGGGAGCUUCUGGCAPMRD
osa-miRf10517-akrCUCAAUGCCAACGUUAUUGGCGCPMRD
osa-miRf10518-akrCGCGAGACGAAUCUUUUGAGPMRD
osa-miRf10519-akrCUGCUAUUGCAGCAGCAGUAPMRD
osa-miRf10520-akrGUGCGCACAAUUUUGUCGGCGPMRD
osa-miRf10521-akrGUCAUCGAUGACAGGCUCAAPMRD
osa-miRf10522-akrUCUUUAGUCCCGGUUGGUGAPMRD
osa-miRf10523-akrGGUUGGUGAUACCAACCGGGAPMRD
osa-miRf10524-akrUUGACCCGUCUCAGGUGACUPMRD
osa-miRf10525-akrUCACAGGUGGGUCACCUGUGPMRD
osa-miRf10526-akrAACCGGGACUAAAGAUCAUCPMRD
osa-miRf10528-akrCCAGUCAGGGGCUCGUUGCUGGPMRD
osa-miRf10529-akrAGGCGAUGACCCAUGUAUACAPMRD
osa-miRf10530-akrGAAUCGACGAUGACCCAUGUAUACPMRD
osa-miRf10531-akrGAAUCGACGAUGACCCAUGUPMRD
osa-miRf10532-akrGACUGGUUCGAGAACCAGCGAGPMRD
osa-miRf10533-akrACCGGCCGUGCAAUGCCGGUPMRD
osa-miRf10534-akrUCUUUAGUCCCGGUUGGUGCPMRD
osa-miRf10535-akrAGCCGGUCUGACCGGUCGCCGGUCUGAPMRD
osa-miRf10536-akrGGUCUGACCGGUCGCCGGUCUGACCAPMRD
osa-miRf10537-akrUUCCGACUGGUUUCCAGUCGGUGGCUPMRD
osa-miRf10539-akrGAGACCUCUUCCUAGGCCUUPMRD
osa-miRf10541-akrUCAGCGCCAAAUACAUUGGCGCUGAPMRD
osa-miRf10543-akrUCCCGGUUGGUAACAACAACCGGAAPMRD
osa-miRf10544-akrGGCACCGUGGUAUAAACCGGGAAPMRD
osa-miRf10545-akrGGUUGGUGAUACCAACCGGGAGUPMRD
osa-miRf10546-akrUUUCAACCGGGGCUAAAGAUCPMRD
osa-miRf10547-akrAAGGCAACCUAGGAGGGGAUGUGAPMRD
osa-miRf10549-akrGUCAUCUCAAUCGGGCCUAAAPMRD
osa-miRf10551-akrCGCCUGCGAAAAUCGAUCUUCGCAPMRD
osa-miRf10552-akrUUUAGUCCCGGUUGGUGAGAPMRD
osa-miRf10553-akrAAAGAUGGUUUCUCCACCAGUGUPMRD
osa-miRf10554-akrAUGGUUUCUCCACCAGUGUACPMRD
osa-miRf10555-akrUCCGGUUGGUAUCACCAACCPMRD
osa-miRf10556-akrCGGCUCGUUAUCUAAACGAGCPMRD
osa-miRf10557-akrACUCAUCUGUGACGGGCAUUPMRD
osa-miRf10558-akrGAGCCUCAUAGUUGCCGGCUPMRD
osa-miRf10559-akrCGGUCAGACCAGCCUGAUGGCPMRD
osa-miRf10560-akrACUUUAGUCCCGGUUGGUGUUAUPMRD
osa-miRf10562-akrAGCGCGGCAAGCUCUAGCUUPMRD
osa-miRf10563-akrCGAAGCCACGAAGGUUGAGCUPMRD
osa-miRf10564-akrUGCCGACUGGUUUCCAGUCGGGGGCUGPMRD
osa-miRf10565-akrGUUCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10566-akrGAUGAGUCAUCAGUGACGGGCUPMRD
osa-miRf10568-akrACUUACUCCCUCCGUCCCAAAAUAAAUPMRD
osa-miRf10569-akrGAACUUACUCCCUCCGUCCCAAAAUPMRD
osa-miRf10570-akrAAGCGUGUUUACGGAAAACGAGPMRD
osa-miRf10571-akrAUAUUUACUCCCUCCGUCCCAUAAPMRD
osa-miRf10572-akrUUACUCCCUCCGUCCCAUAAPMRD
osa-miRf10573-akrCCAAGGUCCCUCAACUUGUCAUCAPMRD
osa-miRf10574-akrAAGGUCCCUCAUCUUGUCAUCPMRD
osa-miRf10575-akrGUUGAGGGACCUUGGUGUACUUPMRD
osa-miRf10576-akrCUUGUCCUGCGGGAGCUGCUGGUUPMRD
osa-miRf10577-akrCAUCUCUACUUCGCAGCCGCPMRD
osa-miRf10578-akrCAUCUCUACUCUGCAGCCGCPMRD
osa-miRf10580-akrUCCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10581-akrAGAUCAUCUUUAGUCCCGGUUCGAPMRD
osa-miRf10583-akrAUCUUUAGUCUCGGUUGGUGUUACCPMRD
osa-miRf10584-akrCCGGUUGGUAACACCAACCGAGAPMRD
osa-miRf10585-akrUUAGUCUCGGUUGGUGUUACCPMRD
osa-miRf10586-akrGUCCCAUCCGAUCCUAGGUUGPMRD
osa-miRf10587-akrCAGCAUAGCUGGCGCCUCCUCCUPMRD
osa-miRf10589-akrAACGAGGGGAUAUCCCAUCGAGPMRD
osa-miRf10590-akrCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf10591-akrUGAUACGUGAUAGGAAUCGCCUPMRD
osa-miRf10592-akrGGGUGAUACUUGCGAGGUAUCAUPMRD
osa-miRf10593-akrUCCUUGAGGAGAUACUAUGAGGUAUPMRD
osa-miRf10595-akrAUCCUGGCGACGUUGCUGAAPMRD
osa-miRf10596-akrCUGGCGGACCAGUUAAGAGGUPMRD
osa-miRf10597-akrAUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10598-akrUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10599-akrUUACCAACCGGGACUAAAGAUCPMRD
osa-miRf10600-akrAGAUCGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10602-akrGGAUGCCACGUCCACAUCCUAGPMRD
osa-miRf10603-akrGGUACUCUCUCCGUCCCAAAAPMRD
osa-miRf10604-akrUGGCCUUCUACAUCUUCGUCPMRD
osa-miRf10605-akrGCGAGCUGCUUGAGCUCGGCUPMRD
osa-miRf10606-akrGGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10607-akrUUAGACACCUCAGCGCCAAAPMRD
osa-miRf10608-akrGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10609-akrAGUCCCGGUUGAUAACACCAACPMRD
osa-miRf10611-akrUACCGGUUGGUAACACCAACCGGPMRD
osa-miRf10612-akrUCCCGGUUGGUGUUACCAACCGGPMRD
osa-miRf10614-akrAUGAUGCAUGCAUCCUCUCUUPMRD
osa-miRf10615-akrAAGAGAGGAUGCAUGCAUCAPMRD
osa-miRf10616-akrCAUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10617-akrUUGCAUCAAAGUGAACAGGCCCCPMRD
osa-miRf10618-akrGCAUCAAAGUGAACAGGACCPMRD
osa-miRf10619-akrGCCGUUCCGCUGUUGCAUGCPMRD
osa-miRf10620-akrCGAUGCCGUAGUCCAUGAGCPMRD
osa-miRf10621-akrUUGCACUUUGGACCACCCCAPMRD
osa-miRf10622-akrGUAUCAUCCCGUCCGAACGGPMRD
osa-miRf10623-akrCGUGGCGCUGAGGUGUCUAAGUPMRD
osa-miRf10625-akrUAGACACCUCAGCGCCACGUPMRD
osa-miRf10626-akrGGUUGGUAAUACCAACCGGAAPMRD
osa-miRf10627-akrACUUUAGUCCCGGUUGGUGGPMRD
osa-miRf10628-akrUGGCGCUGAACUUAGACAUCUCAPMRD
osa-miRf10629-akrUGUCAGUGAGCUGUACUGCAPMRD
osa-miRf10630-akrGUAGCCAAGGACAGACUUGCCGPMRD
osa-miRf10632-akrCCGGCGAACUCCUCUUCUUCUPMRD
osa-miRf10633-akrAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10636-akrUCGAACUGCCUCCGUUCGACAGGPMRD
osa-miRf10637-akrGACAUCGUCUUCCCCGUCAGPMRD
osa-miRf10638-akrUCCCGGUUGUUUAUACCAACCGGGAPMRD
osa-miRf10640-akrCCGGACCCACAUGUCAGCCUCACPMRD
osa-miRf10641-akrUGAGGCUGACAUGUGGGUCCGPMRD
osa-miRf10642-akrCCGGGCCCACAUGUCAGUCUCACPMRD
osa-miRf10643-akrACGGCUGGCCUAUUAUGCCACCGUUPMRD
osa-miRf10644-akrGAGCUCCACCCAACUCCACUPMRD
osa-miRf10645-akrAUGGCGCCCAUCACGGAUGAPMRD
osa-miRf10646-akrCUGGUUGGUGUUACCAACCGPMRD
osa-miRf10648-akrGGUUUUGGUCUACGUGGUGUACACGPMRD
osa-miRf10649-akrGUGAGACCCUUCUACCAGACPMRD
osa-miRf10650-akrGUGGUAUGUCAUGAAACCCUPMRD
osa-miRf10651-akrAAGUUGGUGCCCGUCACAGAUGAPMRD
osa-miRf10652-akrCGUCACGGAUGAGUCAUCUGUPMRD
osa-miRf10653-akrCUGGACCCACAUGUCAGCCUCAPMRD
osa-miRf10654-akrUGAGUGAGGCUGACAUGUGGGUCCPMRD
osa-miRf10655-akrCCCACGUGUCAGCCUCACUUUCPMRD
osa-miRf10656-akrGUCAUCUCAAUCGGGCCUAAPMRD
osa-miRf10658-akrCUUUAGUCCCGGUUGGUAACACCAAPMRD
osa-miRf10660-akrUGGGUUUCCGUGUCCAACGUUUGACPMRD
osa-miRf10661-akrCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10662-akrCGAUGGAGUGGCACUGUUCCPMRD
osa-miRf10663-akrUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf10664-akrACCGCCGGUUCAUCUGCGGUUUGACPMRD
osa-miRf10666-akrCAACCGGGACUAAAGAUCGAPMRD
osa-miRf10667-akrAGUUGGGGCCCGUCACAGAUGACPMRD
osa-miRf10668-akrAGGACAGCGCCAAUAUCGUUGPMRD
osa-miRf10669-akrCCUGUCCCAAGACCGAGUCUPMRD
osa-miRf10671-akrUCCCGGUUGUUUAUACCAACCGGPMRD
osa-miRf10672-akrAACUCGUGGUGAUGUGGACUAAUPMRD
osa-miRf10673-akrCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf10674-akrUUUCGGCAGGUCCGGCCGAAGPMRD
osa-miRf10675-akrUUGGGGCCAGUUUUGGUUCGGCCPMRD
osa-miRf10676-akrCCAUGUCCUCGUCCUAGUUGPMRD
osa-miRf10677-akrCUAGGUGCAGAGGCAGAUGCPMRD
osa-miRf10678-akrACCACUUUGAUGAGGAGUUGGPMRD
osa-miRf10679-akrAGGGUGUCGAGAAGGGUGAUCGPMRD
osa-miRf10680-akrUAUCAGCUAGCUAGCUGGCUUAUPMRD
osa-miRf10681-akrCCUGUCGAACAGGGGCAGUUCGACPMRD
osa-miRf10682-akrUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf10683-akrUGCCGACUGGUCUCCAGUUGGPMRD
osa-miRf10684-akrUUUGGUACUGUGAGGUACCAGUPMRD
osa-miRf10685-akrAGCAGCGACUCUGGUCAUGGAAPMRD
osa-miRf10686-akrUGACCAGGUCACUGCUUGCCPMRD
osa-miRf10687-akrGGUCACUGCUUGCCUUUGCAGPMRD
osa-miRf10688-akrGGAUGCCAUGUCCUCAUCCUAPMRD
osa-miRf10689-akrUGCCAUUUCCUCGUCCUAGGPMRD
osa-miRf10690-akrUCUCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10691-akrAACUUUAGUCCCGGUUGGUAAPMRD
osa-miRf10692-akrUUCUUGCAUUGCCCACAUUCPMRD
osa-miRf10693-akrCCCGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10694-akrCUUUGCAUGCAGUUGCGCCAPMRD
osa-miRf10695-akrAGUCCCGGUUGGUAACACGAACCGPMRD
osa-miRf10696-akrGCCAACGUUUGACCGUCCGUCPMRD
osa-miRf10698-akrGGAUGCCAUGUCCUCAUCCUAGPMRD
osa-miRf10699-akrGGAUGAGGAUGUGGCAUCCUPMRD
osa-miRf10700-akrCCGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10701-akrGCCCGUCACAGAUGAGUCAUCCGUPMRD
osa-miRf10702-akrUGUAGGGACCCAAAGUGAACUUAPMRD
osa-miRf10703-akrUUACCAACCGGGACUAAAGUUPMRD
osa-miRf10705-akrCACGGCUGGCCUAUUAUGCCACCGUUPMRD
osa-miRf10707-akrGGAUCUUUAGUCCCGGUUGGUGPMRD
osa-miRf10708-akrUUGAUGCCCGUCACAGAUGACUCPMRD
osa-miRf10709-akrAUGGUGCGCUGCAGUGGAUUPMRD
osa-miRf10710-akrUUACUCCCUCCGUCCUAGAAUAUPMRD
osa-miRf10711-akrUUAUCCGGGCCCACAUGUCAGCCPMRD
osa-miRf10713-akrCAGGGAGGGGAGAGUCGUGUUUPMRD
osa-miRf10714-akrAGCUCGAGCAGCUCACGAGCPMRD
osa-miRf10715-akrCGAGCUCGAAUAGUUCGUCGAGPMRD
osa-miRf10717-akrUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10718-akrCUUAGACACCUUAGCGCCACPMRD
osa-miRf10719-akrGGCAUGAGGAUGUCAAAAGGPMRD
osa-miRf10720-akrCGGUUGGUGUUACCAAUCGGGAPMRD
osa-miRf10721-akrUCCCGAUUGGUAACACCAACCGPMRD
osa-miRf10723-akrACCCACAUGUCAGUGGCUCAAPMRD
osa-miRf10724-akrCCCCACAUGUCAGUGGCUCAPMRD
osa-miRf10726-akrCCCAGUUGGAAACACCAAUCGGPMRD
osa-miRf10727-akrUAGUCCUGGUUGGUGUAACCAACUPMRD
osa-miRf10728-akrGGGUGAUACUUGCGAGGUAUCAGPMRD
osa-miRf10729-akrAGUCCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf10730-akrGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf10734-akrUAGGUGUUCGACGAAAUGCCUPMRD
osa-miRf10735-akrUAGUACUCCCUCCGUCCCUAAAUAUAAPMRD
osa-miRf10736-akrGUGCCGAGAGGCUGGAGUAUGACPMRD
osa-miRf10737-akrGAGGGACCUUCGGUGCACUUUUUCCPMRD
osa-miRf10738-akrGAAAAAGUGCACCGAAGGUCCPMRD
osa-miRf10739-akrUGAGGUGCCUGAGCUCAGCGPMRD
osa-miRf10741-akrGAGGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10742-akrAAUGACUACUCCCUCCGUCCCAAAPMRD
osa-miRf10743-akrUGCAUACUCCCUCCGUCCCAAAPMRD
osa-miRf10745-akrCCUACAUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf10747-akrCUUGAGGAGGUACAAUGAGGUACPMRD
osa-miRf10748-akrGUACUAGGAUACAUCACAUCPMRD
osa-miRf10749-akrCUGCCGACUGGUUUCCAGUCGGCGGUUPMRD
osa-miRf10750-akrCUGCUGCCGACUGGUUUCCAGUCGGPMRD
osa-miRf10751-akrCCCGGUCCCACAUGUCAGCCUCACPMRD
osa-miRf10752-akrGUCCCACAUGUCAGCCUCACPMRD
osa-miRf10753-akrUCAUGGUAACGUGGACGAAUPMRD
osa-miRf10755-akrGGUACCUCCUGAAAGACCGUPMRD
osa-miRf10756-akrCGGUCUUUCAGGAGGUACCAPMRD
osa-miRf10757-akrAUUUCGGGAUGGGUGACCGAPMRD
osa-miRf10758-akrGGAUUUUCGCAUGCGGUUGCCCPMRD
osa-miRf10760-akrAAGCUGCUGUUGUGCGACGCCGAPMRD
osa-miRf10761-akrAAUGUGGGCAAUGCUAGAAAGUCUUAUPMRD
osa-miRf10762-akrAUGUGGGCAAUGCUAGCAAGUPMRD
osa-miRf10763-akrCGUGGACGAAUCUCGGACGUCCPMRD
osa-miRf10764-akrUCCCGGUUGGUAACACCAACCGAPMRD
osa-miRf10765-akrAGAGAUUUGCUCUGGUCCAAPMRD
osa-miRf10766-akrAGGUAUCAGCUGAUACCUGAUAPMRD
osa-miRf10767-akrUAGGUAUCAGGACCUGAUACCUCGPMRD
osa-miRf10768-akrAGUUGAGCUCUGGGUGCCAUCPMRD
osa-miRf10769-akrCGUGCGCACGCUUCCCAAACUACUAPMRD
osa-miRf10770-akrCCGGAGUACGAUGAUGAUGAPMRD
osa-miRf10771-akrAUGAGCCCAUCACGGAUAAUPMRD
osa-miRf10772-akrGCUCGAGCUUCUAACGAGCCPMRD
osa-miRf10773-akrCGGUGAACUCCUCUUCUUCUCCPMRD
osa-miRf10774-akrCCGUCACGGAUGACACUUAUPMRD
osa-miRf10775-akrAAGUGUCAUCCGUGACGGGCPMRD
osa-miRf10776-akrCGUAGGGCCUGUCACAGAUGAPMRD
osa-miRf10777-akrAGCAGGCUACAGAUCUGUAGCCPMRD
osa-miRf10778-akrUUGGAGCUAGUAGUGGGCUAUACUAPMRD
osa-miRf10779-akrUCCAUGUCACAUCGGAUGUUUGPMRD
osa-miRf10780-akrAUGGUGUCCCAUCCCCAUCUPMRD
osa-miRf10781-akrGUUUUCCGGCUUCAAGUCACGPMRD
osa-miRf10782-akrUUCAAUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf10783-akrGUUUAGUCCCUCUCUCCCAAAPMRD
osa-miRf10784-akrGAUUCGUCCACGUCAUCACGAGPMRD
osa-miRf10786-akrCGCCGUUAGGGUUCCGUCCAPMRD
osa-miRf10787-akrUAAGACUUUCUAGCAUUGCCCACAUPMRD
osa-miRf10789-akrGCUCGUUAUCCUAGCGAGCUAPMRD
osa-miRf10790-akrGAUCUUUAGUCCCGGUUGGUAACACPMRD
osa-miRf10791-akrUAUGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10792-akrAGGUGGUGUCCCAUCCCCACCPMRD
osa-miRf10793-akrCUAUCUGAUCAAUCUCUGCCAPMRD
osa-miRf10794-akrGAGGAGACCGGCGCUGAGUGAPMRD
osa-miRf10795-akrGGUUUCGCGGGUUAGCCACUUACAPMRD
osa-miRf10797-akrUCAUGGUACCUCCUUAAGGACCGUAPMRD
osa-miRf10798-akrUGACCUGGCACUGAGGUGGCPMRD
osa-miRf10799-akrGGUUGGUAACACCAACCGAGAPMRD
osa-miRf10800-akrACGUCAGAGGAUCCCUUUCCUPMRD
osa-miRf10801-akrCAUGUGGGUCCGGGUGGCAAAUPMRD
osa-miRf10803-akrAUAGCAUCAAAGUGAACAGGUCCPMRD
osa-miRf10804-akrGCAUCAAAGUGAACAGGUCCUUAAPMRD
osa-miRf10805-akrAUGACUUACAUUGUGAAACGGAGGAAPMRD
osa-miRf10806-akrUUAGGCUUAAAAGAUUCGUCUCGCPMRD
osa-miRf10807-akrAAUAUAUUGGGACGGAGGGAGUAGUAPMRD
osa-miRf10808-akrCUGCUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf10809-akrUACUGCUCCCUCCGUCCCAAPMRD
osa-miRf10810-akrUACUACUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf10811-akrAUAUAUUGGGACGGAGGGAGCAGUAPMRD
osa-miRf10812-akrCGAGCUCGAAUAGCUCGUCGAPMRD
osa-miRf10813-akrUCGCGAGCUGCUUGAGCUCGGCUPMRD
osa-miRf10814-akrCUACUCCUUCCGUCCCAAUAUAPMRD
osa-miRf10815-akrUUUCCGUGUCCAACUUUGACUGUCPMRD
osa-miRf10817-akrUGAGGGGCCUAAAGUGAACUUUUUPMRD
osa-miRf10818-akrAAGUUCACUUUAGGCCCCUCPMRD
osa-miRf10819-akrUCUUCCUCUCGUCGCCGGAGGPMRD
osa-miRf10820-akrAUUGGACCGGAGCAAAUCUCUUGCPMRD
osa-miRf10821-akrCGCCGGGUUGUAGAACGACGCGAPMRD
osa-miRf10822-akrGGUGUGGAAUUAAUCCCCUCCAAPMRD
osa-miRf10823-akrGGGGCUAAACUUUAGUCCCUPMRD
osa-miRf10824-akrAUAGGUAUCAGACCUGAUACCPMRD
osa-miRf10826-akrGCCCGUCACAGAUGAGUCAUCCPMRD
osa-miRf10827-akrUGGAACCCUAACGGCGAUGGCPMRD
osa-miRf10828-akrUUUGCAGGCGGCCUCCUCCUGGPMRD
osa-miRf10829-akrAGAUUUACUCCCUCCGUCCCAUAPMRD
osa-miRf10830-akrUUACUCCCUCCGUCCCAUAGAAAPMRD
osa-miRf10831-akrAGGCUCGGGUUCGGCUCGUUUPMRD
osa-miRf10832-akrAUACCCGGUUUUGUAGUUCGGGGGPMRD
osa-miRf10833-akrCCCCUGAACUACAAAACCGGPMRD
osa-miRf10834-akrUGCCCACCAUGGUGACCGUAGAPMRD
osa-miRf10836-akrGUCCUUGAGGACGUACCAUGPMRD
osa-miRf10838-akrUCCUUGAGGACGUACCAUGAGGUACPMRD
osa-miRf10839-akrCCUGUGACGUUGGUGAAGGUGPMRD
osa-miRf10840-akrCUGUUUGGGAAGCUUCUGGCAPMRD
osa-miRf10842-akrUGUUUGGGACGGAUGGAGUACGUAPMRD
osa-miRf10843-akrGUCAGCGCCAGAACAAUUGGCGCUGPMRD
osa-miRf10844-akrUGGGCGGCAAGCUGACGUGGCAPMRD
osa-miRf10846-akrUCCCGGUUGGUGGUACCAACCGAGAPMRD
osa-miRf10847-akrGUUGGUGAGACCAACCGGGAPMRD
osa-miRf10848-akrCCUGGUUGGCAUGGCCAAAAPMRD
osa-miRf10849-akrUGGACUGUUUGGGGGAGCUUCUPMRD
osa-miRf10850-akrUGCUGGUUCGAGAACCAGCGAGPMRD
osa-miRf10851-akrAGUCCCGGUUGGUAAAACCAACCGGPMRD
osa-miRf10853-akrGUCAUCUCAAUCGGGUCUAAPMRD
osa-miRf10855-akrUUACAUUGUGAAACGGAGGGAGUPMRD
osa-miRf10856-akrUCCCGGUUGGUAUUACUAACCGGGAPMRD
osa-miRf10857-akrGUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10858-akrUCCCGGUUGAUGUUACCAACCGGPMRD
osa-miRf10860-akrCCAAUGAUAUUGGCGUCGUCPMRD
osa-miRf10861-akrUCCCGGUUGAAUAACCGGGACUAPMRD
osa-miRf10862-akrUCCCGGUUUGUAACACCAACCGGPMRD
osa-miRf10863-akrGCGGCUGCGGCUGCAGUUGUGCPMRD
osa-miRf10864-akrAGGAUGGGGACGUGGCAUCCUGPMRD
osa-miRf10865-akrGGUGGAUGUGACACAUCCUAPMRD
osa-miRf10867-akrUGGAUGAAUCUCGGACGUCUPMRD
osa-miRf10868-akrUUGGUGUUACUAACCGGGAUUAAAPMRD
osa-miRf10870-akrUGUCUAAGUUUAGCGCCACAPMRD
osa-miRf10871-akrUGAGGUACCGGUACCUCGAGPMRD
osa-miRf10872-akrUUUGGUACCAUGAGGUACCGGUAPMRD
osa-miRf10873-akrCGGUACCUCACGGUACCAAAUPMRD
osa-miRf10874-akrGAUUUGGUACCAUGAGGUACCPMRD
osa-miRf10875-akrGUCACGUAGGCGCCACCUCAGUPMRD
osa-miRf10876-akrAGUUGGAGCUGUGCCAAACAGPMRD
osa-miRf10877-akrCCCAACCGGGACUAAAGAUCGAUPMRD
osa-miRf10878-akrCGGCCGUCCGUCUGCGAAGAUAGPMRD
osa-miRf10879-akrUCAGCGCCAUGCUAUUUGGCGCUGPMRD
osa-miRf10881-akrCCUAAGAGCCCUCCAGUGAAPMRD
osa-miRf10882-akrGGCCUCCUAAGAGCUCGCCAGCGAPMRD
osa-miRf10883-akrCUGGUUGGUGUUACCAACCGAGAPMRD
osa-miRf10885-akrCCGCCGACUGGUUUUCAGUCGGAGGAUPMRD
osa-miRf10886-akrUGCCGCCGACUGGUUUUCAGUCGGPMRD
osa-miRf10888-akrAAAGCUGCCAGGAAGUUCCGGACPMRD
osa-miRf10889-akrCUUCCGGAGUUCUUCCUAGGPMRD
osa-miRf10890-akrAGCACUUUGCUCUUGACGAGPMRD
osa-miRf10891-akrCCGGUUUGUGUUACCAACCGGGAPMRD
osa-miRf10892-akrGUUCGAUAGGACCUGUCGAACPMRD
osa-miRf10894-akrAUCUUUAGUCCCGGUUGUUGPMRD
osa-miRf10895-akrUGUCGAAUUGCGUCAGUUCGACAGPMRD
osa-miRf10896-akrUAUCUUUAGUCCCGGUUGUUPMRD
osa-miRf10897-akrGCCGUUCGACAGGACCUGUCGAACPMRD
osa-miRf10898-akrGGGAAAUUGGAACCAUGCCACUUCPMRD
osa-miRf10899-akrACAAGUUGAAGGACCUUGGGPMRD
osa-miRf10900-akrGGACCUUGGGUGUACUUUUUCCUUCPMRD
osa-miRf10901-akrAGUCAUCUGUGACGGGCAUUAAPMRD
osa-miRf10902-akrUGUGACCCCACAUGUCAGUUACAUGAPMRD
osa-miRf10903-akrAGCUCGAGUAGCUCACGAGUPMRD
osa-miRf10905-akrUGCGCCAUAGAAUAAUGGCUUGGCUPMRD
osa-miRf10906-akrUGCCGCCCAAGUAGAGGGCGGCAAPMRD
osa-miRf10907-akrUCCCGGUUGGUGUUAUCAACCPMRD
osa-miRf10909-akrGGGUGAUACUUGUGAGGUAUCAGGUPMRD
osa-miRf10911-akrGUGGUGGCGAUGUGCCAAGUGAPMRD
osa-miRf10912-akrUCUUUAGUCCCGGUUUGUAACACCPMRD
osa-miRf10914-akrCCCGCCAGAUCUAGCUGAGGPMRD
osa-miRf10915-akrCAGCGGCAAAACUGUUCUUGPMRD
osa-miRf10916-akrGUUCCUCACGUUGUCGUCGAGPMRD
osa-miRf10917-akrGGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10919-akrCCCGGUUGGUAAAACCAACUGGGPMRD
osa-miRf10921-akrCCCGGUUAGUAACACCAACCGPMRD
osa-miRf10923-akrUGCGCCAUAGUAUAAUGGCAUGGCPMRD
osa-miRf10924-akrUAGCUACAUUUGGGGACAGAGPMRD
osa-miRf10926-akrGGGGAUCUUUAGUCCCGGUUAPMRD
osa-miRf10927-akrUCUUUAGUCCCGGUUGGUGGGPMRD
osa-miRf10928-akrAGGUAUCAGGCCUGGUACCCGPMRD
osa-miRf10929-akrCUCUUAAGUGACUGCUAGCGPMRD
osa-miRf10930-akrAAUGCCCGAUUGAGAUGACAPMRD
osa-miRf10931-akrAGGUUAAGCAUGCUUGGCCUPMRD
osa-miRf10932-akrUCCGGUGGGACCCACAUGUCAUUPMRD
osa-miRf10933-akrGAUGACUCAUAUGUGACGGGCPMRD
osa-miRf10934-akrCAUCUUGCGAUUUCCUGGCAPMRD
osa-miRf10935-akrAUCUUUAGUCUCGGUUGGUAPMRD
osa-miRf10937-akrUUGGUGUUACCAACCGGGACUAAAPMRD
osa-miRf10938-akrCUGAUGGACGGUCCUCCACUUPMRD
osa-miRf10939-akrAGUGGAGGACCGUCCAUCAGAPMRD
osa-miRf10940-akrAUUAGGCUCAGAAGAUUCGUCUUCUPMRD
osa-miRf10941-akrGACAUGGAGUUGAGUUGGUUPMRD
osa-miRf10943-akrGCCACAUCAGCGAAACCGUCCPMRD
osa-miRf10944-akrGCGGUUUUGCUGACGUGGCGCCPMRD
osa-miRf10945-akrUUUUGCUGACGUGGCGCCUACGUPMRD
osa-miRf10946-akrUUUCGCUGAUGUGGCGCCUACGUPMRD
osa-miRf10947-akrGACGAUGGCGACAACGGCGAUGAPMRD
osa-miRf10951-akrUCCCGGUUGGCAUUACCAACCGGPMRD
osa-miRf10953-akrAUAAGUCAUCUGUGACGGGCUCUAPMRD
osa-miRf10954-akrUAGGCUCGAUUUGAGCUCGGCPMRD
osa-miRf10957-akrUUGGUGCCCGUCACAGAUGACPMRD
osa-miRf10960-akrGGUGUUACCAACCGGGAUUAPMRD
osa-miRf10961-akrUGCCAUGUUCUCGUCCUAGGPMRD
osa-miRf10962-akrUACCAACCGGGACUAAAGUUACGPMRD
osa-miRf10963-akrUUACCAACCGGGACUAAAGUPMRD
osa-miRf10964-akrCUUUAGUCCCGGUUGGUGGGAPMRD
osa-miRf10968-akrUCGAGCUGAGAUCGAGCUUCPMRD
osa-miRf10970-akrCGAGCCGAGCUCGAGCUUCUPMRD
osa-miRf10971-akrUGAACCCAUGACCUCUUGGGUAAPMRD
osa-miRf10972-akrGGAGACUUGAACCCAUGACCPMRD
osa-miRf10974-akrCCACGAGGUCAUGGGUUCAAPMRD
osa-miRf10975-akrGACUUGAACCCAUGACCUCGUPMRD
osa-miRf10976-akrUCCCGGUUGGUGUUACCAACUGGPMRD
osa-miRf10977-akrGGUGAUCUUUAGUCCCGGUUAUUPMRD
osa-miRf10978-akrCUGCCAAAGGAGAAUUGCCCPMRD
osa-miRf10979-akrUGCCCUUUAGGGCUAAUUCAPMRD
osa-miRf10981-akrUGGGUUCGCGGCUGACCCACUUAPMRD
osa-miRf10982-akrCGUGCGGUCCUCUUAAGUCGACCPMRD
osa-miRf10983-akrUCUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10984-akrCAGUAGCGGCAAUCUCAUCUPMRD
osa-miRf10985-akrUGUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf10987-akrUAAUGCCCGUCACAGAUGAGUPMRD
osa-miRf10988-akrCCCCGGGAUCUUUAGUCCCGGUUPMRD
osa-miRf10989-akrUUUCCAGUCGGAGGUUGGUCACUPMRD
osa-miRf10990-akrUGCUGCCGACUAGUUUCCAGUCGGAGGPMRD
osa-miRf10991-akrAGUCUCGGUUGGUAACACCAACCGGPMRD
osa-miRf10992-akrGCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10993-akrUCCCGCACUUCCAUUCUGCGCGAPMRD
osa-miRf10994-akrUGGCCCACAUAUCAGUGGCACAPMRD
osa-miRf10995-akrGUCUUGCCCAAGUCGCCGCUGGPMRD
osa-miRf10997-akrGUCCCGGUUGGUAACACCAAPMRD
osa-miRf10998-akrGCUCUUUAGUCUCGGUUGGUPMRD
osa-miRf10999-akrGUCCGGUUGGUGUUACCAACCPMRD
osa-miRf11000-akrCGUCCCAAAAUGUAGCUACCUPMRD
osa-miRf11001-akrAGCUACAUUUUGGGACGGAGGAAPMRD
osa-miRf11002-akrCCUCCGUCCCAAAAUGUAGCUACPMRD
osa-miRf11003-akrGAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf11005-akrCCAUGAGGUAGCAGUACCUCGPMRD
osa-miRf11006-akrUCCCGGUUGGUAGUACCAACCGGPMRD
osa-miRf11007-akrCCCAGUUGGUAGCACCAACCGGGPMRD
osa-miRf11008-akrUUGGUAGCACCAACCGGGGCUAPMRD
osa-miRf11009-akrAUUUGGUACCGUGAGGUACCPMRD
osa-miRf11010-akrCCCGGAGGUUCUGGCCAGAACPMRD
osa-miRf11011-akrAAGUUCUGGCCAGAACCUCCGGGUAPMRD
osa-miRf11012-akrGGAAGUUCUGGCCAGAACCUCCPMRD
osa-miRf11013-akrGGUUUGCCGGAGUUGGAGGAGAPMRD
osa-miRf11014-akrCUGGAUGAUGCGGUCGAGGAUGCCPMRD
osa-miRf11015-akrUUCUGGAUGAUGCGGUCGAGGAPMRD
osa-miRf11016-akrCGAGUCGAGCUCGAGCAGCUCGCGPMRD
osa-miRf11017-akrAGGACGAGUCGAGCUCGAGCAGCUPMRD
osa-miRf11018-akrUUAGUCCCGGUUGGUAUUACCPMRD
osa-miRf11019-akrAGUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf11020-akrUUAUUCCCGGUUGGUGUUACCPMRD
osa-miRf11021-akrAGUCCCGGUUGGUGACACCAACPMRD
osa-miRf11023-akrGUUGGUGUCACCAACCGGGACUAPMRD
osa-miRf11024-akrAGAGCUUCUGAUUCUGGGAGAPMRD
osa-miRf11025-akrGUCGUCGUCGGUGGUCAGCUPMRD
osa-miRf11026-akrAGUGGCAGUGGCAGUUGCAGUUPMRD
osa-miRf11028-akrUCGAGCUAGCUCGCGAGCCAAAPMRD
osa-miRf11029-akrAAUGCCAUGUCCUCGUCCUAGGUGPMRD
osa-miRf11032-akrUUCUUGAGGAGGUAUCAUGAGGUACPMRD
osa-miRf11033-akrCUUGAGAAGGUACCAUGAGGUACPMRD
osa-miRf11034-akrUGUUACCAACCGGGACUAAAAAPMRD
osa-miRf11035-akrUCGUGAGGUACCGGUACCUCGAGPMRD
osa-miRf11036-akrCGUGCCAACGUUUGACUGUCPMRD
osa-miRf11037-akrCCAACGUUUGACUGUCCGUCUUAUAUPMRD
osa-miRf11038-akrCCAACGUUUGACUGUCCGUCPMRD
osa-miRf11040-akrCCUCCUCUUCGCGAACGUCACCUGCCGPMRD
osa-miRf11041-akrAGAGGGAUAUGGGUCGCUGAPMRD
osa-miRf11042-akrGUAUGUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf11043-akrGUAUGUGGGCAAUGCUAGAAAGUPMRD
osa-miRf11044-akrGUUGCUAUAUUGUGGGACGGAGUPMRD
osa-miRf11045-akrGCGCUCCUCCAUCUUCUUCGAPMRD
osa-miRf11047-akrCUGCUGUUGCAUCAGCAGUAUPMRD
osa-miRf11048-akrGCAGUACUGCUGAUGCAAUAGPMRD
osa-miRf11049-akrAGUCAUCUGUGACGGGCAUUAPMRD
osa-miRf11050-akrCUUACAUUGUGAAACGGAGGAAPMRD
osa-miRf11051-akrGGCCCACAUGUCAGUGACACAAAAPMRD
osa-miRf11052-akrUUGUGUCACUGACAUGUGGGCCPMRD
osa-miRf11053-akrGCGUGCACUUUGAGCGCCAUGPMRD
osa-miRf11054-akrCCGGUUGAUAACACCAAUCGGPMRD
osa-miRf11055-akrCGGUUGGUGUUACAAACCGGGAPMRD
osa-miRf11056-akrGGUGUUACGAACCGGGAUUAAAPMRD
osa-miRf11057-akrCUGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11058-akrUUAGUCCUGGUUGGUGUUACCPMRD
osa-miRf11059-akrCUUAUAUCAUGGGACGGAGGGAGUAPMRD
osa-miRf11060-akrUAUCAUGGGACGGAGGGAGUACUAGPMRD
osa-miRf11062-akrUUCUUGAGGAGGUAACAUGAGGUACPMRD
osa-miRf11064-akrUGAGGUACCAUGAGGUACCAAAUPMRD
osa-miRf11065-akrUACUACUGCUGGUGGUGGCGGCGPMRD
osa-miRf11066-akrAGUCCCGGUUGGUAACACUAACCGGGAPMRD
osa-miRf11067-akrCUAGGUCCGCCUGCGAAAAUAGPMRD
osa-miRf11069-akrCUGCCGACUGGUUUCCAGUCGGCGGCUPMRD
osa-miRf11072-akrUCCCGGUUAGUAUUACCAACCGPMRD
osa-miRf11073-akrGAUGAUGACGUCGUCGGUGAPMRD
osa-miRf11074-akrUCAAGCUCGAACGAGCUCGAPMRD
osa-miRf11076-akrAUCAAGCUCGAGCAGCUUGCPMRD
osa-miRf11077-akrCCGGUUGGUGUUACCAACCGAGAPMRD
osa-miRf11078-akrUUUCGCGCAACGGUUGUGCGAGAPMRD
osa-miRf11079-akrAGAUGGCUGAUGCUCGAACUCPMRD
osa-miRf11082-akrCGAUUUGGUACCAUGAGGUACCPMRD
osa-miRf11083-akrUACUGUCCUUGAGGAGGUAUCAUPMRD
osa-miRf11085-akrGCAGGCCCAGCUGUCAGUCAPMRD
osa-miRf11086-akrGAGCUGGUACAGGCCGGUGUAPMRD
osa-miRf11087-akrACCUCGGAGUGCUUCUACGGCUPMRD
osa-miRf11089-akrUUACUCCCGGUUGUUACUACCAACCPMRD
osa-miRf11090-akrUUUUGGGACAGAGGGAGUAUGUPMRD
osa-miRf11091-akrCACCGGUCAGACCGGUCAUGCAAUGCPMRD
osa-miRf11093-akrAGGCGGUUUUGCCCUUCUUUPMRD
osa-miRf11095-akrUCGUCGAGGUCGACAUCGACGGCPMRD
osa-miRf11096-akrUGACGCUGCACCCGCAACAAPMRD
osa-miRf11097-akrGGGAUAAUCGAUUAUCCCGUGCPMRD
osa-miRf11098-akrCAGCUGCUGCAGCUUUUCCCPMRD
osa-miRf11100-akrUAGUUUGUGUUGUAGCUGGCUAPMRD
osa-miRf11101-akrAUCUUUAGUCCCGGUUGGUGPMRD
osa-miRf11105-akrCCUCUUAAGGGUCCGCAUGCPMRD
osa-miRf11107-akrUUUCCGUGCGGUCCUCUUAAPMRD
osa-miRf11110-akrGGUGUUACCAAUCGGGACUAAAGAUPMRD
osa-miRf11112-akrUUGGUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf11114-akrAGGGUUCGGCUGAACCCUUGGUUUPMRD
osa-miRf11115-akrAACCAAGGGUUCAGCCGAACCCUPMRD
osa-miRf11116-akrAGUCGGUCUAGAUGAGCCGAPMRD
osa-miRf11117-akrUCAGCGCCAACCUCUUUGGCGCUGAPMRD
osa-miRf11118-akrUCAGCGCCAAGUGCAUUGGCGCUGAPMRD
osa-miRf11119-akrGUAGUACUAGGAUAUGUCACAUCCAPMRD
osa-miRf11120-akrCCCAGUUGGUAGUAACAACCGGGAPMRD
osa-miRf11121-akrGUGUCCGGUCUGACCGAGGCACAGUPMRD
osa-miRf11122-akrUAGGUCUGGAGUAGAGUUGUGGAGCPMRD
osa-miRf11123-akrCCGGUGUUUUAGGACAGGAACUUPMRD
osa-miRf11125-akrGGCUCACCAUUGCAGGAGGAPMRD
osa-miRf11126-akrCAUACAGGCCACUUAAGAAGPMRD
osa-miRf11128-akrCGUACCGUGAGGUACCGGUACAUCPMRD
osa-miRf11129-akrGGUACCGUGAGGUACCGAUAPMRD
osa-miRf11131-akrUCCCGGUUGAUGAUACCAACPMRD
osa-miRf11132-akrACUUACAUUGUGAAACGGAGGGPMRD
osa-miRf11133-akrCUUACAUUGUGAAAUGGAGGPMRD
osa-miRf11135-akrCGUCCGACUGGUUUCCAGUCGGGGGCUCPMRD
osa-miRf11136-akrCUACGUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf11138-akrGUCCGGUUGUUGAGAACAACPMRD
osa-miRf11140-akrUUUUGGCCCAUCACAGGUAAPMRD
osa-miRf11141-akrGAUGACCCUCAUCUGUGACGGGPMRD
osa-miRf11143-akrGAGCUCAGCUCGGGCUUGGUPMRD
osa-miRf11144-akrCCCACAUGUCAGUGACUCAAPMRD
osa-miRf11145-akrCAGCCCUUGCUUGCCGAACAGGPMRD
osa-miRf11147-akrCAGAUUCGUUGUACUAGGAGGPMRD
osa-miRf11148-akrAUGGUACCUCCUGAAGGACCPMRD
osa-miRf11152-akrUCAGCACCAUGCUAUUUGGCGCUGPMRD
osa-miRf11153-akrUGACAUGGGUGGCCCAUGGUUGPMRD
osa-miRf11154-akrAGAUUUUGGGUGGAUGUGACPMRD
osa-miRf11155-akrUGGACCCACACGUCAUCCUCGAPMRD
osa-miRf11156-akrAGGUAUCGCAUGAUACCUCGUPMRD
osa-miRf11157-akrUUGAGGAGGUACCAUGAGGUAPMRD
osa-miRf11158-akrGCACCACCAACAUUGGUGUCPMRD
osa-miRf11159-akrGCCAAUGUAGUUGGUGCCGUPMRD
osa-miRf11160-akrGCAGCAUCAGCAUCCAAGCUPMRD
osa-miRf11163-akrACGGUCCUUAAGGAGGUACCAUGAPMRD
osa-miRf11164-akrGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11166-akrUUAGUCCCGGUUGGUGUUACPMRD
osa-miRf11167-akrGAGCUCGACACGAGCUCGAGPMRD
osa-miRf11168-akrGGAUGCCAUGACCUCGUCCUAGPMRD
osa-miRf11169-akrACCAACCGGGACUAAAGAUCPMRD
osa-miRf11170-akrUGCAUGCAUCUGCAUGUGCCPMRD
osa-miRf11171-akrCGAUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf11172-akrAAAAGUGCACCAAAGGUCCCUCAAPMRD
osa-miRf11173-akrUCCCACCCAGAGGUUUCGCCCGGUPMRD
osa-miRf11174-akrGUUGGUGUUACUAACCGGGACUAAAPMRD
osa-miRf11175-akrAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11176-akrUAACGCCCGUCACAGAUGAGUPMRD
osa-miRf11177-akrUCCCUCAACUUGUCAUCGGGAPMRD
osa-miRf11178-akrCCGUUGACAAGUUGAGGGACCUUPMRD
osa-miRf11179-akrUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf11180-akrCACCGAAGGUCCCUCAACUUGUPMRD
osa-miRf11181-akrUCUGCUCCAGUGGAGAAGCAPMRD
osa-miRf11182-akrGUACUCCCUCCGUCCCAUGAAAAAPMRD
osa-miRf11183-akrACGUCGGAGGAUCCUCUUCCPMRD
osa-miRf11184-akrUUGCAUCUAGGUCCCUUGCCPMRD
osa-miRf11185-akrGUGGAUGGAUGCGGAGACAAPMRD
osa-miRf11186-akrCUUGGGUGGACGUCCACCCAUUUPMRD
osa-miRf11187-akrAACGGGUGGACGUCCACCCGAGPMRD
osa-miRf11188-akrCAGCUGCUAGAAGCUCCCCAAAPMRD
osa-miRf11189-akrUGCCAGAAGCUCCCCCAAACAPMRD
osa-miRf11191-akrUGCCGACUGGUUUCCAGUCGGCGGPMRD
osa-miRf11192-akrCGGGACUGAAGAUCAUCUUUAGUCPMRD
osa-miRf11193-akrAGAUGAUCUUCAGUCCCGGUUGGUGPMRD
osa-miRf11194-akrGAGUUGCUCGAGCUCGGCUCGUCUCPMRD
osa-miRf11195-akrGGUUCGCGGGUCAACCCACUUGPMRD
osa-miRf11199-akrACUGCACGUGGUCUCCUUCUCCAUCPMRD
osa-miRf11200-akrGAUGUGUCCUAACCAGUCAAPMRD
osa-miRf11201-akrCCGGUUGGUGUUACUAACCGGPMRD
osa-miRf11202-akrUCCCUCUGUCCCAGAAUAAGPMRD
osa-miRf11203-akrUAGGGCCUGUUCACUUUGAUGCCAPMRD
osa-miRf11204-akrAGAGAUCCCUGACUUUGUGCPMRD
osa-miRf11205-akrUGCCGACUGAUUUCUAGUCGGCGGPMRD
osa-miRf11207-akrACCAUGAGGUAUCGGUACCCCGAPMRD
osa-miRf11208-akrUGUCCAACGUUUGACUGUCCGUCPMRD
osa-miRf11209-akrUGCAGUUUCAUCUGCUUGUGGPMRD
osa-miRf11210-akrAUCAUGCUGUGCAGUUUCAUPMRD
osa-miRf11211-akrGGUAAUGUCCCAUCCCCAACUPMRD
osa-miRf11212-akrAUACUCCCUCCGUCCCUAAAPMRD
osa-miRf11213-akrGUACUCCUUUCGUCCCAAAAPMRD
osa-miRf11215-akrUAGAUACUCCCUCCGUCCCAPMRD
osa-miRf11216-akrAUUGUACUCCCUCCGUCCCAUUAAAAAPMRD
osa-miRf11217-akrAGAGCUGGAGCUGUGCCAAACGGPMRD
osa-miRf11218-akrACUACUCUCUCCGUCCCAAAAAAACPMRD
osa-miRf11219-akrUUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf11220-akrCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf11221-akrGUUGCAGCAGCAGGGACAGUPMRD
osa-miRf11223-akrCGUCCGCCUGCGAAGAUAAUPMRD
osa-miRf11224-akrUUACCAACCGGGACUAAAGAUCAPMRD
osa-miRf11226-akrAUCUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf11227-akrUAGUCCUGGUUGGUAACACCAACCGGGAPMRD
osa-miRf11229-akrAGUCCCGGUUGGUAACACGAACCGGPMRD
osa-miRf11230-akrCCGGUUGGUAACACGAACCGGPMRD
osa-miRf11231-akrGUCCGCUUGCGAAAAUCGAUUUUCGCPMRD
osa-miRf11234-akrGGUUGGUGUUACCAACUGGGAPMRD
osa-miRf11235-akrGGUGUUACCAACUGGGACUAPMRD
osa-miRf11236-akrAGUCCCAGUUGGUAACACCAACCPMRD
osa-miRf11237-akrGGUAUUACGAACCGGGACUAPMRD
osa-miRf11238-akrCAUGUGCAGCACAGCAGAGGAUUPMRD
osa-miRf11239-akrUCUGCUGUGCUGCACAUGCAPMRD
osa-miRf11240-akrGAUGGUGUACUUGGGCAGCGAPMRD
osa-miRf11241-akrGCCGAUUUUCGCUGGCGGACPMRD
osa-miRf11242-akrCGUCUUCCUGUUCCUGCAGCUGGPMRD
osa-miRf11243-akrCCCACAUGUCAGUGACUCUAAPMRD
osa-miRf11244-akrUCCCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf11245-akrAGUCCCGGUUGGUAACAUCAACCGGGAPMRD
osa-miRf11246-akrCCGGUUGGUGUUACCUACCGGGAPMRD
osa-miRf11247-akrGGUGUUACCUACCGGGACUAAAGAUPMRD
osa-miRf11248-akrCGCCGUUAGGGUUCCAUCCUPMRD
osa-miRf11251-akrCCGUCACUGAUGACUCAUCUPMRD
osa-miRf11252-akrUUCCGGUGUUCUUCACCAGGAGGPMRD
osa-miRf11253-akrUGUCCAACGUUUGACUGUCCGUPMRD
osa-miRf11254-akrAAGCUUAGCUGCGACGUUGCCPMRD
osa-miRf11256-akrGAUCUUUAGUCCCGGUUGGUAACPMRD
osa-miRf11258-akrUUAUCCUAACGAGCCGAGCUGPMRD
osa-miRf11259-akrGUGUCAGUGGGGACUCACAUGPMRD
osa-miRf11260-akrAUAUCAUCCCCUCCUAGGUUGUPMRD
osa-miRf11263-akrCCGGUUGGUAACACCAACCGGGAGUPMRD
osa-miRf11267-akrGACGACGACGAACUUGCCCUUPMRD
osa-miRf11268-akrACUGUUUGGCACAGCUCCAGCUCPMRD
osa-miRf11269-akrGGGAUAUCUUCACGAUCACUPMRD
osa-miRf11270-akrGUACUCCUUUCGUCCCAAAAAAAAPMRD
osa-miRf11271-akrGCCACCAACCGGGACUAAAGAUCAPMRD
osa-miRf11272-akrUUGGUGUUACCAACCAGGACPMRD
osa-miRf11273-akrUGCCAUCGCCAUUAGGGUUCPMRD
osa-miRf11274-akrGUUGGCAUGCCACGUGGACAPMRD
osa-miRf11275-akrCUACGUGGCAUGCCAAGGUGGCPMRD
osa-miRf11276-akrCCACGUGGCAUGCCAACGUGGPMRD
osa-miRf11277-akrGGCCCGUCACAGGUGACUUGAUACCPMRD
osa-miRf11278-akrGGAUCCUGCCGGUCAGACCGPMRD
osa-miRf11279-akrUAACUUUAGUCCCGGUUGGUAPMRD
osa-miRf11281-akrUCGGCAGAUUUGGUCGAAGGPMRD
osa-miRf11282-akrAAAAUGAUCUUCGUAGGCGGACPMRD
osa-miRf11283-akrGUGGUGUUGACUCGGUCUUCPMRD
osa-miRf11285-akrCAUGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf11287-akrCUGUCGAACUGGGGCAGUUCGACAPMRD
osa-miRf11288-akrUGUCCAACGUUUGACUGUCCGUUUUAUPMRD
osa-miRf11289-akrAGAAGGGGUCAUAUUCCCUUPMRD
osa-miRf11290-akrGUGACACCAACCGGGAGUAAAPMRD
osa-miRf11292-akrUUAAGUGGUCCGCCUGCGAAPMRD
osa-miRf11293-akrGGCUCGUACUCCUGCUUGUCGACGUPMRD
osa-miRf11294-akrGGUUGGUACUACCAACCGGGAPMRD
osa-miRf11295-akrUGACGGGCCCUAGUUGUGGCUCPMRD
osa-miRf11297-akrUCCCGGUUGGUAACACGAACCGGGAPMRD
osa-miRf11298-akrAUCUUUAGUCCCGGUUGGUAGCPMRD
osa-miRf11299-akrGUGUAUUCCAUGUCGACGGCPMRD
osa-miRf11300-akrCAGGGAGCUCUUGAUGUUUGUGAPMRD
osa-miRf11301-akrGGUUACUGUAGCACUUAUGGPMRD
osa-miRf11302-akrGCGUCGCUUAUAUGGUCCGCPMRD
osa-miRf11303-akrGGCAUGUGGGUCCCACAUGUUUPMRD
osa-miRf11305-akrGACCUCUUAAGUGGUCCACCUGPMRD
osa-miRf11306-akrUUUCAACCGGGACUAAAGAUPMRD
osa-miRf11307-akrGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf11308-akrUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf11309-akrGAUCUUUAGCCCUGGUUGGUPMRD
osa-miRf11310-akrUAGCAAGUUCGAGUGGGAUAPMRD
osa-miRf11312-akrCGGUUGGUGUUACCAAUCAGPMRD
osa-miRf11314-akrGAAGAGGUGCUCCACAUCUUCPMRD
osa-miRf11315-akrUUGGUACUGUGGGGUACCGGUPMRD
osa-miRf11316-akrGGUACUCCCUCCGUUCCUAAAUAPMRD
osa-miRf11318-akrUAUCAACCGGGACUAAAGAUCCCPMRD
osa-miRf11319-akrGGAGCUAGAGCUGUGCCAAACGGGPMRD
osa-miRf11320-akrGAGCUCGAGCUCGAGCCAAGCPMRD
osa-miRf11321-akrAUAGGCUUGGCUCGAGCUCGAPMRD
osa-miRf11322-akrCCCGGUUGGUGCUACCAACCGAGAPMRD
osa-miRf11323-akrAUCAAGCUCGAGCAGCUUGCGAPMRD
osa-miRf11325-akrCUCCAACCGGGACUAAAGUUPMRD
osa-miRf11326-akrCGGUUGGUAACUCCAACCGGPMRD
osa-miRf11327-akrAAUCCAACAGCUAUCUUGGCAPMRD
osa-miRf11329-akrAACUUUAGUCCCGGUUGGUAUUPMRD
osa-miRf11330-akrCCGGUUAGUGUUACUAACCAGGAPMRD
osa-miRf11333-akrACGUGAUACUCGCGAGGUAUCPMRD
osa-miRf11336-akrUGAUACCGGUAAGGUAUCAGGACPMRD
osa-miRf11337-akrCGCGAUACCAGAUAGGUAUCACPMRD
osa-miRf11338-akrUUAGUCCCGGUUGGUGACACCPMRD
osa-miRf11339-akrUCCCGAUUGGUAACACCAACCPMRD
osa-miRf11341-akrCGCGCCGACGAUGACGGUGGAGUPMRD
osa-miRf11343-akrCUCGUCGCUGACGAGUGGGGCCAPMRD
osa-miRf11344-akrAUCUUUUGGCCACGCCAGCCPMRD
osa-miRf11345-akrCCUGGUUGGCAUUGAGGGAGPMRD
osa-miRf11346-akrCUGGUGUGGCAAAACAACGCPMRD
osa-miRf11347-akrCGGCGUCGUCUUCCCUCCCCAUGAPMRD
osa-miRf11348-akrAAGAACCUAGGACUGGAUGGGAUAUPMRD
osa-miRf11349-akrUCAGCGCCGUGCUAUUUGGCPMRD
osa-miRf11352-akrAGGGAUUUUGGAAGGAGGUGACAPMRD
osa-miRf11353-akrGUGGAUGCCUUAACACGAAGPMRD
osa-miRf11354-akrGUAGCUGUCCUUCCACGCCAPMRD
osa-miRf11355-akrGGUGGAGGUGGAGCUGUGCCAAAPMRD
osa-miRf11356-akrAGGGUCUGCUUGGCACAGCUPMRD
osa-miRf11357-akrUGGAGCUGUGCCAAAUAGGCCCUGPMRD
osa-miRf11358-akrAAGGCACCUACCUUUGACGGPMRD
osa-miRf11359-akrCCGUGAGGUACCGGUAUUUCGAGAUAPMRD
osa-miRf11360-akrCCGUGAGGUAUCGGUAUCUCGAGPMRD
osa-miRf11363-akrCGCCAAGUGCAUUGGCGCUGPMRD
osa-miRf11364-akrAUGUGUCAUCCGUGACGGACCUGPMRD
osa-miRf11366-akrAUGAGGUACCAUGAGGUACCAPMRD
osa-miRf11368-akrCCGGUUGGUAACACAAACCGGPMRD
osa-miRf11370-akrAAGUUGGUUCCCAGCCCGGAPMRD
osa-miRf11371-akrAUCCAUGGCCGCUCCCAUGGCUGPMRD
osa-miRf11372-akrUGUUACUCCCUCCGUCCCAUAAUAPMRD
osa-miRf11373-akrGGGUGUAAGUGGCUAACCCGCGAAACPMRD
osa-miRf11374-akrAUUCUGGCCCGUCACAGGUGAPMRD
osa-miRf11375-akrCCGGUUGAUGUUACCAACCGGPMRD
osa-miRf11376-akrAUCGCGCGGUAACCGCGGUAAPMRD
osa-miRf11377-akrCUGUCGAACUGCGGUAGUUCPMRD
osa-miRf11378-akrUUGCUCGAGGUUGCGCAGCAUGPMRD
osa-miRf11379-akrUUAGUCCAGGUUGGUGUUACCPMRD
osa-miRf11381-akrGAUGACCCUCAUCAGUGACGGPMRD
osa-miRf11382-akrGUGUCCAACGUUCGACUGUCCGUPMRD
osa-miRf11383-akrAUCUUUAGUCCCGGUUGGUAGAPMRD
osa-miRf11385-akrUGUUGCCGAUUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11386-akrGCCGAUUGGUUUCCAGUCGGCGGCAPMRD
osa-miRf11387-akrGCCAGCGAAGAUCCAUUUUCGCUGGPMRD
osa-miRf11388-akrCCGGUUGAUAACAUCAACCGGPMRD
osa-miRf11389-akrGCGAAAAUCGGAUUUUCGCGUGCGGPMRD
osa-miRf11390-akrCACCGUCGUCGCUGCCACACPMRD
osa-miRf11392-akrCUCAGCGCCAAGUUAUUUGGCGCUGPMRD
osa-miRf11393-akrCUCAGCGCCAUUGACCUUGGCGCUPMRD
osa-miRf11395-akrCCGGUCUGACCGGUCCACAUPMRD
osa-miRf11396-akrCUGGUUGGUGACACCAACCGPMRD
osa-miRf11398-akrCCGGUUGGUAACACCAACCGPMRD
osa-miRf11399-akrUCGGCUGGUGUUACCAACCGPMRD
osa-miRf11400-akrCCCACAAGUGGAGCUAUAGGPMRD
osa-miRf11401-akrAUGGCCCGUCAGAGGUGAGGUPMRD
osa-miRf11402-akrGUAGGACUUGGAGAUAUCGGACPMRD
osa-miRf11403-akrAUCUUUAGUCCCGGUUGGUGCUPMRD
osa-miRf11405-akrACUGGGAUCUUUAGUCCCGGUPMRD
osa-miRf11406-akrUCCCGGUUGGUGCUACCAACCAGGPMRD
osa-miRf11407-akrGCUGAGCUUGAGCCAAGUUCAPMRD
osa-miRf11408-akrAGGGUCAUCGGUGACGGGCUAPMRD
osa-miRf11409-akrUGUCCAACGUUUGACUGUCCAUCUUAUPMRD
osa-miRf11410-akrUCCCGGUUGGUGCUACCAACCPMRD
osa-miRf11411-akrAUCUUUAGUCCCGGUUGGUGCPMRD
osa-miRf11412-akrUACUUUAGUCCCGGUUGGUAPMRD
osa-miRf11413-akrACUCCCAGGUGUAUGUACUAPMRD
osa-miRf11414-akrUCGUGAUGACGUGGACGAAUPMRD
osa-miRf11415-akrGAGAGCAGGAUGCAGCCAAGGPMRD
osa-miRf11416-akrCAUCCUUGGCUGCAUCCUGCUPMRD
osa-miRf11418-akrUACCUCAUGGUACCUCCUCAAGGAPMRD
osa-miRf11419-akrAGGGUUAAGCGUGCUUGGCCPMRD
osa-miRf11420-akrUGUUACCAACCGGGACUAAAGAPMRD
osa-miRf11428-akrUGAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11434-akrAGCUGGAGCUCAGCCAAACAPMRD
osa-miRf11435-akrGAUCCGUCGCCAUCGAGCUUGPMRD
osa-miRf11436-akrGCGCUGAACAUAGACACUUCAACPMRD
osa-miRf11437-akrGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11438-akrCCUUUGUUGCACAAUGGACCPMRD
osa-miRf11439-akrUGCCAACGUUUGACUGUCCAUCPMRD
osa-miRf11440-akrGGUCAUCGGUGACGGGCUUCAPMRD
osa-miRf11441-akrUGCACCACCGGCUGAAUUGGUGGUPMRD
osa-miRf11443-akrCACGGGAUAAUCGAUUAUCCPMRD
osa-miRf11444-akrAUCUUCGUAGGCGGGCGGUCPMRD
osa-miRf11445-akrGAUGACUCAUCUGUGACGGGCCCPMRD
osa-miRf11446-akrACUCAUCUGUGACGGGCCCUPMRD
osa-miRf11447-akrACUCAUCUGUGUCGGGCUCUAUPMRD
osa-miRf11448-akrGCCAUCGAACACGACCAGCUPMRD
osa-miRf11449-akrUAACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf11450-akrCCCGGUUGGACAACUGGAACPMRD
osa-miRf11452-akrUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf11454-akrAGUCCCGGUUGGUAACACCAACCGAGAPMRD
osa-miRf11456-akrUCUCGGUUGGUAUUACCAACCAPMRD
osa-miRf11457-akrACUUGCAUUGUGAAACGGAGGGPMRD
osa-miRf11458-akrCUCAUGGUGACGUGGAUGAAPMRD
osa-miRf11459-akrGUUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11460-akrCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11461-akrAGCGCCAUGCUAUUUGGCUCUGPMRD
osa-miRf11462-akrAAAACCAUGGGCCCACAUGUCAAUPMRD
osa-miRf11463-akrAAAACCAUGGGCCCACAUGUPMRD
osa-miRf11464-akrGAUGAGUCAUCUGUGACGGGCCCUAPMRD
osa-miRf11466-akrGCCCGUCACAGAUGACUCAUCPMRD
osa-miRf11468-akrGGUUGGUGUUACCAAACGGGAPMRD
osa-miRf11469-akrGCUCGUUAUCCUAACGAGCUPMRD
osa-miRf11470-akrACUGUACCGUGCCUUUGUCAPMRD
osa-miRf11471-akrUCAGUGAUAAAGGCACGGUGCAPMRD
osa-miRf11472-akrUUGCCAUGCCUGUCUGGCUGPMRD
osa-miRf11473-akrGCCUUAAUUCCGGCCCAUCCPMRD
osa-miRf11474-akrAAUGAUCUUUAGUCCCGGUUGGAPMRD
osa-miRf11475-akrUCGGUGACAAGAUGAGGGACCUPMRD
osa-miRf11477-akrCUGUCGAACAACCGCAGUUCPMRD
osa-miRf11478-akrUCCUGGUUGGUGUUACCAACCGPMRD
osa-miRf11479-akrUCCCGGUUGGUAACACCAACAGGPMRD
osa-miRf11481-akrGUGUCAUCUGUGACGGGCUCCPMRD
osa-miRf11482-akrGUCCGGAGGUUCCGAUCAAUPMRD
osa-miRf11486-akrGGCUCGUUAUCCUAACGAGCUPMRD
osa-miRf11487-akrGCCCGUCACAGAUGAGUCAUCPMRD
osa-miRf11488-akrCAGAUGAGUCAUCGGUGAUGGGPMRD
osa-miRf11489-akrCCCGGUUGGUAACACAAACCGGPMRD
osa-miRf11490-akrGAUCUUUAGUCCCGGUUGGUAUUPMRD
osa-miRf11491-akrUGGGCAAUACUAGAAAGUCUPMRD
osa-miRf11493-akrAUCUUUAGUCCCGGUUGAUAGCPMRD
osa-miRf11494-akrCUAUCUUUAGUCCCGGUUGAPMRD
osa-miRf11495-akrGUGGCCUCCUCGAGCUCCUCUGPMRD
osa-miRf11496-akrGGUUGGUGUCACCAACCGGGAAPMRD
osa-miRf11497-akrACAGGGAUCUACGUAGUACGACAUPMRD
osa-miRf11498-akrAGCGCCAAAGUCAAUGGCGCPMRD
osa-miRf11499-akrCCGGUUGAUAUUACCAACCGPMRD
osa-miRf11500-akrCGCAGGCAUCAGGUGGAGGAPMRD
osa-miRf11501-akrGUGAUGCUUGCGAUGUAUCAGGUPMRD
osa-miRf11502-akrGUGCCUCUAUCUGCAUUGCUGPMRD
osa-miRf11503-akrUGGAGCUGGAACUUUGCCAAACAGPMRD
osa-miRf11504-akrUGGAGCUGGAACUUUGCCAAPMRD
osa-miRf11505-akrUCAGUGACUCAAAGUCAGAGGGAAGPMRD
osa-miRf11506-akrGGGUUCACAUGUCAGUGAGCAPMRD
osa-miRf11508-akrAGAGCCUGUUUGGCACAGCUCUAGCUCPMRD
osa-miRf11509-akrGAGCUGGAGCUCAGCCAAACAGGPMRD
osa-miRf11510-akrCUGUUUGGCACAGCUCUAGCUCPMRD
osa-miRf11513-akrAGUGCUGGCUGCUGCAGCAGPMRD
osa-miRf11514-akrCUGUUUGGCUGAGCUCCAGCUPMRD
osa-miRf11515-akrAAUGCAGCCAUGGUCCAUCGUCPMRD
osa-miRf11516-akrUCGGUCGGACGAUCGUCAGGPMRD
osa-miRf11517-akrAUAGCCGAACAGGCCCUUUGPMRD
osa-miRf11518-akrGCUGCCGCUUCCGCCUUGGAGAPMRD
osa-miRf11519-akrCAUUUUGUCAGGAAGUUCCGGGPMRD
osa-miRf11521-akrGGUCACAUCCCCUCCUAGGUPMRD
osa-miRf11522-akrCUUUAGUCCCGGUUGGUGAUPMRD
osa-miRf11523-akrUAUGUACUCCUUUCGUCCCAUAAUAUPMRD
osa-miRf11524-akrGGGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf11525-akrCUCGCGAGCUGCUUGAGCUUGGCUPMRD
osa-miRf11526-akrCGAGCUCGAAUAGCUCGUCGPMRD
osa-miRf11528-akrGGCUUGUUAUCCUAACGAGCUAPMRD
osa-miRf11529-akrUGCCGACUGGACUCCAGUUGGPMRD
osa-miRf11530-akrGCAGCAGCUGCUGCUCCCUUUCCUPMRD
osa-miRf11531-akrGUUCGUGGCUAACCCACUUAPMRD
osa-miRf11532-akrCCUGUCGAACGGAGGCAGUUCGAPMRD
osa-miRf11533-akrGAGCCUGGCUUGUCUUGGCUCPMRD
osa-miRf11534-akrUCGAACCGUGGCAGUUCGACAGGPMRD
osa-miRf11537-akrUAACUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11538-akrUGGCGGCCACAAUGUCCUCCAPMRD
osa-miRf11539-akrAGCUGCCGACUGGUUUCCAGUCGGPMRD
osa-miRf11540-akrUUCCAACCGGGACUAAAGUUPMRD
osa-miRf11541-akrCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11542-akrCUGGUUGAUAACACCAACCGGPMRD
osa-miRf11543-akrUCAGUGCCAGGACCGUUGGCGCUGAPMRD
osa-miRf11544-akrCAUCUGUGACGGGCCACAACUPMRD
osa-miRf11545-akrAUACUCCUUGUAUGACGCCUGCPMRD
osa-miRf11546-akrUAGUCCCGGUUUGUAACACCAACCGGPMRD
osa-miRf11549-akrCAACCGGGACUAAAGAUGAUCPMRD
osa-miRf11550-akrCCCGGUUGGUACUACCAACCGAGAPMRD
osa-miRf11551-akrAGCGCCAAGGCGGUUGGCACUGAGPMRD
osa-miRf11553-akrAGCCAUCUUGAGUCCCGGUUPMRD
osa-miRf11554-akrCCGGUUGGUGUUACCCACCAPMRD
osa-miRf11557-akrUCCUUGAGGAGGUACCAUGAGGUAUPMRD
osa-miRf11559-akrAGACCUGCCGUGCAAUGCCGGUCAPMRD
osa-miRf11560-akrUUAUCUUCGCCCCUUGCAAAPMRD
osa-miRf11561-akrUUCGCGGGUUAGUCACUUACACCPMRD
osa-miRf11562-akrUACGGCUGCUUAAGACGCCCPMRD
osa-miRf11563-akrGGGGUUACCAACCGGGACUAAAPMRD
osa-miRf11564-akrGGUGUUACCAACCGGGACUAAAPMRD
osa-miRf11565-akrUGUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf11568-akrCUCUUGGUCGAGACGCCAGUPMRD
osa-miRf11570-akrCCUUCUCGCUCUCCACUAGGPMRD
osa-miRf11571-akrAGCUCGUCAUAGAUGACCUCPMRD
osa-miRf11572-akrGGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11573-akrUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11575-akrCCCGGUUGUUAAUACCAACCGGPMRD
osa-miRf11578-akrUCUGCAGUCACUGCACCGUGCCPMRD
osa-miRf11579-akrUGUUUGGGGGAGUUUCUGGCAPMRD
osa-miRf11580-akrCGUCAGAGGUGACUGUCACCPMRD
osa-miRf11581-akrGUGCACGUGGAAAACGAGGGAGAGAPMRD
osa-miRf11583-akrUACCUCAUGGCACCUCCUCAAGAACCGUPMRD
osa-miRf11586-akrUUCUUGAGGAGGUGCCAUGAGGUACPMRD
osa-miRf11587-akrAGAUCGAUCUUUAGUCCCGGUUGPMRD
osa-miRf11588-akrUCCCGGUUGGUGUUAUCAACCGGGACUAPMRD
osa-miRf11589-akrUCUCGGUUGGUGUUACCAACCPMRD
osa-miRf11590-akrUCCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf11592-akrAGACCGGCUGUGCAAUGCCAGUCPMRD
osa-miRf11595-akrCAUCGGUGUUGGAGGUGGCPMRD
osa-miRf11596-akrGAUCUUUAGCCCCGGUUGGUPMRD
osa-miRf11597-akrACCGGUCUGACCGGCUGAUGGPMRD
osa-miRf11598-akrAAUUGCUUGUUUGUGUGCCCPMRD
osa-miRf11599-akrGCAACGAUAACGUGGGAAAUPMRD
osa-miRf11601-akrUGUCGCCCUCUGUAAGGGCGGUAAGPMRD
osa-miRf11603-akrCUACUCCCUCCGUCCCAAAAUAAGUPMRD
osa-miRf11604-akrCUACUCUCUCCGUCCCAAAAUAAAPMRD
osa-miRf11605-akrCUACUCUCUCCGUCCCAAAAPMRD
osa-miRf11608-akrACUCUCUUCCAUGCCGGAUCPMRD
osa-miRf11609-akrAUAGGCUUGGCUCGAGCUCGPMRD
osa-miRf11610-akrUUAGCUCGACUCGGCUCGUUPMRD
osa-miRf11611-akrUUUUGCAGGCGGACCUCUUAPMRD
osa-miRf11612-akrUACUCCCUCCGUCCCUAAAUAUAPMRD
osa-miRf11613-akrCUUCUCCACCUCGAUCCUCGGPMRD
osa-miRf11614-akrCGUGUCCAACGUUUGACUGUCPMRD
osa-miRf11615-akrAACUGGAGCUAGAGCUGUGCCPMRD
osa-miRf11616-akrGAUACUUGCGAGGUAUCAGGUPMRD
osa-miRf11617-akrUUUAGGCCCGAUUGAGAUGAGPMRD
osa-miRf11618-akrGUACUCCCUCAGUCCCAAAAPMRD
osa-miRf11619-akrACCUACUCCCUCUGUCCCAAAAUPMRD
osa-miRf11620-akrUUGACCAGCUCGGCCAUGAUPMRD
osa-miRf11622-akrUGCCAUCACCGGUAGCAGCACUUPMRD
osa-miRf11623-akrGUACUAGGAUGUGUCACAUCCPMRD
osa-miRf11624-akrCUACUCCCUAUGUCCCAAAAPMRD
osa-miRf11626-akrUGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf11627-akrCCCCUCCUGCCAGAUCUGGCAGPMRD
osa-miRf11628-akrGGACCCACAUGUCAGCCUCACPMRD
osa-miRf11629-akrCAUCGAUGCACGGCACCGUGCACPMRD
osa-miRf11632-akrUCGAGCCGAGCUUGAGCUUGUPMRD
osa-miRf11633-akrGUCAGACCGGCCGUGCAAUGCCGGUPMRD
osa-miRf11634-akrCGUCCCACGUGGCAUUGACGUGACGPMRD
osa-miRf11637-akrCGGUCAGACCGGCCUGAUGGPMRD
osa-miRf11638-akrCCGAUGCCGAACGGGUAUGGAAUPMRD
osa-miRf11639-akrCUCUGUGUCCAGGAGAACCCPMRD
osa-miRf11640-akrGGUAUUACCAACCGGGACUAPMRD
osa-miRf11641-akrUCGAGCUUGGUCAAGCUCGAPMRD
osa-miRf11642-akrCGGUCAGACCGGUCGUGCAUUGCCGGUPMRD
osa-miRf11644-akrCAUAGGUAUCAGGCCUGGUAPMRD
osa-miRf11645-akrAUAGGUAUCAGGUCUGAUACCUAPMRD
osa-miRf11646-akrGCCUGAUACCUAUAGGUAUCAGPMRD
osa-miRf11647-akrUGUCCUUGCUGGUGGCGGACPMRD
osa-miRf11648-akrGAUGACUCAUCUAUGACGGGCPMRD
osa-miRf11649-akrAAACCGUGCAAAGGAGGUCCCPMRD
osa-miRf11650-akrAUACUGCCAUGGGACCUCCUUUGCAPMRD
osa-miRf11651-akrGGAGGUCCCAUGGCAGUAUUUPMRD
osa-miRf11652-akrGAGGUCCCAUGGCAGUAUUUPMRD
osa-miRf11653-akrAUCUUUAGUCCCGCUUGGUGAGAPMRD
osa-miRf11656-akrUUCUCGCUGACGUGGUCGCUPMRD
osa-miRf11657-akrGGCGCCAACCACUUUGGCGCUGAGGUPMRD
osa-miRf11658-akrAGGUGUCUUUGCUGGUGGCCPMRD
osa-miRf11659-akrCCCGGUCCCAUAUGUCAGCCUPMRD
osa-miRf11660-akrGAAGGAGGCUGACAUAUGGGACCPMRD
osa-miRf11661-akrCCCGGUCUCACAUGUCAGCCUCCUUPMRD
osa-miRf11662-akrGCACACCGACGAGGUACCGGUPMRD
osa-miRf11663-akrGGAGCUAGAGCUGUGCCAAACCGGPMRD
osa-miRf11664-akrGGAGCUAGAGCUGUGCCAAAPMRD
osa-miRf11665-akrACCGGCAUUGCUUGGCCGGUPMRD
osa-miRf11667-akrGAUGAGUCAUCAGUGACGGGCCPMRD
osa-miRf11668-akrACCGGUGUAGAUCAAUCGGUCPMRD
osa-miRf11669-akrUCAACAACCGGGAGUAAAGAPMRD
osa-miRf11670-akrGUUGGUGUUACCAACCGGGACUAPMRD
osa-miRf11672-akrGUCUUGUCCCAGUCCCCACUGPMRD
osa-miRf11673-akrGCCCGUCACCGAUGACACUCAUCPMRD
osa-miRf11674-akrAGGGCUGCAAUCUGGUGGUUPMRD
osa-miRf11675-akrCCCACAUAUCAGUGACUCAAPMRD
osa-miRf11676-akrAAGGAUGUGUCCCAUCCAGUPMRD
osa-miRf11677-akrAGUUGGUGCCCGUCACGGAUGAPMRD
osa-miRf11678-akrUUCGCGGGUUAACCACUUACAPMRD
osa-miRf11679-akrAGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf11680-akrAUUCGUCUCGCGGUUUACAGGCGPMRD
osa-miRf11682-akrACGUAAAGUCAGAGGGACGUGGPMRD
osa-miRf11683-akrUCCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf11684-akrCCGGUUGAUAAUACCAACCGGPMRD
osa-miRf11686-akrCGGCGUGUGCCAUCCCACACAUCPMRD
osa-miRf11687-akrCAUGUGCCAUCCCACACGUCPMRD
osa-miRf11688-akrGUACCGUGAGGUACUGGUACCUCGAPMRD
osa-miRf11689-akrAAGGUACCGGUACCUCAUGGUAPMRD
osa-miRf11690-akrCACGGGAUAAUCGAUUAACCPMRD
osa-miRf11691-akrGCGGCGUCAGCUAGGUUUGGGGPMRD
osa-miRf11692-akrUCCCCGGUUCUGAUCACUUGCPMRD
osa-miRf11693-akrUGACGUGAAGUCAGAGGGACGUGGPMRD
osa-miRf11694-akrCCGCCUGCGAAAAUCUAUUUUCGCAGPMRD
osa-miRf11695-akrCCUGCGAAAAUCAUUUUCGCAGGCGPMRD
osa-miRf11696-akrCGGUCCUUGAGGAGGUACCAUGAGAUACPMRD
osa-miRf11699-akrCUUGAGGAGGUACCAUGAGAUAPMRD
osa-miRf11701-akrUCGAGGUACCGGUACCUCACGGUACUPMRD
osa-miRf11702-akrGGUACCGGUACCUCACGGUACPMRD
osa-miRf11703-akrAGCUCACGUCGAUUUGGUUGPMRD
osa-miRf11704-akrCCAAAUCGAGGUGAGCUCUAPMRD
osa-miRf11705-akrGAGACAACUACUCCCUCCGUUCUPMRD
osa-miRf11706-akrUCCCGGUUGGUACUAUCAACCGGGAPMRD
osa-miRf11708-akrGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf11711-akrUCCUUAAGGAGGUACCAUGAGGUACPMRD
osa-miRf11714-akrUUCUAGCAUUGCCUACAUUCPMRD
osa-miRf11715-akrGCUUGCGUCGUAAGCCGGCUUPMRD
osa-miRf11716-akrUAGUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf11718-akrGGUUGGUAAUACCAACCGGGAGUPMRD
osa-miRf11720-akrUUAGUCCCGGUUGGUGUUAAPMRD
osa-miRf11723-akrGUAUCAUCAUGUCCGAACGGGPMRD
osa-miRf11724-akrAGGCCCGUCACAGAUGACUCPMRD
osa-miRf11726-akrUUUCCCGGUCUGUAACACCAACPMRD
osa-miRf11727-akrGACCGCACGGGAUAAUCGAUUAUCCPMRD
osa-miRf11728-akrACACUGAUGAUCCCCUUAUCGPMRD
osa-miRf11729-akrUGAGGCUGACAUGUGGGUCCGAPMRD
osa-miRf11730-akrUCGGACCCACAUGUCAGCCUCACUCPMRD
osa-miRf11731-akrGGGCCUACAUGUCAGCCUCACPMRD
osa-miRf11732-akrCUCUCUCUCCCUUGAAGGCUAUCUPMRD
osa-miRf11735-akrUUCCCGUGUCCAACGUUUGACUGUCUGUPMRD
osa-miRf11736-akrCCAACAGGGUAGCCUUCCUCPMRD
osa-miRf11737-akrACUCCGUCCCAUAAUGUAGCPMRD
osa-miRf11738-akrAUACUCCCUCCGUCCCAAAAAPMRD
osa-miRf11739-akrGGGGAUUAACUGAACAAGGCUUGAPMRD
osa-miRf11741-akrUCAGUGCCAAACACCUUGGCGCUGAGPMRD
osa-miRf11742-akrAGCUCGAGCUAGCUUGUUAGPMRD
osa-miRf11743-akrAGCGAAAAUGGAUCUUUGCUGGCPMRD
osa-miRf11744-akrGCCAAUGUCCAUGGCGCUGAPMRD
osa-miRf11745-akrCUUAUCUGUGACGGGCAUUAPMRD
osa-miRf11746-akrUGUUACCAAACGGGACUAAAGAUPMRD
osa-miRf11747-akrACCAAACGGGACUAAAGAUCCPMRD
osa-miRf11748-akrUAGUCCCGGUUGGUAACACCAAPMRD
osa-miRf11749-akrUUGGUGUUACCAACCGGGACUAAAGPMRD
osa-miRf11750-akrCAGUCCUUGAGGAGGUACCACGPMRD
osa-miRf11751-akrCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf11752-akrCCGGUUGGUAUUACCAACCGGPMRD
osa-miRf11753-akrUCCCGGUUUUCCAACCGGGAGUAAPMRD
osa-miRf11754-akrAGGUAUCGGUUGAUACCUAGPMRD
osa-miRf11755-akrCUGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf11756-akrCUGGUUGGUAACACCAACCGPMRD
osa-miRf11757-akrUCUUUAGUCCCGGAUGGUGUUACCPMRD
osa-miRf11758-akrGAGCUCGAGCUCGAACGAGCUCGAPMRD
osa-miRf11759-akrGGCACUGAUGCAGCAUCAGUGCCPMRD
osa-miRf11762-akrAAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11763-akrCCGGUUGGUAACAACAACCGGGAPMRD
osa-miRf11765-akrAUGUCGUUGGCGUCAUCCCUUCPMRD
osa-miRf11766-akrGCUCGUUAUCCUAACGAGCCAPMRD
osa-miRf11767-akrGGGAGGAUAGGCUUGGCAUCCAAPMRD
osa-miRf11768-akrUAGGCUCGAUUUGAGCUCGGCUCGPMRD
osa-miRf11769-akrGAACCUCCUGGUAACCCUCUAPMRD
osa-miRf11771-akrUCCCGGUUGAUGUUACCAACCPMRD
osa-miRf11772-akrCCUAGAUCUGGCCGGAGGAGGAPMRD
osa-miRf11773-akrGCCAUUGCCAUGGCCAUGGCCUCGPMRD
osa-miRf11774-akrUUGCCAUUGCCAUGGCCAUGGCPMRD
osa-miRf11775-akrACACCGAAGGUCCCUUAACUUGUPMRD
osa-miRf11776-akrACACCUAAGGUCCCUCAACUUGUPMRD
osa-miRf11777-akrUAAGGGACCUUCGGUGUACUPMRD
osa-miRf11778-akrUGAGGGACCUUAGGUGUACUPMRD
osa-miRf11779-akrCACCGUUAGGGUUCCGUCCAUPMRD
osa-miRf11780-akrCCUCCGUCCAAAAAUAUAGCAACCUPMRD
osa-miRf11781-akrGGACCCACAUGUCAGUGACUCAAUPMRD
osa-miRf11782-akrGAUCUUUAGUUCCGGUUGAUAPMRD
osa-miRf11783-akrUGCCGACUGGUUUCUAGUUGGCGPMRD
osa-miRf11784-akrCUGGUUGGUAUCACCAACCGPMRD
osa-miRf11786-akrGACGGAGUGGUACGGUUCCAAUUPMRD
osa-miRf11791-akrAUCGGAAGCAAUUUGGUACCPMRD
osa-miRf11793-akrCCUCCUCAAGGACCGUAGAAPMRD
osa-miRf11795-akrAUGGUACCUGCUCAAGGACCGUAGAPMRD
osa-miRf11796-akrGGUCCUUGAGGAGGUACCAUGAAGUACPMRD
osa-miRf11798-akrGGUUGGUAACACCAACCGGGAGUPMRD
osa-miRf11800-akrGGUGUUACCAAUCGGGACUAPMRD
osa-miRf11801-akrGGUGUUACCAACCAGGACUAPMRD
osa-miRf11802-akrUAGUCCCGAUUGGUAACACCAACCGGPMRD
osa-miRf11803-akrAAAAAGUCCACUUAGACUCCCUPMRD
osa-miRf11804-akrUCUCGGUUGGUAACACCAACCGGUPMRD
osa-miRf11806-akrCCUGGUUUUCUUGGAGCAUGAGGUUPMRD
osa-miRf11808-akrGUACUCCCUCCGUCCCUAAAUAUAPMRD
osa-miRf11810-akrAUACUUAUCGGUGACGGGCUUUPMRD
osa-miRf11811-akrUCGCAGAUGAGUCAUCCGUGAPMRD
osa-miRf11812-akrGAAGAUCUAUUUUCGCAUGCGGCPMRD
osa-miRf11813-akrAAAGGACCGUAAAAUUGCUCPMRD
osa-miRf11814-akrGGGUCCACAUGUCAGUCACCAPMRD
osa-miRf11815-akrGCUGGCAAUGGCAGAUUGGCAGUPMRD
osa-miRf11816-akrAGUCCCGGUUGGUAACUCCAACCGGGACPMRD
osa-miRf11817-akrGUGCGAGGCAUUUUCGUCUUPMRD
osa-miRf11818-akrCUGGUUGGUGUUACCAACCGAPMRD
osa-miRf11820-akrAUGACUCAUCUCUGACGGGUUPMRD
osa-miRf11821-akrUGCUUUGGCUGAUCAGCUAUUPMRD
osa-miRf11823-akrUGAUCUUUAGUCUCGGUUGGUAPMRD
osa-miRf11824-akrUGAUACCUACCAGGUAUCAUPMRD
osa-miRf11825-akrACCUCGAGGUACCGGUAUCUCACPMRD
osa-miRf11826-akrUAUCUCGAGGUACCGGUAUCUCPMRD
osa-miRf11827-akrAGUCCUGGUUGGUAACACCAACPMRD
osa-miRf11828-akrGUUGGUAACUCCAACCGGGACPMRD
osa-miRf11829-akrACGCGGAGGAGGUGGUGUUCUPMRD
osa-miRf11830-akrACAUGGCGGUGUUGACCUGGPMRD
osa-miRf11831-akrAGGUCAACACCGCCAUGUAGPMRD
osa-miRf11832-akrUCCCGGUUGAUGAUACCAACCGGGAPMRD
osa-miRf11833-akrUUUAGUCCUGGUUGGUAACACCAPMRD
osa-miRf11834-akrUCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf11835-akrAGAGGGCCCACAUGUCAGUGAUPMRD
osa-miRf11836-akrGCCGCCAUUCUAGCUGUUGUUPMRD
osa-miRf11838-akrAGCUAGCUACAGAUCUGUAGCPMRD
osa-miRf11839-akrCGGUCAGACCAGCCUGAGGCGUPMRD
osa-miRf11841-akrCGUGCGCGCGAAAAACGAGGGPMRD
osa-miRf11842-akrUUUCCGUCCGCCUUGAUCGCPMRD
osa-miRf11843-akrUUUCGUCCGCCUUGAUCGCUPMRD
osa-miRf11845-akrGGCUCGUUAUCCUAACGAGCUAGAAPMRD
osa-miRf11848-akrGCGAGAUGUUUCUCCCUUCGPMRD
osa-miRf11851-akrUCCUCCGCCAGCGAAAAUGUPMRD
osa-miRf11853-akrGGUUGGUGACAUCAAUCGGGAPMRD
osa-miRf11855-akrUCGAACAGCAGCCGUUCGACPMRD
osa-miRf11856-akrUUGGUGCCCGUCACCGAUGACPMRD
osa-miRf11858-akrGAAGAUCGCCGAUCUUCGCAGPMRD
osa-miRf11859-akrUUAGGGUUCCGACCAUUCCACPMRD
osa-miRf11860-akrUGAUCUUUAGUCCCGGUUGGUAAPMRD
osa-miRf11861-akrCCGGAGAGAAGACGAUGACAPMRD
osa-miRf11862-akrGCAGAACAUCAGCAUCCUCCAPMRD
osa-miRf11863-akrGUUAUCCCUCACGGCUGGCAUPMRD
osa-miRf11864-akrUGCGCCAUAGUAUAAUGGCUUGGCPMRD
osa-miRf11865-akrGUGGCACGCCCUGGUGUAGAUCCCGPMRD
osa-miRf11866-akrCUUUAGUCCCGGUUGGUGGCPMRD
osa-miRf11867-akrAGGGUAGGCCGGUCAGACCGPMRD
osa-miRf11872-akrACCGCCGGUGUGUCGCCGGUUAGACPMRD
osa-miRf11873-akrUUGGGCCUACAUGUCAGCCUCAUPMRD
osa-miRf11874-akrACCGGCCGUGCAAGGCCGGUCAGAPMRD
osa-miRf11875-akrGGUGUUACGAACCGGGACUAAAGAUPMRD
osa-miRf11877-akrCCGGUCCCAUAUGUCAGCCUPMRD
osa-miRf11878-akrGGUCUCACAUGUCAGCCUCCUUPMRD
osa-miRf11880-akrAGUAGUUAGCUCGAUCGAUCGAUCPMRD
osa-miRf11881-akrACGAGCUUCAAAAGGCGGCGPMRD
osa-miRf11882-akrAGUCCCGGUUGGUAAAACCAACCGGGAPMRD
osa-miRf11884-akrACACGUGGCAGUCCAGUCAGCAUPMRD
osa-miRf11885-akrGUGGCAGUCCAGUCAGCAUAPMRD
osa-miRf11886-akrCAGGUGAGGUUACCUCACCUPMRD
osa-miRf11887-akrCCGACUGGUCUCCAGUUGGCGGCUGPMRD
osa-miRf11888-akrAGAUCAUCUUUAGUCCCGGUUCGPMRD
osa-miRf11890-akrAGGGGAUACCUGUGACGGGCCPMRD
osa-miRf11892-akrGCCGGUCAGACCGACAUUUGGCGCPMRD
osa-miRf11893-akrAUUCAAACAUCCGAUGUGAUAGGGPMRD
osa-miRf11894-akrCCCUAUCACAUCGGAUGUUUGAAPMRD
osa-miRf11895-akrACAAAUCUGUAGCCCGCUUCPMRD
osa-miRf11897-akrCUCCAACCGGGACUAAAGAUPMRD
osa-miRf11899-akrUCAGCGCCAUGGACAUUGGCGPMRD
osa-miRf11900-akrUAGCGCCAAUGUCCAUGGCGCUPMRD
osa-miRf11901-akrAUCUUCACAGGCGGACGGCCGCPMRD
osa-miRf11902-akrAACCGCGACUAAAGAUCCCGGGPMRD
osa-miRf11903-akrGGAUCUUUAGUCGCGGUUGGUGPMRD
osa-miRf11904-akrCGGUUGGUAAAACCAAUCGGGAPMRD
osa-miRf11905-akrCCAACGUUUGACCGUCCGUCPMRD
osa-miRf11907-akrGAGCCCGGUCUGACCGGUCCACAUPMRD
osa-miRf11908-akrUCCCACCCAGAGGUUUUGGCUPMRD
osa-miRf11909-akrUGGUUUCCGCCGGUCUGACCGPMRD
osa-miRf11911-akrUCACCGGUUAGACCGCCGAAACCCAGUPMRD
osa-miRf11912-akrUCACCGGUUAGAUCGCCGAAPMRD
osa-miRf11913-akrUAGUCCCGGUUGAUAACACCAACCGGPMRD
osa-miRf11914-akrCACCAACCGGGACUAAAGAUCCPMRD
osa-miRf11916-akrCGGUUUUCCCAACCAGCACUAUGPMRD
osa-miRf11917-akrGAGCUGCUCGAGCUCGGCUCGUCUCPMRD
osa-miRf11918-akrUCCCGGUUGGUAACACCAACCGGGPMRD
osa-miRf11919-akrGGUUGGUAACACCAACCGGGGACPMRD
osa-miRf11921-akrCCUUGGCAACCGGAGCACUUCUUPMRD
osa-miRf11922-akrCUUCCGACUGGUUUCCAGUCGGUGPMRD
osa-miRf11923-akrCUUCCGACUGGUUUCCAGUCPMRD
osa-miRf11924-akrGGCUGGCCUAUUAUGCCGCCGUUGPMRD
osa-miRf11927-akrUCCCAGUUGGUAACACCAACCGGPMRD
osa-miRf11928-akrGAGCCCGGUCUGACCGGUCUACAUPMRD
osa-miRf11930-akrCGUCCGCCUGCGAAGAUUAUPMRD
osa-miRf11931-akrGGAUCGAUUUUCGCAGGCGGPMRD
osa-miRf11932-akrGACGCCCGAUAUUCGUCCACPMRD
osa-miRf11933-akrGCAUGAUACCUCAUAGGUAUCAPMRD
osa-miRf11936-akrAAAACGUGCGUGCGGAAAACGAPMRD
osa-miRf11937-akrCGUGCGUGCGGAAAACGAGGGAPMRD
osa-miRf11938-akrAACUUCGGCGACCUCUUCUUPMRD
osa-miRf11939-akrCGGAACCUUGUGUGGGUUGGPMRD
osa-miRf11940-akrUGGAGCUGGAGCUGUGCCAAACGGPMRD
osa-miRf11941-akrGUGCCGGUUGGGAAAUCCGACACCPMRD
osa-miRf11943-akrACGAGCGUCUUAAGGAGCCGPMRD
osa-miRf11944-akrUAGUCCCGGUUGUUCAACCGGPMRD
osa-miRf11946-akrCCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11947-akrGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11949-akrUAGUACUAGGACGUGUCACAUCCCPMRD
osa-miRf11950-akrACACUCAUCUAUGACGGGCUPMRD
osa-miRf11951-akrUCCGUGUCUAACGUUUGACCGUCCPMRD
osa-miRf11952-akrUUACUCCCUCCGUCCCAAUAUAUAPMRD
osa-miRf11953-akrUAGUACUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf11954-akrUUUAGUACUCCCUCCGUCCCAAPMRD
osa-miRf11955-akrCUUUCUAGCAUUGCCCACAUPMRD
osa-miRf11957-akrUGAACCGGGACUAAAGAUCUCGGGPMRD
osa-miRf11961-akrCGGUUGGUGUUACUAACCGGGACUAPMRD
osa-miRf11962-akrGGGUUACGAACCGGGACUAAAPMRD
osa-miRf11963-akrUUAGUCCCGGAUUCGUAGUCCCPMRD
osa-miRf11964-akrUCCCGAUUGGUAAGACCAACCGPMRD
osa-miRf11967-akrACCAGCGAGUAGAAUUAUCUCUCPMRD
osa-miRf11969-akrGAGGAGCUCGAGCUUGGCUUGUCPMRD
osa-miRf11970-akrUCCCGGUUGGUAACUCCAACCPMRD
osa-miRf11971-akrCACUACCAACCGGGACUAAAGPMRD
osa-miRf11972-akrAUUUGGUACCGUGAGGUACCAPMRD
osa-miRf11975-akrCCGGUUGGUGUCACCAACCGGGACUAPMRD
osa-miRf11976-akrUUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf11979-akrAGUUAAUGCCCGUCACAGAUPMRD
osa-miRf11980-akrUCUCAACAACCGGGACUAAAGPMRD
osa-miRf11982-akrCGGAUUGAGAUCAGGUGCAGUPMRD
osa-miRf11983-akrAUCCGGUCAAACGUCCGAUGUGACPMRD
osa-miRf11984-akrGGUGUCACAUUGAACGUUUGAPMRD
osa-miRf11985-akrUGCGGCGCAACUGCUCCGUUUCPMRD
osa-miRf11987-akrCCGGUUGAUAACAUUAACCGGPMRD
osa-miRf11988-akrUAGUCCCGGUUGGUAAAACCAACCGGPMRD
osa-miRf11990-akrCGCGAGACAAAUCUAUUGAGCCPMRD
osa-miRf11991-akrAGUACCGUGAGGUACCGGUACCPMRD
osa-miRf11992-akrGAAACGAUUUGGUACCGUGCPMRD
osa-miRf11993-akrAUCCAACGAUCGGAAACGAUUPMRD
osa-miRf11994-akrUUGCUUGCAACGUUUGACCAPMRD
osa-miRf11995-akrUACCCGUGAUACCUGAUACCUAGPMRD
osa-miRf11996-akrGUCUUAUAACCUGAAACGGGGGPMRD
osa-miRf11997-akrAAGUGGUCCGCCUGCGAAAAUAGPMRD
osa-miRf11998-akrUGGUCCGCUUGCGAAAAUAGAPMRD
osa-miRf11999-akrCUAUUUUCGCAGGCGGACCACUUPMRD
osa-miRf12000-akrUCUAUUUUCGCAGGCGGACCPMRD
osa-miRf12001-akrUGUUUGGCUGAGCUCCAGCUPMRD
osa-miRf12002-akrGCCUCCAUCGCCAUCGCCAUPMRD
osa-miRf12003-akrUGGGACCUAUGUGGACCCCACAUGUPMRD
osa-miRf12004-akrUCCUGACAUGUGGGGCCCACGUGGGUCCPMRD
osa-miRf12005-akrCCUAUGUGGACCCCACAUGUUAGUAPMRD
osa-miRf12006-akrCCCCACAUGUUAGUAUGCCACPMRD
osa-miRf12007-akrCGGCGGCGAUGAUCGUCUCCGUCAPMRD
osa-miRf12010-akrUCGCCGUCAACUGCGAGGUCGPMRD
osa-miRf12011-akrGGUUGGUAAAACCAACCGGGAGUPMRD
osa-miRf12012-akrUCCUGGUUGGUAACACCAACCGGPMRD
osa-miRf12013-akrCCGGUUGGUUUUACCAACCGGGAPMRD
osa-miRf12014-akrAUGUAAGUCAUUCUAGCAUUCCCCPMRD
osa-miRf12015-akrAAGUCAUUCUAGCAUUCCCCACAUUCPMRD
osa-miRf12016-akrUAAGUCAUUCUAGCAUUCCCCPMRD
osa-miRf12017-akrAGGCCUGGUCGGAGAUGAACPMRD
osa-miRf12019-akrUCCCGGUUGGUAACACCAACCPMRD
osa-miRf12021-akrUCAGAGACACAUACUGCAUGUPMRD
osa-miRf12022-akrGCUCGAGCUUGAUCGAGCUCCPMRD
osa-miRf12023-akrAAAAAACUCAACCUAGGAGGGGPMRD
osa-miRf12024-akrCUUCUCUGACGUAAAGUCAGAGGPMRD
osa-miRf12027-akrUCCCGGUUGGUAACACGAACCGGPMRD
osa-miRf12028-akrCUUUAGUCCCGGUUGGUAACACPMRD
osa-miRf12029-akrAUGUUGGCCGCCGCCGCUGCCAUPMRD
osa-miRf12030-akrCCCACCAAUCGUCAUCAUCGPMRD
osa-miRf12031-akrGUUAGAAGCUCCCCCAAACGGAUCPMRD
osa-miRf12032-akrAGUUAGAAGCUCCCCCAAACGPMRD
osa-miRf12033-akrAGAUCCUGGCACCACCUGGUPMRD
osa-miRf12034-akrCUCAAGAGAUUCAUCUCGCGPMRD
osa-miRf12035-akrUGAACUACUCCCUCCGUCCCAUAAPMRD
osa-miRf12036-akrUCCUAGGACAACGAAUCUGGACAUPMRD
osa-miRf12037-akrCUGUUUAGGGGAGCUUCUGGCAPMRD
osa-miRf12038-akrCAGCUGCUAGAAGCUCCCUCAAACAGPMRD
osa-miRf12039-akrAGGUACUCCCUCCGUCCCAUAAUAUAAGPMRD
osa-miRf12040-akrACUCCCUCCGUCCCAUAAUAUAAGPMRD
osa-miRf12042-akrGGUUGGUAGUACUAACCGAGAGUPMRD
osa-miRf12043-akrCAGUGCCACGCUAUUUGGCGPMRD
osa-miRf12044-akrUCCUCGACACACUCGUCGACPMRD
osa-miRf12046-akrGGGUGUAAGUGGCUAACCCGPMRD
osa-miRf12047-akrCCUCCUCAAGGACCGUAAAAPMRD
osa-miRf12050-akrAUCUUCGCAGACGGACGGCCGCPMRD
osa-miRf12051-akrGGUUUCGCGGGUUAGCCACUUACACPMRD
osa-miRf12052-akrUGGGUUUCGCGGGUUAGCCAPMRD
osa-miRf12053-akrCAUGCCAAAUUUUGGUAAGGCCPMRD
osa-miRf12054-akrGGCCUCUUAAGUAGCCGUAUPMRD
osa-miRf12055-akrCCGGUUGGUAACACCAACCGGUPMRD
osa-miRf12056-akrGCUGACAUGUGGGCCCGAGUGGUPMRD
osa-miRf12057-akrUAAGGCUGACAUGUGGGCCCGAPMRD
osa-miRf12058-akrACCCGGGCCCACAUGUCAGCCUCACPMRD
osa-miRf12059-akrAUUACCAACCGGGACUAAAGCUUPMRD
osa-miRf12060-akrGGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf12062-akrUAGUCCCGGUUGGACAACCGGGAPMRD
osa-miRf12063-akrGGUUGGAGAUAUCAACCGGGAPMRD
osa-miRf12064-akrGAUCUUUAGUCCUGGUUGGUAACAPMRD
osa-miRf12065-akrCGAUCUUUAGUCCUGGUUGGUPMRD
osa-miRf12066-akrUCUUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf12068-akrGCCACUUAAGCAGCCGUAUGPMRD
osa-miRf12069-akrGUUGGUAGUAUCAACCGGGAPMRD
osa-miRf12070-akrCGGUUGGUAGUACCAACCGGPMRD
osa-miRf12073-akrGCCGGUCAGACUGCCUCUGGUCACCPMRD
osa-miRf12078-akrACCUCUUAGCAUGGCUGCUAGCPMRD
osa-miRf12080-akrAGAUCGAUCUUCGCAAGCGGCPMRD
osa-miRf12081-akrCCUCAGCACCAGCGCUUGUGPMRD
osa-miRf12085-akrACUUUAGUCCCGGUUGGUGUPMRD
osa-miRf12087-akrCCUGGGUCCACAUGUCAGCCUCUPMRD
osa-miRf12088-akrGGUCCACAUGUCAGCCUCUUUUCPMRD
osa-miRf12089-akrCUCAAAAGAUUCGUCUCGCGPMRD
osa-miRf12090-akrUCUAGUCACCUGUGACGGGUCUAPMRD
osa-miRf12091-akrAACCCGUCACAGAUGAUCAUPMRD
osa-miRf12092-akrUAGUCCCGGUUUUCCAACCGGGAPMRD
osa-miRf12093-akrGUUGGUGUUACCAACCGGGAUUAPMRD
osa-miRf12095-akrGGUUGGUAACACCAAUCGGGPMRD
osa-miRf12097-akrCCGGUUGGUGUUACCAACCAGGAPMRD
osa-miRf12098-akrUCCUGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf12099-akrCUCUCUCGUUUUCCACGCGCACGPMRD
osa-miRf12100-akrGUGCGCGCGGAAAAUGAGAGAGGUGPMRD
osa-miRf12102-akrCCCGGUUGGUAGUACCAACCGUGAPMRD
osa-miRf12103-akrCUUGCUGGUUCUCGAACCAGUGPMRD
NolmiR-23UGGUUUGGUCUGGGAUGGAGUAJian Yang et al. (2014)
NolmiR-36UUUGCAUGACCCGGGAGAUGAJian Yang et al. (2014)
NolmiR-50AUGAACGGAACCCUAACGGCGJian Yang et al. (2014)
NolmiR-53UUGGGAGGUGGUGAGUACUAAGJian Yang et al. (2014)
NolmiR-56AGCUUUUGGGGUGUAGUAAGGCUUJian Yang et al. (2014)
NolmiR-58AUUUUAUGGUCUGUAAGAAGGUAUJian Yang et al. (2014)
NolmiR-62AGAAUGAUUUAUAUUGUAAAACGGJian Yang et al. (2014)
NolmiR-63AGAAUCUGUACUAAAAGAUGGACUJian Yang et al. (2014)
NolmiR-74UGGAUUUAUUUUAGGACAGAUGGAJian Yang et al. (2014)
NolmiR-86AGUGUACUCAGUUCAGAAUGGUAUJian Yang et al. (2014)
NolmiR-95ACAACAAAACUAGAAAAUAUGCGUJian Yang et al. (2014)
NolmiR-101AGUGGGAUUUUUGUUCAAAAUGGCJian Yang et al. (2014)
NolmiR-105AACCUUUAGCUAUGCAUCUGGACAJian Yang et al. (2014)
NolmiR-112GGGACUUAUACUUUUGUAAGAGGGJian Yang et al. (2014)
NolmiR-142GAGAACUUUCGAUGGCAUGGAACCJian Yang et al. (2014)
NolmiR-150GGAACCGGGACUGUGGAUUUCGGCJian Yang et al. (2014)
NolmiR-162AGAGAAACUGUAGCAGUCAGAAGCJian Yang et al. (2014)
NolmiR-185ACAGAAAAUGUCAACUCAAGCJian Yang et al. (2014)
NolmiR-230AGAGAAACUGUAGCUGCUAGAAGCJian Yang et al. (2014)
NolmiR-349AGAAAUUCGGUUAUCUGUUCGGUCJian Yang et al. (2014)
NolmiR-432AAUGACUGGUUAGAAAAGAUGGAGJian Yang et al. (2014)

283 NR maize miRNA IDsmiRNA_sequencedatabasename
zma-miR529-5pAGAAGAGAGAGAGUACAGCCUmiRBase.V20
zma-miR168b-3pCCCGCCUUGCAUCAAGUGAAmiRBase.V20
zma-miR167h-3pGAUCAUGUUGCAGCUUCACmiRBase.V20
zma-miR168a-3pCCCGCCUUGCACCAAGUGAAmiRBase.V20
zma-miR827-5pUUUGUUGGUGGUCAUUUAACCmiRBase.V20
zma-miR156l-3pGCUCACUGCUCUAUCUGUCACCmiRBase.V20
zma-miR396b-3pGUUCAAUAAAGCUGUGGGAAAmiRBase.V20
zma-miR319b-5pAGAGCGUCCUUCAGUCCACUCmiRBase.V20
zma-miR159a-5pGAGCUCCUAUCAUUCCAAUGAmiRBase.V20
zma-miR408b-5pCAGGGACGAGGCAGAGCAUGGmiRBase.V20
zma-miR169i-3pGGCAGUCUCCUUGGCUAGmiRBase.V20
zma-miR2275b-5pAGGAUUAGAGGCAACUGAACCmiRBase.V20
zma-miR156b-3pGCUCACCCUCUAUCUGUCAGUmiRBase.V20
zma-miR159h-3pUUUGGAGUGAAGGGAGCUCUGmiRBase.V20
zma-miR2275a-5pAGAGUUGGAGGAAAGCAAACCmiRBase.V20
zma-miR171b-3pUUGAGCCGUGCCAAUAUCACmiRBase.V20
zma-miR167g-3pGGUCAUGCUGUAGUUUCAUCmiRBase.V20
zma-miR167c-3pGAUCAUGCUGUGGCAGCCUCACUmiRBase.V20
zma-miR156a-3pGCUCACUUCUCUCUCUGUCAGUmiRBase.V20
zma-miR156k-3pGCUCGCUUCUCUUUCUGUCAGCmiRBase.V20
zma-miR166n-5pGGAUUGUUGUCUGGCUCGGUGmiRBase.V20
zma-miR168cUCGCUUGUUGCAGAUCGGGACPMRD
zma-miR156rUGACAGAAGAGAGUGGGCACPMRD
zma-miR167j-3pGAUCAUGUGGCAGUUUCAUUmiRBase.V20
zma-miR398b-5pGGGGCGGACUGGGAACACAUGmiRBase.V20
zma-miR164c-3pCAUGUGCCCUUCUUCUCCAUCmiRBase.V20
zma-miR171k-5pUGGUAUUGUUUCGGCUCAUGUmiRBase.V20
zma-miR319a-5pGAGCUCUCUUCAGUCCACUCmiRBase.V20
zma-miR166g-5pGGAAUGUUGUCUGGUUGGAGAmiRBase.V20
zma-miR528a-3pCCUGUGCCUGCCUCUUCCAUUmiRBase.V20
zma-miR164b-3pAUGUGCCCAUCUUCUCCACCmiRBase.V20
zma-miR166uUCGGACCACGCUUCAUUCCCCPMRD
zma-miR156e-3pGCUCACUGCUCUCUCUGUCAUCmiRBase.V20
zma-miR156i-3pGCUCACUGCUCUAUCUGUCAUCmiRBase.V20
zma-miR2118gUUCCUGAUGCCUCCUAUUCCUAmiRBase.V20
zma-miR529-3pGCUGUACCCUCUCUCUUCUUCmiRBase.V20
zma-miR166j-5pGGUUUGUUUGUCUGGUUCAAGGmiRBase.V20
zma-miR397a-5pUCAUUGAGCGCAGCGUUGAUGmiRBase.V20
zma-miR2275b-3pUUCAGUUUCCUCUAAUAUCUCAmiRBase.V20
zma-miR169l-5pUAGCCAGGGAUGAUUUGCCUGmiRBase.V20
zma-miR390a-3pCGCUAUCUAUCCUGAGCUCCAmiRBase.V20
zma-miR156h-3pGCUCACUGCUCUUUCUGUCAUCmiRBase.V20
zma-miR167d-3pGGUCAUGCUGCUGCAGCCUCACUmiRBase.V20
zma-miR171i-5pUGUUGGCACGGUUCAAUCAAAmiRBase.V20
zma-miR2275a-3pUUUGUUUUCCUCCAAUAUCUCAmiRBase.V20
zma-miR159f-5pGAGCUCCUCUCAUUCCAAUGAmiRBase.V20
zma-miR398aUGUGUUCUCAGUUCGCCCCCGPMRD
zma-miR164g-3pCACGUGCUCCCCUUCUCCACCmiRBase.V20
zma-miR398a-5pGGGGCGAACUGAGAACACAUGmiRBase.V20
zma-miR169c-3pGGCAAGUCUGUCCUUGGCUACAmiRBase.V20
zma-miR166k-5pGGAUUGUUGUCUGGCUCGGGGmiRBase.V20
zma-miR399b-5pGUGCAGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR160a-3pGCGUGCAAGGGGCCAAGCAUGmiRBase.V20
zma-miR169m-3pGGCAUCCAUUCUUGGCUAAGmiRBase.V20
zma-miR172c-5pCAGCACCACCAAGAUUCACAmiRBase.V20
zma-miR171a-3pUGAUUGAGCCGCGCCAAUAUmiRBase.V20
zma-miR164d-3pCACGUGGUCUCCUUCUCCAUmiRBase.V20
zma-miR394a-3pAGGUGGGCAUACUGCCAAUGmiRBase.V20
zma-miR167f-3pGAUCGUGCUGCGCAGUUUCACCmiRBase.V20
zma-miR399d-5pGUGUGGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR172d-5pCAGCACCAUCAAGAUUCACAmiRBase.V20
zma-miR399f-5pGGGCAACUUCUCCUUUGGCAGAmiRBase.V20
zma-miR167b-3pGAUCAUGCUGUGACAGUUUCACUmiRBase.V20
zma-miR166i-5pGGAAUGUCGUCUGGCGCGAGAmiRBase.V20
zma-miR399b-3pUGCCAAAGGAGAGCUGUCCUGmiRBase.V20
zma-miR171c-3pUGACUGAGCCGUGCCAAUAUCmiRBase.V20
zma-miR171b-5pGAUAUUGGCGCGGUUCAAUCmiRBase.V20
zma-miR164a-3pCACGUGUUCUCCUUCUCCAUCmiRBase.V20
zma-miR396g-5pUCCCACAGCUUUAUUGAACUGmiRBase.V20
zma-miR397b-3pCCAGCGCUGCACUCAAUUACGmiRBase.V20
zma-miR395e-5pGUUCCCUUCAAGCACUUCACAUmiRBase.V20
zma-miR162-5pGGGCGCAGUGGUUUAUCGAUCmiRBase.V20
zma-miR399e-5pGGGCUUCUCUUUCUUGGCAGGmiRBase.V20
zma-miR399c-5pGGGUACGUCUCCUUUGGCACAmiRBase.V20
zma-miR393a-3pAUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
zma-miR393aUCCAAAGGGAUCGCAUUGAUCPMRD
zma-miR437cUCAAAGUUAGAGAAGUUUGACPMRD
zma-miR393c-3pGUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
zma-miR393dUCCAAAGGGAUUGCACUGAUCPMRD
zma-miR160c-3pGCGUGCAUGGUGCCAAGCAUAmiRBase.V20
zma-miR160d-3pGCGUGCGUGGAGCCAAGCAUGmiRBase.V20
zma-miR2118eUUCCUGAUGUCUCCCAUUCCUAmiRBase.V20
zma-miR169a-3pGGCAAGUUGUUCUUGGCUACAmiRBase.V20
zma-miR169n-3pGGCAGGCCUUCUUGGCUAAGmiRBase.V20
zma-miR437gAAAGUUAGAGAAGUUUGACUCPMRD
zma-miR395n-5pGUUCUCUACAAGCACUUCACGAmiRBase.V20
zma-miR396g-3pGUUCAAGAAAGCUGUGGAAGAmiRBase.V20
zma-miR167uUGAAGCUGCCACAUGAUCUGPMRD
zma-miR399a-5pGUGCGGUUCUCCUCUGGCACGmiRBase.V20
zma-miR395o-5pGUUCUCUUCAAGCACUUCACGAmiRBase.V20
zma-miR171a-5pUAUUGGCGAGGUUCAAUCAGAmiRBase.V20
zma-miR395a-5pGUUCUCCUCAAACCACUUCAGUUmiRBase.V20
zma-miR396e-3pGGUCAAGAAAGCCGUGGGAAGmiRBase.V20
zma-miR2275c-5pAGGAUUAGAGGGACUUGAACCmiRBase.V20
zma-miR167a-3pGAUCAUGCAUGACAGCCUCAUUmiRBase.V20
zma-miR166h-5pGGAAUGACGUCCGGUCCGAACmiRBase.V20
zma-miR395b-5pGUUCCCUACAAGCACUUCACAAmiRBase.V20
zma-miR169r-3pGGCAAGUUGUCCUUGGCUACAmiRBase.V20
zma-miR395dGUGAAGUGUUUGGAGGAACUPMRD
zma-miR159b-5pGUGCUCCCUUCAAACCAAUAAmiRBase.V20
zma-miR395o-3pGUGAAGUGUUUGGGUGAACUCmiRBase.V20
zma-miR399h-5pGUGCAGUUCUCCUCUGGCACGmiRBase.V20
zma-miR159g-5pGUGCUCCCUUCACACCAAUAAmiRBase.V20
zma-miR169l-3pGGCAAAUCAUCCCUGCUACCmiRBase.V20
zma-miR159c-5pGAGCUCCCUUCGAUCCAAUCCmiRBase.V20
zma-miR171c-5pUAUUGGUGCGGUUCAAUCAGAmiRBase.V20
zma-miR2118fUUCCCAAUGCCUUCCAUGCCUAmiRBase.V20
zma-miR159g-3pUUUGGAGUGAAGGGAGUUCUGmiRBase.V20
zma-miR393b-3pAUCAAUGCGAUCCUUUUGGAGGmiRBase.V20
zma-miR171g-5pUAUUGACUUGGCUCAUCUCUCmiRBase.V20
zma-miR164e-3pCAUGUGUCCGCCCUCUCCACCmiRBase.V20
zma-miR171m-5pUAUUGGCGCGCCUCAAUCCGAmiRBase.V20
zma-miR171mGAUGUUGGCAUGGCUCAAUCAPMRD
zma-miR169o-3pGGCAGGUCUUCUUGGCUAGCmiRBase.V20
zma-miR169q-3pGGCAGGCCUUCUGGCUAAGmiRBase.V20
zma-miR399j-5pAGGCAGCUCUCCUCUGGCAGGmiRBase.V20
zma-miR169f-3pGGCAUGUCUUCCUUGGCUACUmiRBase.V20
zma-miR169p-3pGGCAAGUCAUCUGGGGCUACGmiRBase.V20
zma-miR395k-5pGUUUCCUUCAAGCACUUCACAUmiRBase.V20
zma-miR399i-5pGUGCGGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR437eGAAGUUAAAGAAGUUUGACUUPMRD
zma-miR166l-5pGAAUGGAGGCUGGUCCAAGAmiRBase.V20
zma-miR2275d-5pAGAGUUGGAGGAAAGAAAACUmiRBase.V20
zma-miR164f-3pCACGUGCGCUCCUUCUCCAACmiRBase.V20
zma-miR164h-5pUGGAGAAGCAGGGCACGUGUGmiRBase.V20
zma-miR171l-5pUAUUGGCGUGCCUCAAUCCGAmiRBase.V20
zma-miR395i-5pGUUCCCUACAAGCACUUCACGAmiRBase.V20
zma-miR395l-5pGUUCCUUCCAAACACUUCACCAmiRBase.V20
zma-miR399g-5pGGGCAACCCCCCGUUGGCAGGmiRBase.V20
zma-miR1432-3pGGGUGUCAUCUCGCCUGAAGCAmiRBase.V20
zma-miR437dUAAGUUAGAGAAGUUUGACUUPMRD
zma-miR171j-5pUAUUGACGCGGUUCAAUUCGAmiRBase.V20
zma-miR395f-5pGUUACCUACAAGCACGUCUCGAmiRBase.V20
zma-miR395k-3pGUGAAGUGUUUGAGGAAACUCmiRBase.V20
zma-miR395m-5pGUUCCUUUCAAACACUUCACAUmiRBase.V20
zma-miR158UCCUAAAUGUAGACAAAGCAPMRD
zma-miR407CCUAAAUCAUAUACUUUUGGAPMRD
zma-miR414UCAUCCUCAUCAUCGUCGUCCPMRD
zma-miR156d-5pUGACAGAAGAGAGUGAGCACmiRBase.V20
zma-miR156d-3pGCUCACUUCUCUUUCUGUCAGCmiRBase.V20
zma-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase.V20
zma-miR160b-3pGCGUGCAAGGAGCCAAGCAUGmiRBase.V20
zma-miR164a-5pUGGAGAAGCAGGGCACGUGCAmiRBase.V20
zma-miR169a-5pCAGCCAAGGAUGACUUGCCGAmiRBase.V20
zma-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
zma-miR166a-5pGGAAUGUUGUCUGGCUCGGGGmiRBase.V20
zma-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase.V20
zma-miR162-3pUCGAUAAACCUCUGCAUCCAmiRBase.V20
zma-miR166h-3pUCGGACCAGGCUUCAUUCCCmiRBase.V20
zma-miR166b-5pGGAAUGUUGUCUGGUUCAAGGmiRBase.V20
zma-miR166c-5pGGAAUGUUGUCUGGCUCGAGGmiRBase.V20
zma-miR172aAGAAUCUUGAUGAUGCUGCAmiRBase.V20
zma-miR171d-5pUGUUGGCUCGGCUCACUCAGAmiRBase.V20
zma-miR171d-3pUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
zma-miR171f-5pCGAUGUUGGCAUGGCUCAAUCmiRBase.V20
zma-miR171f-3pUUGAGCCGUGCCAAUAUCACAmiRBase.V20
zma-miR394a-5pUUGGCAUUCUGUCCACCUCCmiRBase.V20
zma-miR395b-3pGUGAAGUGUUUGGGGGAACUCmiRBase.V20
zma-miR395c-5pGUUCCCUGCAAACACUUCACCAmiRBase.V20
zma-miR395c-3pGUGAAGUGUUUGGAGGAACUCmiRBase.V20
zma-miR396b-5pUUCCACAGCUUUCUUGAACUGmiRBase.V20
zma-miR399a-3pUGCCAAAGGAGAAUUGCCCUGmiRBase.V20
zma-miR399d-3pUGCCAAAGGAGAGCUGCCCUGmiRBase.V20
zma-miR399e-3pUGCCAAAGGAGAGUUGCCCUGmiRBase.V20
zma-miR399f-3pUGCCAAAGGAAAUUUGCCCCGmiRBase.V20
zma-miR156j-5pUGACAGAAGAGAGAGAGCACAmiRBase.V20
zma-miR156j-3pUGCUCUCUGCUCUCACUGUCAUCmiRBase.V20
zma-miR159a-3pUUUGGAUUGAAGGGAGCUCUGmiRBase.V20
zma-miR159c-3pCUUGGAUUGAAGGGAGCUCCUmiRBase.V20
zma-miR319a-3pUUGGACUGAAGGGUGCUCCCmiRBase.V20
zma-miR166k-3pUCGGACCAGGCUUCAAUCCCUmiRBase.V20
zma-miR167e-5pUGAAGCUGCCAGCAUGAUCUGmiRBase.V20
zma-miR167e-3pGAUCAUGCUGUGCAGUUUCAUCmiRBase.V20
zma-miR168a-5pUCGCUUGGUGCAGAUCGGGACmiRBase.V20
zma-miR169c-5pCAGCCAAGGAUGACUUGCCGGmiRBase.V20
zma-miR169f-5pUAGCCAAGGAUGACUUGCCUAmiRBase.V20
zma-miR169i-5pUAGCCAAGGAUGACUUGCCUGmiRBase.V20
zma-miR169dUAGCCAAGGAGACUGCCUAUGmiRBase.V20
zma-miR169eUAGCCAAGGAGACUGCCUACGmiRBase.V20
zma-miR171g-3pGAGGUGAGCCGAGCCAAUAUCmiRBase.V20
zma-miR172eGGAAUCUUGAUGAUGCUGCAUmiRBase.V20
zma-miR166l-3pUCGGACCAGGCUUCAUUCCUCmiRBase.V20
zma-miR166m-5pGGAAUGUUGGCUGGCUCGAGGmiRBase.V20
zma-miR171k-3pGUGAGCCGAACCAAUAUCACUmiRBase.V20
zma-miR393a-5pUCCAAAGGGAUCGCAUUGAUCUmiRBase.V20
zma-miR408aCUGCACUGCCUCUUCCCUGGCmiRBase.V20
zma-miR156k-5pUGACAGAAGAGAGCGAGCACmiRBase.V20
zma-miR160f-5pUGCCUGGCUCCCUGUAUGCCGmiRBase.V20
zma-miR160f-3pGCGUGCGAGGUGCCAGGCAUGmiRBase.V20
zma-miR396cUUCCACAGGCUUUCUUGAACUGmiRBase.V20
zma-miR2118aUUCCUGAUGCCUCUCAUUCCUAmiRBase.V20
zma-miR2118bUUCCCGAUGCCUCCCAUUCCUAmiRBase.V20
zma-miR2118cUUCCUAAUGCCUCCCAUUCCUAmiRBase.V20
zma-miR2118dUUCCUGAUGCCUCCCAUGCCUAmiRBase.V20
zma-miR2275d-3pUUUGUUUUCCUCUAAUAUCUCAmiRBase.V20
zma-miR159e-5pCAGCUCCUGCAGCAUCUGUUCmiRBase.V20
zma-miR159e-3pAUUGGUUUGAAGGGAGCUCCAmiRBase.V20
zma-miR164e-5pUGGAGAAGCAGGACACGUGAGmiRBase.V20
zma-miR164f-5pUGGAGAAGCAGGGCACGUGCUmiRBase.V20
zma-miR169m-5pUAGCCAAGAAUGGCUUGCCUAmiRBase.V20
zma-miR169o-5pUAGCCAAGAAUGACUUGCCUAmiRBase.V20
zma-miR169p-5pUAGCCAAGGAUGACUUGCCGGmiRBase.V20
zma-miR171l-3pGGAUUGAGCCGCGUCAAUAUCmiRBase.V20
zma-miR171n-5pUAUUGGUGAGGUUCAAUCCGAmiRBase.V20
zma-miR171n-3pUGAUUGAGCCGCGCCAAUAUCmiRBase.V20
zma-miR390a-5pAAGCUCAGGAGGGAUAGCGCCmiRBase.V20
zma-miR393b-5pUCCAAAGGGAUCGCAUUGAUCCmiRBase.V20
zma-miR395d-5pGUUCUAUGCAAGCACUUCACGAmiRBase.V20
zma-miR396e-5pUUCCACAGCUUUCUUGAACUUmiRBase.V20
zma-miR396f-3pGGUCAAGAAAGCUGUGGGAAGmiRBase.V20
zma-miR397a-3pUAGCCGUUAGCGCUCAUUAACUmiRBase.V20
zma-miR398a-3pUGUGUUCUCAGGUCGCCCCCGmiRBase.V20
zma-miR399g-3pUGCCAAAGGGGAUUUGCCCGGmiRBase.V20
zma-miR482-5pUGGGAGAUGAAGGAGCCUUmiRBase.V20
zma-miR482-3pUCUUCCUUGUUCCUCCCAUUmiRBase.V20
zma-miR528a-5pUGGAAGGGGCAUGCAGAGGAGmiRBase.V20
zma-miR827-3pUUAGAUGACCAUCAGCAAACAmiRBase.V20
zma-miR1432-5pCUCAGGAGAGAUGACACCGACmiRBase.V20
zma-miR444aUGCAGUUGUUGUCUCAAGCUUmiRBase.V20
zma-miR156pUGACAGAAGAGAGAGAGCACPMRD
zma-miR157mUUGACAGAAGAGAGAGAGCACPMRD
zma-miR162bUCGAUAAACCUCUGCAUCCAGPMRD
zma-miR170nUGAUUGAGCCACGUCAAUAUCPMRD
zma-miR172mAGAAUCCUGAUGAUGCUGCAGPMRD
zma-miR172nAGAAUCCUGAUGAUGCUGCAUPMRD
zma-miR173AGCGCUUGCAGAGUGAAAUCAPMRD
zma-miR319mUUGGAUUGAAGGGAGCUCCUPMRD
zma-miR396dUCCACAGGCUUUCUUGAACUGPMRD
zma-miR413AUAGUUUCUCUUGUUUUGCACPMRD
zma-miR437aAAAGUUAGAGAAGUUUGACUUPMRD
zma-miR437fGAAGUCAGAGAAGUUUGACUUPMRD
zma-miR444bUUGCUGCCUCAAGCUUCCUGCPMRD
zma-miR447AGGGAUGAGAUGUUUUGUUGGPMRD
zma-miR-n1AACGGUGCUGUGUUAGGGGGGUUD Ding et al (2013)
zma-miR-n2aCGGAGGGGAUUGGAGAGGCUAD Ding et al (2013)
zma-miR-n2gGGAGGGGAUUGGAGAGGCUAAD Ding et al (2013)
zma-miR-n3aUAUAUAAGUUGGAUUAUGGUAD Ding et al (2013)
zma-miR-n4aUCGCGUCUUUCGCGGUCGGGCD Ding et al (2013)
zma-miR-n5UCGCUAGAUCGUUGAGGGAUUD Ding et al (2013)
zma-miR-n6UGAAAGGCGGAUGGCUCUCUAD Ding et al (2013)
zma-miR-n7UUAGAUUAUAGUAGAAGAGUAD Ding et al (2013)
zma-miR-n8UUAGGCUCGGGGACUACGGUGD Ding et al (2013)
zma-miR-n9aUUUCAAAGUUCGUGGACCUAAD Ding et al (2013)
osa-miR530-3pGTTGCATCTGCCTCTGCACCTFangli Wu et al (2014)
osa-miR811aACGTCCATTTCTCGATCTAACGGTFangli Wu et al (2014)
ath-miR829_1ATTCCATCATTTGGTATCAGAGCTFangli Wu et al (2014)
ath-miR845aCATCAATTGGTATCAGAGCCGFangli Wu et al (2014)
zmiRs1aGGUGAACCACCGGACAUCGCACHongjun Liu et al (2014)
zma-miRs2UUUGACCAAGUUUGUAGAAAAHongjun Liu et al (2014)
zma-miRs3UAUACACUGUGGUUGUGGAUGHongjun Liu et al (2014)
zma-miRs4UAGCCAAGCAUGAUUUGCCCGUHongjun Liu et al (2014)
zma-miRs5UGAUGCCAUUCAUUAAUCUCHongjun Liu et al (2014)
zma-miRs6aUGGGUCAAGAAAGUAGAUGAAGHongjun Liu et al (2014)
zma-miRs7UUGGAGGGGAUUGAGGGGGCUAHongjun Liu et al (2014)
zma-miRs8UUGGAUUGGUUUAGAGUGGUUHongjun Liu et al (2014)
zma-miRs9UUAGGCUCGGGGACUAUGGUGHongjun Liu et al (2014)
zma-miRs10AUCGGCUGAUCGUUUGGCCUGHongjun Liu et al (2014)
zma-miRs11CGUGGAACUUCUUCGGCGUAGHongjun Liu et al (2014)
zma-miRs12UGGCUGUGAUGACAAAAAGGUHongjun Liu et al (2014)
zma-miRs13UGAGUUUAGGGACUGGGAUGGHongjun Liu et al (2014)
zma-miRs14UGAAACUGUCACAGCAUGAUCHongjun Liu et al (2014)
zma-miRs15UGUUCGGUUGCUCAGGAACGGUHongjun Liu et al (2014)
zma-miRs16UUGCCAGGAGGAGGAUGGAGCHongjun Liu et al (2014)
zma-miRs17UGAAAAGCUAGAACGAUUUACHongjun Liu et al (2014)
zma-miRs18GUACUACGGGUACUGCGAGCHongjun Liu et al (2014)
zma-miRs19aUGGUUGACAUAUGGACCCCACHongjun Liu et al (2014)
zma-miRs20AGGGCUUGUUCGUUUUGGAGUHongjun Liu et al (2014)
zma-miRs21GGUGUUGGUGCCUGUAGCGGHongjun Liu et al (2014)
Zma_miR_Seq01AAAATTTAGAGGACGTTGCTGGAGThiebaut et al (2014)
Zma_miR_Seq02AAACCGTCGGAGATAGCTTATGTCThiebaut et al (2014)
Zma_miR_Seq03AACCTATGTCCGACGGTTTTAGGCThiebaut et al (2014)
Zma_miR_Seq04ACGTCTATGGTTAGATCACGCGGCThiebaut et al (2014)
Zma_miR_Seq05ATAACTGTAGTGCATTAAAGCGGGThiebaut et al (2014)
Zma_miR_Seq06ATCCATATGGACTGGGAGGAAAGCThiebaut et al (2014)
Zma_miR_Seq07aCCCGCCGGCGAGCGCTTTCCTThiebaut et al (2014)
Zma_miR_Seq08CGGCGGGGGCGAACTGAGAACThiebaut et al (2014)
Zma_miR_Seq09aCGTGGTATTGTTTCGGCTCATGThiebaut et al (2014)
Zma_miR_Seq10TCCTTGTTGGACAGATAAAGGAGCThiebaut et al (2014)
Zma_miR_Seq11TTGTTGGTCTATTCGGGTTTTCGAThiebaut et al (2014)
Zma_miR_Seq12CATGAACCGAGCGAGCTAGCGAGCThiebaut et al (2014)
Zma_miR_Seq13GGCGGACTGGGAACACATGGGThiebaut et al (2014)
Zma_miR_Seq14TTGGGAGCCACAAAACTGAAGThiebaut et al (2014)
Zma_miR_Seq15TTTTGTTGGTGGTCATTTAACCThiebaut et al (2014)

1487NRArabidopsis_miR_IDmiR_sequencedatabase name
aly-miR156a-5pUGACAGAAGAGAGUGAGCACmiRBase21
aly-miR156a-3pGCUCACUGCUCUUUCUGUCAGAmiRBase21
aly-miR156b-3pGCUCACCUCUCUUUCUGUCAGUmiRBase21
aly-miR156c-3pGCUCACUGCUCUAUCUGUCAGAmiRBase21
aly-miR156d-3pGCUCACUCUCUUUCUGUCAUAmiRBase21
aly-miR156e-3pGCUUACUCUCUCUCUGUCACCmiRBase21
aly-miR156f-3pGCUCACUCUCUAUCUGUCACCmiRBase21
aly-miR156g-5pCGACAGAAGAGAGUGAGCACmiRBase21
aly-miR156g-3pGCUUACUCUCUUCUUGUCUCCmiRBase21
aly-miR156h-5pUGACAGAAGAAAGAGAGCACmiRBase21
aly-miR156h-3pGCUCUCUUUCCUUCUGCCACCmiRBase21
aly-miR157a-5pUUGACAGAAGAUAGAGAGCACmiRBase21
aly-miR157a-3pGCUCUCUAGCCUUCUGUCAUCAmiRBase21
aly-miR157b-3pGCUCUCUAAGCUUCUGUCAUCAmiRBase21
aly-miR157c-3pGCUCUCUAUACUUCUGUCACCmiRBase21
aly-miR157d-5pUGACAGAAGAUAGAGAGCACmiRBase21
aly-miR157d-3pGCUCUCUAUGCUUCUGUCAUCmiRBase21
aly-miR158a-5pCUUUGUCUACAAUUUUGGAAAmiRBase21
aly-miR158a-3pUCCCAAAUGUAGACAAAGCAmiRBase21
aly-miR159a-5pGAGCUCCUUGAAGUUCAAACGmiRBase21
aly-miR159a-3pUUUGGAUUGAAGGGAGCUCUAmiRBase21
aly-miR159b-5pGAGCUCCUUGAAGUUCAAUGGmiRBase21
aly-miR159b-3pUUUGGAUUGAAGGGAGCUCUUmiRBase21
aly-miR159c-5pGAGCUCCCUUCCUCCAAAACGmiRBase21
aly-miR159c-3pUUUGGAUUGAAGGGAGCUCCUmiRBase21
aly-miR319a-5pAGAGCUUCCUUGAGUCCAUUCmiRBase21
aly-miR319a-3pUUGGACUGAAGGGAGCUCCCUmiRBase21
aly-miR319b-5pAGAGCUUUCUUCGGUCCACUCmiRBase21
aly-miR319c-5pGGAGAUUCUUUCAGUCCAGUCmiRBase21
aly-miR319c-3pUUGGACUGAAGGGAGCUCCUUmiRBase21
aly-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase21
aly-miR160a-3pGCGUAUGAGGAGCCAUGCAUAmiRBase21
aly-miR160b-3pGCGUACAGAGUAGUCAAGCAUGmiRBase21
aly-miR160c-3pGCGUACAAGGAGCCAAGCAUGmiRBase21
aly-miR161-5p.2UCAAUGCAUUGAAAGUGACUAmiRBase21
aly-miR161-5p.1UUGAAAGUGACUACAUCGGGGmiRBase21
aly-miR161-3p.1CCGGUUUAGUCACUUUCACmiRBase21
aly-miR161-3p.2GUCACUUUCACUGCAUUAAUCmiRBase21
aly-miR162a-5pGGAGGCAGCGGUUCAUCGAUCmiRBase21
aly-miR162a-3pUCGAUAAACCUCUGCAUCCAGmiRBase21
aly-miR164a-5pUGGAGAAGCAGGGCACGUGCAmiRBase21
aly-miR164a-3pCACGUACUCCCCUUCUCCAACmiRBase21
aly-miR164b-3pCAUGUGCCCAUCUUCACCAUCmiRBase21
aly-miR164c-5pUGGAGAAGCAGGGCACGUGCGmiRBase21
aly-miR164c-3pCACGUGUUCUACUCCUCCAACmiRBase21
aly-miR165a-5pGAAUGUUGUCUGGAUCGAGGmiRBase21
aly-miR165a-3pUCGGACCAGGCUUCAUCCCCmiRBase21
aly-miR165b-5pGAAUGUUGUUUGGAUCGAGGmiRBase21
aly-miR166a-5pGGAAUGUUGUCUGGCUCGAGGmiRBase21
aly-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase21
aly-miR166b-5pGGACUGUUGUCUGGCUCGAGGmiRBase21
aly-miR166e-5pGGAAUGUUGUCUGGCACGAGGmiRBase21
aly-miR166f-5pUGAAUGAUGCCUGGCUCGAGAmiRBase21
aly-miR166g-5pGGAAUGUUGUUUGGCUCGAGGmiRBase21
aly-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase21
aly-miR167a-3pGAUCAUGUUCGCAGUUUCACCmiRBase21
aly-miR167b-3pGGUCAUGCUCUGACAGCCUCACUmiRBase21
aly-miR167c-5pUAAGCUGCCAGCAUGAUCUUGmiRBase21
aly-miR167c-3pAGGUCAUGCUGGUAGUUUCACmiRBase21
aly-miR167d-5pUGAAGCUGCCAGCAUGAUCUGGmiRBase21
aly-miR167d-3pAGGUCAUCCUGCAGCUUCAGUmiRBase21
aly-miR168a-5pUCGCUUGGUGCAGGUCGGGAAmiRBase21
aly-miR168a-3pCCCGCCUUGCAUCAACUGAAUmiRBase21
aly-miR168b-3pCCCGUCUUGUAUCAACUGAAUmiRBase21
aly-miR169a-5pCAGCCAAGGAUGACUUGCCGAmiRBase21
aly-miR169a-3pGGCAAGUUGUCCUUGGCUACAmiRBase21
aly-miR169b-5pCAGCCAAGGAUGACUUGCCGGmiRBase21
aly-miR169b-3pGGCAAGUUGUCCUUCGGCUACAmiRBase21
aly-miR169c-3pGGCAAGUCAUCUCUGGCUAUGmiRBase21
aly-miR169d-5pUGAGCCAAGGAUGACUUGCCGmiRBase21
aly-miR169d-3pGCAAGUUGACCUUGGCUCUGUmiRBase21
aly-miR169f-3pGCAAGUUGACCUUGGCUCUGCmiRBase21
aly-miR169h-5pUAGCCAAGGAUGACUUGCCUGmiRBase21
aly-miR169h-3pGGCAGUCUCCUUGGCUAUUmiRBase21
aly-miR169i-3pGGCAGUCUCCUUGGAUAUCmiRBase21
aly-miR169j-3pGGCAGUCUCCUUGGCUAUCmiRBase21
aly-miR169m-3pGGCAGUCUUCUUGGCUAUCmiRBase21
aly-miR169n-5pUAGCCAAAGAUGACUUGCCUGmiRBase21
aly-miR169n-3pGGCAGUCUCUUUGGCUAUCmiRBase21
aly-miR170-5pUAUUGGCCUGGUUCACUCAGAmiRBase21
aly-miR170-3pUGAUUGAGCCGUGUCAAUAUCmiRBase21
aly-miR171a-3pUGAUUGAGCCGCGCCAAUAUCmiRBase21
aly-miR171b-5pAGAUAUUAGUGCGGUUCAAUCmiRBase21
aly-miR171b-3pUUGAGCCGUGCCAAUAUCACGmiRBase21
aly-miR171c-5pAGAUAUUGGUGCGGUUCAAUCmiRBase21
aly-miR172a-5pGUGGCAUCAUCAAGAUUCACAmiRBase21
aly-miR172a-3pAGAAUCUUGAUGAUGCUGCAUmiRBase21
aly-miR172b-5pGCAGCACCAUCAAGAUUCACAmiRBase21
aly-miR172c-5pGGAGCAUCAUCAAGAUUCACAmiRBase21
aly-miR172c-3pAGAAUCUUGAUGAUGCUGCAGmiRBase21
aly-miR172d-5pGCAACAUCUUCAAGAUUCAGAmiRBase21
aly-miR172e-5pGCAGCACCAUUAAGAUUCACmiRBase21
aly-miR172e-3pGAAUCUUGAUGAUGCUGCAUmiRBase21
aly-miR173a-5pUUCGCUUGCAGAGAGAAAUCACmiRBase21
aly-miR173a-3pGAUUCUCUGUGCAAGUGGAAGmiRBase21
aly-miR390a-5pAAGCUCAGGAGGGAUAGCGCCmiRBase21
aly-miR390a-3pCGCUAUCCAUCCUGAGUUUCAmiRBase21
aly-miR390b-3pCGCUAUCCAUCCUGAGUUCCAmiRBase21
aly-miR391-5pUUCGCAGGAGAGAUAGCGCCAmiRBase21
aly-miR391-3pACGGUAUCUCUCCUACGUAGCmiRBase21
aly-miR393a-5pUCCAAAGGGAUCGCAUUGAUCCmiRBase21
aly-miR393a-3pAUCAUGCUAUCUCUUUGGAUUmiRBase21
aly-miR393b-3pAUCAUGCGAUCUCUUUGGAUUmiRBase21
aly-miR394a-5pUUGGCAUUCUGUCCACCUCCmiRBase21
aly-miR394a-3pAGGUGGGUAUACUGCCAAUAmiRBase21
aly-miR394b-3pAGGUGGACAUAUUGCCAACAmiRBase21
aly-miR395b-5pGUUCCCUUUAACGCUUCAUUGmiRBase21
aly-miR395b-3pCUGAAGUGUUUGGGGGGACUCmiRBase21
aly-miR395c-3pCUGAAGUGUUUGGGGGGACUUmiRBase21
aly-miR395d-5pGUUCUCCCGAACACUUCAUUGmiRBase21
aly-miR395d-3pCUGAAGUGUUUGGGGGAACUCmiRBase21
aly-miR395e-5pGUUCCUCUGAGCACUUCAUUGmiRBase21
aly-miR395f-5pGUUCCCUUAAACGCUUUAUUGmiRBase21
aly-miR396a-5pUUCCACAGCUUUCUUGAACUGmiRBase21
aly-miR396a-3pGUUCAAUAAAGCUGUGGGAAGmiRBase21
aly-miR396b-5pUUCCACAGCUUUCUUGAACUUmiRBase21
aly-miR396b-3pGCUCAAGAAAGCUGUGGGAAAmiRBase21
aly-miR397a-5pUCAUUGAGUGCAGCGUUGAUGmiRBase21
aly-miR397a-3pCCGGCGUUGCGCUCAAUUAUGmiRBase21
aly-miR397b-3pUCAGCGUUGCAUUCAAUUAUGmiRBase21
aly-miR398a-5pGGAGUGUCAUGAGAACACAGAmiRBase21
aly-miR398a-3pUGUGUUCUCAGGUCACCCCUUmiRBase21
aly-miR398b-5pGGGUUGAUAUGAGGACACAUGmiRBase21
aly-miR398b-3pUGUGUUCUCAGGUCACCCCUGmiRBase21
aly-miR398c-5pGGGUCGACAUGAGAACAUAUGmiRBase21
aly-miR398c-3pUGUGUUAACUCAGGUCACCCCUGmiRBase21
aly-miR399a-5pGGGUAAGAUCUCUAUUGGCAGGmiRBase21
aly-miR399a-3pUGCCAAAGGAGAUUUGCCCGGmiRBase21
aly-miR399b-5pGGGCGCCUCUCCAUUGGCAGGmiRBase21
aly-miR399b-3pUGCCAAAGGAGAGUUGCCCUGmiRBase21
aly-miR399c-5pGGGCAUCUUUCUAUUGGCAGGmiRBase21
aly-miR399d-5pGGGCGAAUACUCCUAUGGCAGAmiRBase21
aly-miR399d-3pUGCCAAAGGAGAUUUGCCCCGmiRBase21
aly-miR399e-5pGGGCGAAUCCUCUAUUGGCAGGmiRBase21
aly-miR399e-3pUGCCAAAGGAGAUUUGCCUCGmiRBase21
aly-miR399f-5pGGGCAAGAUCACCAUUGGCAGAmiRBase21
aly-miR399f-3pUGCCAAAGGAGAUUUGCCCUGmiRBase21
aly-miR400-5pUAUGAGAGUAUUAUAAGUCACmiRBase21
aly-miR400-3pGACUUAUAAUAAUCUCAUGAAmiRBase21
aly-miR403a-5pUGUUUUGUGCGUGACUCUAAUUmiRBase21
aly-miR403a-3pUUAGAUUCACGCACAAACUCGmiRBase21
aly-miR408-5pCAGGGAACAAGCAGAGCAUGGmiRBase21
aly-miR408-3pAUGCACUGCCUCUUCCCUGGCmiRBase21
aly-miR472-5pAUGGUCGAAGUAGGCAAAAUCmiRBase21
aly-miR472-3pUUUUUCCUACUCCGCCCAUACCmiRBase21
aly-miR771-5pUGAGCCUCUGUGGCAGCCCUCmiRBase21
aly-miR771-3pGGGCUCCUCAGAUGUUCAUGmiRBase21
aly-miR774a-5p.1CGAGACGAAGAUAUGGGUGACmiRBase21
aly-miR774a-5p.2AGAUAUGGGUGACUAAUACUUmiRBase21
aly-miR774a-3p.2UUAUUUGUUACCCAUAUCUCCmiRBase21
aly-miR774a-3p.1UACCCAUAUCUCCAUCUCCAAmiRBase21
aly-miR781-5pUUAGAGUUUUCUGGAUACUUAmiRBase21
aly-miR781-3pAGUAUCCAGAAAACUCUAAUUmiRBase21
aly-miR822-5pAUGUAACGCAUGUUGUUUUCUmiRBase21
aly-miR822-3pGAAACAACAUACGUUACAUCCmiRBase21
aly-miR823-5pCUUGUAUGAUCACUAACCAUmiRBase21
aly-miR823-3pUAGGUUGGUGAUCAUAUAGGAUmiRBase21
aly-miR824-5pUAGACCAUUUGUGAGAAGGGAmiRBase21
aly-miR824-3pCCUUCUCAUCGAUGGUCUAGAmiRBase21
aly-miR825-5pUCAAGCACCAGCUCGAAGAAGCmiRBase21
aly-miR825-3pUUCUCGAGAAGGUGCAUGAACmiRBase21
aly-miR827-5pUUUGUUGAUUGACAUCUAUACmiRBase21
aly-miR827-3pUUAGAUGACCAUCAACAAACGmiRBase21
aly-miR828-5pUCUUGCUUAAAUGAGUAUUCCAmiRBase21
aly-miR828-3pAGAUGCUCAUUUGAGCAAGCAAmiRBase21
aly-miR829-5pACUUUGAAUCUUUGAUUUGAAmiRBase21
aly-miR829-3pCAAAUCAAAUCUUCAAGGUACmiRBase21
aly-miR831-5pAGAAGAGGUACAAGGAGAUGAGAmiRBase21
aly-miR831-3pUAAACUCCUCGUACUCUUCUUGmiRBase21
aly-miR833-5pUGUUAGUCUGAACUCGGUCUAGUmiRBase21
aly-miR833-3pUAGACCGAUGUCAACAAACAAGmiRBase21
aly-miR834-5pACCACAGCUUCUGCUACGAACmiRBase21
aly-miR834-3pUGGUAGCAGUAGCGGUGGUAAmiRBase21
aly-miR835-5pUUCUUGCAUAUGUUCUUUAUCmiRBase21
aly-miR835-3pUGAAGAAGAUACGCAAGAAAGmiRBase21
aly-miR838-5pUGCAAGAAUGAGAAGCAAAGCmiRBase21
aly-miR838-3pUUUUCUUCUUCUUCUUGCACAmiRBase21
aly-miR839-5pCACCAACCUCUCAUCGUUCCCmiRBase21
aly-miR839-3pGAACGCAUGAGAGGUUGGUGAAmiRBase21
aly-miR840-5pACACUAAAGGACCUAAACUAACmiRBase21
aly-miR840-3pUUGUUUAGGUCCCUUAGUUUCUmiRBase21
aly-miR842-5pAUGAUGGAUCCGACCAUGAUGmiRBase21
aly-miR842-3pUCAUGGUCAGAUCCGUCAUCCmiRBase21
aly-miR844-5pAGAAGGACUAGUAAGAUGGCUmiRBase21
aly-miR844-3pCCAUCUUACUAGUCUUUCUUUmiRBase21
aly-miR845a-5pUCGAUUGGUGUCAGAGCCACGmiRBase21
aly-miR845a-3pCGGCUCUGAUACCAGUUGAUGmiRBase21
aly-miR845b-5pUCAAUUGGUAUCAGAGCAACGmiRBase21
aly-miR845b-3pUCGCUCUGAUACCAAAUGAUGmiRBase21
aly-miR846-5pUUCAGGGACUUCAAUUCAGAAmiRBase21
aly-miR846-3pUUGAAUUGAAGUGCUUGAAUUmiRBase21
aly-miR847-5pUCUUGAUGAAGAGGAAUGGAAmiRBase21
aly-miR847-3pUCACUCCUCUUCUUCAUGAUGmiRBase21
aly-miR852-5pAGAACAAAGGCGCUUAUCUUAUmiRBase21
aly-miR852-3pAAGAUAAGCGCCUUAGUUCUGAmiRBase21
aly-miR856-5pUAAUUCCACCAAUAACUUCAGCmiRBase21
aly-miR856-3pUGAUGUUAUUUGUGGUAUAAAmiRBase21
aly-miR857-5pAAACUUUCACCAUACAAAAUAmiRBase21
aly-miR857-3pUUUUGUAUGUUGAAGGUGUAUmiRBase21
aly-miR858-5pUUUCGUUGUCUGUUCGACCUUmiRBase21
aly-miR858-3pGGUCGAGCAGACAACGAAGAUmiRBase21
aly-miR859-5pUCUCUCCGUUGUAAAAUCAAAmiRBase21
aly-miR859-3pUGAUUUUACAAUAGAUAGAUAmiRBase21
aly-miR860-5pAUAUAGUCCAAUCUAUUGAAGmiRBase21
aly-miR860-3pUCAAUAGAUUGGACUAUAUAUmiRBase21
aly-miR861-5pGUUUGGAGAAAUAUGCAUCAUmiRBase21
aly-miR861-3pGAUGGAUAUAUCUUCAAGAACmiRBase21
aly-miR862-5pUCCAAUAGGUCUAGCAUGUGCmiRBase21
aly-miR862-3pACAUGCUGGAUCUACUUGAAGmiRBase21
aly-miR868-5pCUUUCUCGGCACUUGAGGAUGUmiRBase21
aly-miR868-3pCUUCUUAAGUGCUGAUAAUGUmiRBase21
aly-miR2111a-5pUAAUCUGCAUCCUGAGGUUUAmiRBase21
aly-miR2111a-3pGUCCUCGGGAUGCGGAUUACCmiRBase21
aly-miR2111b-3pAUCCUCGGGAUACAGAUUACCmiRBase21
aly-miR2112-5pCGCAAAUGCGGAUAUCAAUGUmiRBase21
aly-miR2112-3pCUUUAUAUCCGCAUUUGCGCAmiRBase21
aly-miR395h-5pGUUCCCUUAAACGCUUCAUUGmiRBase21
aly-miR399g-5pGGGCAAAUACUCCAUUGGCAGAmiRBase21
aly-miR399h-5pGGGCAAGAUCUCUAUUGGCAGGmiRBase21
aly-miR158b-5pUUUGUCUACAAUUUUGGAAAmiRBase21
aly-miR158b-3pUCCCAAAUGUAGACAAAGCmiRBase21
aly-miR163-5p.1CGAGUUCCAGCCUCCUCAGAmiRBase21
aly-miR163-5p.2GACUUUAGCAACAACGAUUUCmiRBase21
aly-miR163-3p.2AAUCGUUGAGGCUGAAGUCGUmiRBase21
aly-miR163-3p.1UGAAGAGGACUUGGAACUCGAUCmiRBase21
aly-miR402-5pUUGGCCUAUUGAACCUCUGUUUmiRBase21
aly-miR402-3pACAGAGUUCCGUAGACCACGGmiRBase21
aly-miR773b-5pUAUCUUUGAACAAACAGUUGAmiRBase21
aly-miR773b-3pAAUUGUUCAUUCAAGGAUAUUmiRBase21
aly-miR3433-5pGGUCAUUUGAGAACUGUGAUGmiRBase21
aly-miR3433-3pUCACAGUUCUUGAUUACCCACmiRBase21
aly-miR837-5pCAUUGUUUCUUGUUUUUUUCAmiRBase21
aly-miR837-3pAAACGAACAAGAAACUGAUGAmiRBase21
aly-miR848-5pGGCAAUCCCAUGUCAAAmiRBase21
aly-miR848-3pUGACAUGGGACUAACAGACUAAmiRBase21
aly-miR851-5pUGGUCUUUGUUUGCGACCCAUACGmiRBase21
aly-miR851-3pUGUGGGUGGCAAACAAAGACGACAmiRBase21
aly-miR853-5pCUGCUAUCCUUUUCCUGUUGCAmiRBase21
aly-miR853-3pCAACCGGAAAGGGGAGCAGCAmiRBase21
aly-miR869-5pCACUUAUCUCAACCCUAGUGAmiRBase21
aly-miR869-3pCCUGGGUUUGAGAUAAUUGACmiRBase21
aly-miR3434-5pGCUGAUUCUCUGAUUUUGAACmiRBase21
aly-miR3434-3pUCAAAAUCAGAGAAUCAACCAmiRBase21
aly-miR774b-5pUGAGAUGAAGAUUUGGAUGACmiRBase21
aly-miR774b-3pCACCCAAAUCUUCCUCUCAGGmiRBase21
aly-miR3435-5pUGGCAUAAUUCUGUCAAUUCCmiRBase21
aly-miR3435-3pAAUUGACAGUAUUAUGCCAGAmiRBase21
aly-miR3436-5pCGAGCAAAAAUCAUUGUUGAUmiRBase21
aly-miR3436-3pCAACAACGAUUUUUGGGUCGUUmiRBase21
aly-miR3437-5pAAAAAACAAGGAUCCACGGAUmiRBase21
aly-miR3437-3pCGGUGGAUCUUGUUUUUUGUmiRBase21
aly-miR3438-3pUCCAUAGCUUCAUCUCUGACCmiRBase21
aly-miR3438-5pUCAAGGAUUAAGCUAUGAAGCmiRBase21
aly-miR3439-5pUUGGGGUUUCGAAAUCAAGAGmiRBase21
aly-miR3439-3pUCUGAUUUUCGAAGUCCCAAAAmiRBase21
aly-miR3440-5pUGGUUUCCCUGGCCAAUCCACUmiRBase21
aly-miR3440-3pUGGAUUGGUCAAGAGAACCGCAmiRBase21
aly-miR3441-5p.2CGAAGAAAAUGAAGUCGUUUUmiRBase21
aly-miR3441-5p.1UUCAAAGCAUCUUUGAAGGAAmiRBase21
aly-miR3441-3p.1CCCUCAAUGAUGUUUUGAAGCmiRBase21
aly-miR3441-3p.2AACGACUUCAUCUUCUUUGCUmiRBase21
aly-miR3442-5pACCAUGUUUAGACUCUGAAUUmiRBase21
aly-miR3442-3pUUCAGAGUCUAAACAUGGUGUmiRBase21
aly-miR3443-5pUUCUAAUCCCGCCAUGCACCGmiRBase21
aly-miR3443-3pGUGCCUUGUGAGAUUAGAGUUmiRBase21
aly-miR3444a-5pUUGGGAGCUCGAUGAGAUCGAmiRBase21
aly-miR3444a-3pAAUCUCAUCAAUCUCCCAAUAmiRBase21
aly-miR3445-5p.2GGUCUUUCUCCCUAUCAAGCGmiRBase21
aly-miR3445-5p.1CGAACCAUCACCUUCCAAACCmiRBase21
aly-miR3445-3p.1UUUGGAAGGUGAUUGUUUGCUmiRBase21
aly-miR3445-3p.2CUUGAUAGUGAGAAAGACCCAmiRBase21
aly-miR3446-5pCUCGGAAGCUAGACGUGUGGCAGGmiRBase21
aly-miR3446-3pUGCCACUCUUUUAGCUUCCGAAUCmiRBase21
aly-miR3447-5pCGUGACGAACAUAAUCAAACGmiRBase21
aly-miR3447-3pUUUGAGUGUGUUUGUUAUGAAmiRBase21
aly-miR3448-5pCCAGGAAAACAUCUUCAGACAmiRBase21
aly-miR3448-3pUCUGAGGAUUUUUUUUGUGGUCmiRBase21
aly-miR3449-5pUCUAGAUUGCUUUCGGUCUGUmiRBase21
aly-miR3449-3pAGAUAGAAAGCAAUCUGGAUA--miRBase21
aly-miR395iCUGAAGUGUUUGGAGGAACUCmiRBase21
aly-miR841UACGACCCACUGGAAACUAAAmiRBase21
aly-miR1887CACUUAGAUUGUUCUUAGUAUGAGmiRBase21
aly-miR4221AAGAGUUCAAAAGUAGUGAAGAmiRBase21
aly-miR4222UUUCAUUCGAAAUUGUUACCGCmiRBase21
aly-miR4223AUGGAAUUUGAUAAAUAAACACmiRBase21
aly-miR4224CAACUGAGCUUCCUCAUCUCUmiRBase21
aly-miR4225GAAUCGAUGGUUAAACAACACmiRBase21
aly-miR4226UACAAGAUGCAUUCGAGCAAUAmiRBase21
aly-miR4227UCAUUUGUGCCAAUCAUUCUAmiRBase21
aly-miR4228AAAGCCUUGAACGCUGUCGUUmiRBase21
aly-miR4229UUGGCAGGGAGGUCCUCCACACmiRBase21
aly-miR4230UGUCUCGGAAAUUUGCACCCUmiRBase21
aly-miR4231UAGACCUUUGUGUUGCCAUCGmiRBase21
aly-miR3444bAUCUCAUCAAUCUCCCAAUACmiRBase21
aly-miR4232UCACAUUUAUUAGGAUGUGUGCmiRBase21
aly-miR4233CACAUCAUCAACAUCAACUCCmiRBase21
aly-miR4234CAACUUAAAAUCAGUUGGCAAUmiRBase21
aly-miR4235ACUGAAAACACUACAACCCCUmiRBase21
aly-miR4236CAUUAAUUUGUUCCCCUCCUAmiRBase21
aly-miR4237AAACGUAAACAUAUAUAAUCGAmiRBase21
aly-miR4238UUUUUGCAAAUUAAAACCCCAAmiRBase21
aly-miR4239UCCGUUAUUUCCGCAUGCUCCmiRBase21
aly-miR4240AUGGCUAGAGUGACUAGACCCGmiRBase21
aly-miR4241CUUUGGGAUUUUCUUACAGCGAmiRBase21
aly-miR4242AAAGUUAACUAUGGCAUUCCCmiRBase21
aly-miR4243UGAAAUUAUAGAUUUCGUACAmiRBase21
aly-miR4244UUGUUGAUUCCUUGGAGAUUGmiRBase21
aly-miR4245ACAAAGUUUUAUACUGACAAUmiRBase21
aly-miR4246AAAUCCAAUUUUCAUUGCUUAAmiRBase21
aly-miR4247UGUAUCCUAAUAUUAGACCCCmiRBase21
aly-miR4248aACAUUUUAUUUUUGGCAAUCAmiRBase21
aly-miR4249UGAAUUUGAGAAGUUGAGGUAmiRBase21
aly-miR4250UCCAAAGGCACAAGAACAUCA--miRBase21
ath-miR156b-3pUGCUCACCUCUCUUUCUGUCAGUmiRBase21
ath-miR156d-3pGCUCACUCUCUUUUUGUCAUAACmiRBase21
ath-miR156f-3pGCUCACUCUCUAUCCGUCACCmiRBase21
ath-miR157a-3pGCUCUCUAGCCUUCUGUCAUCmiRBase21
ath-miR160c-3pCGUACAAGGAGUCAAGCAUGAmiRBase21
ath-miR161.1UGAAAGUGACUACAUCGGGGUmiRBase21
ath-miR162a-5pUGGAGGCAGCGGUUCAUCGAUCmiRBase21
ath-miR163UUGAAGAGGACUUGGAACUUCGAUmiRBase21
ath-miR165a-5pGGAAUGUUGUCUGGAUCGAGGmiRBase21
ath-miR165a-3pUCGGACCAGGCUUCAUCCCCCmiRBase21
ath-miR169a-3pGGCAAGUUGUCCUUGGCUACmiRBase21
ath-miR173-3pUGAUUCUCUGUGUAAGCGAAAmiRBase21
ath-miR159b-3pUUUGGAUUGAAGGGAGCUCUU--miRBase21
ath-miR319bUUGGACUGAAGGGAGCUCCCU--miRBase21
ath-miR169g-3pUCCGGCAAGUUGACCUUGGCUmiRBase21
ath-miR390b-3pCGCUAUCCAUCCUGAGUUCCmiRBase21
ath-miR394b-3pAGGUGGGCAUACUGCCAAUAGmiRBase21
ath-miR397bUCAUUGAGUGCAUCGUUGAUGmiRBase21
ath-miR398a-5pAAGGAGUGGCAUGUGAACACAmiRBase21
ath-miR398b-5pAGGGUUGAUAUGAGAACACACmiRBase21
ath-miR399fUGCCAAAGGAGAUUUGCCCGG--miRBase21
ath-miR401CGAAACUGGUGUCGACCGACAmiRBase21
ath-miR402UUCGAGGCCUAUUAAACCUCUGmiRBase21
ath-miR403-5pUGUUUUGUGCUUGAAUCUAAUUmiRBase21
ath-miR404AUUAACGCUGGCGGUUGCGGCAGCmiRBase21
ath-miR405aAUGAGUUGGGUCUAACCCAUAACUmiRBase21
ath-miR406UAGAAUGCUAUUGUAAUCCAGmiRBase21
ath-miR407UUUAAAUCAUAUACUUUUGGUmiRBase21
ath-miR408-5pACAGGGAACAAGCAGAGCAUGmiRBase21
ath-miR158bCCCCAAAUGUAGACAAAGCAmiRBase21
ath-miR164c-3pCACGUGUUCUACUACUCCAACmiRBase21
ath-miR167c-3pUAGGUCAUGCUGGUAGUUUCACCmiRBase21
ath-miR172e-3pGGAAUCUUGAUGAUGCUGCAU--miRBase21
ath-miR413AUAGUUUCUCUUGUUCUGCACmiRBase21
ath-miR414UCAUCUUCAUCAUCAUCGUCAmiRBase21
ath-miR415AACAGAGCAGAAACAGAACAUmiRBase21
ath-miR416GGUUCGUACGUACACUGUUCAmiRBase21
ath-miR417GAAGGUAGUGAAUUUGUUCGAmiRBase21
ath-miR418UAAUGUGAUGAUGAACUGACCmiRBase21
ath-miR419UUAUGAAUGCUGAGGAUGUUGmiRBase21
ath-miR420UAAACUAAUCACGGAAAUGCA--miRBase21
ath-miR426UUUUGGAAAUUUGUCCUUACG--miRBase21
ath-miR447a-3pUUGGGGACGAGAUGUUUUGUUGmiRBase21
ath-miR447a.2-3pUAUGGAAGAAAUUGUAGUAUUmiRBase21
ath-miR447c-5pCCCCUUACAAUGUCGAGUAAAmiRBase21
ath-miR447c-3pUUGGGGACGACAUCUUUUGUUG--miRBase21
ath-miR771UGAGCCUCUGUGGUAGCCCUCAmiRBase21
ath-miR773aUUUGCUUCCAGCUUUUGUCUCmiRBase21
ath-miR774aUUGGUUACCCAUAUGGCCAUCmiRBase21
ath-miR775UUCGAUGUCUAGCAGUGCCAmiRBase21
ath-miR776UCUAAGUCUUCUAUUGAUGUUmiRBase21
ath-miR777UACGCAUUGAGUUUCGUUGCUUmiRBase21
ath-miR778UGGCUUGGUUUAUGUACACCGmiRBase21
ath-miR779.2UGAUUGGAAAUUUCGUUGACUmiRBase21
ath-miR779.1UUCUGCUAUGUUGCUGCUCAUmiRBase21
ath-miR780.1UCUAGCAGCUGUUGAGCAGGUmiRBase21
ath-miR780.2UUCUUCGUGAAUAUCUGGCAUmiRBase21
ath-miR782ACAAACACCUUGGAUGUUCUU--miRBase21
ath-miR822-5pUGCGGGAAGCAUUUGCACAUGmiRBase21
ath-miR822-3pUGUGCAAAUGCUUUCUACAGGmiRBase21
ath-miR823UGGGUGGUGAUCAUAUAAGAUmiRBase21
ath-miR825UUCUCAAGAAGGUGCAUGAACmiRBase21
ath-miR826aUAGUCCGGUUUUGGAUACGUGmiRBase21
ath-miR827UUAGAUGACCAUCAACAAACUmiRBase21
ath-miR829-5pACUUUGAAGCUUUGAUUUGAAmiRBase21
ath-miR829-3p.1AGCUCUGAUACCAAAUGAUGGAAUmiRBase21
ath-miR829-3p.2CAAAUUAAAGCUUCAAGGUAGmiRBase21
ath-miR830-5pUCUUCUCCAAAUAGUUUAGGUUmiRBase21
ath-miR830-3pUAACUAUUUUGAGAAGAAGUGmiRBase21
ath-miR831-5pAGAAGCGUACAAGGAGAUGAGGmiRBase21
ath-miR831-3pUGAUCUCUUCGUACUCUUCUUGmiRBase21
ath-miR832-5pUGCUGGGAUCGGGAAUCGAAAmiRBase21
ath-miR832-3pUUGAUUCCCAAUCCAAGCAAGmiRBase21
ath-miR833a-5pUGUUUGUUGUACUCGGUCUAGUmiRBase21
ath-miR835-3pUGGAGAAGAUACGCAAGAAAGmiRBase21
ath-miR836UCCUGUGUUUCCUUUGAUGCGUGGmiRBase21
ath-miR837-5pAUCAGUUUCUUGUUCGUUUCAmiRBase21
ath-miR837-3pAAACGAACAAAAAACUGAUGGmiRBase21
ath-miR838UUUUCUUCUACUUCUUGCACAmiRBase21
ath-miR839-5pUACCAACCUUUCAUCGUUCCCmiRBase21
ath-miR840-5pACACUGAAGGACCUAAACUAACmiRBase21
ath-miR840-3pUUGUUUAGGUCCCUUAGUUUCmiRBase21
ath-miR841a-5pUACGAGCCACUUGAAACUGAAmiRBase21
ath-miR841a-3pAUUUCUAGUGGGUCGUAUUCAmiRBase21
ath-miR843UUUAGGUCGAGCUUCAUUGGAmiRBase21
ath-miR844-5pUGGUAAGAUUGCUUAUAAGCUmiRBase21
ath-miR844-3pUUAUAAGCCAUCUUACUAGUUmiRBase21
ath-miR845aCGGCUCUGAUACCAAUUGAUGmiRBase21
ath-miR846-5pCAUUCAAGGACUUCUAUUCAGmiRBase21
ath-miR848UGACAUGGGACUGCCUAAGCUAmiRBase21
ath-miR849UAACUAAACAUUGGUGUAGUAmiRBase21
ath-miR850UAAGAUCCGGACUACAACAAAGmiRBase21
ath-miR851-5pUCUCGGUUCGCGAUCCACAAGmiRBase21
ath-miR851-3pUGGGUGGCAAACAAAGACGACmiRBase21
ath-miR852AAGAUAAGCGCCUUAGUUCUGmiRBase21
ath-miR853UCCCCUCUUUAGCUUGGAGAAGmiRBase21
ath-miR847UCACUCCUCUUCUUCUUGAUGmiRBase21
ath-miR855AGCAAAAGCUAAGGAAAAGGAAmiRBase21
ath-miR854aGAUGAGGAUAGGGAGGAGGAGmiRBase21
ath-miR854dGAUGAGGAUAGGGAGGAGGAG--miRBase21
ath-miR856UAAUCCUACCAAUAACUUCAGCmiRBase21
ath-miR859UCUCUCUGUUGUGAAGUCAAAmiRBase21
ath-miR860UCAAUAGAUUGGACUAUGUAUmiRBase21
ath-miR861-5pCCUUGGAGAAAUAUGCGUCAAmiRBase21
ath-miR861-3pGAUGGAUAUGUCUUCAAGGACmiRBase21
ath-miR862-5pUCCAAUAGGUCGAGCAUGUGCmiRBase21
ath-miR862-3pAUAUGCUGGAUCUACUUGAAGmiRBase21
ath-miR863-5pUUAUGUCUUGUUGAUCUCAAUmiRBase21
ath-miR863-3pUUGAGAGCAACAAGACAUAAUmiRBase21
ath-miR864-5pUCAGGUAUGAUUGACUUCAAAmiRBase21
ath-miR864-3pUAAAGUCAAUAAUACCUUGAAGmiRBase21
ath-miR865-5pAUGAAUUUGGAUCUAAUUGAGmiRBase21
ath-miR865-3pUUUUUCCUCAAAUUUAUCCAAmiRBase21
ath-miR866-5pUCAAGGAACGGAUUUUGUUAAmiRBase21
ath-miR866-3pACAAAAUCCGUCUUUGAAGAmiRBase21
ath-miR845bUCGCUCUGAUACCAAAUUGAUGmiRBase21
ath-miR867UUGAACAUGGUUUAUUAGGAAmiRBase21
ath-miR868-5pUCAUGUCGUAAUAGUAGUCACmiRBase21
ath-miR868-3pCUUCUUAAGUGCUGAUAAUGCmiRBase21
ath-miR869.1AUUGGUUCAAUUCUGGUGUUGmiRBase21
ath-miR869.2UCUGGUGUUGAGAUAGUUGACmiRBase21
ath-miR870-5pAAGAACAUCAAAUUAGAAUGUmiRBase21
ath-miR870-3pUAAUUUGGUGUUUCUUCGAUC--miRBase21
ath-miR1886.1UGAGAGAAGUGAGAUGAAAUCmiRBase21
ath-miR1886.2UGAGAUGAAAUCUUUGAUUGGmiRBase21
ath-miR1886.3AAUUAAAGAUUUCAUCUUACUmiRBase21
ath-miR1887UACUAAGUAGAGUCUAAGAGAmiRBase21
ath-miR1888aUAAGUUAAGAUUUGUGAAGAA--miRBase21
ath-miR2111b-3pAUCCUCGGGAUACAGUUUACCmiRBase21
ath-miR2112-3pCUUUAUAUCCGCAUUUGCGCA--miRBase21
ath-miR2933aGAAAUCGGAGAGGAAAUUCGCCmiRBase21
ath-miR2934-5pUCUUUCUGCAAACGCCUUGGAmiRBase21
ath-miR2934-3pCAUCCAAGGUGUUUGUAGAAAmiRBase21
ath-miR2936CUUGAGAGAGAGAACACAGACGmiRBase21
ath-miR2937AUAAGAGCUGUUGAAGGAGUCmiRBase21
ath-miR2938GAUCUUUUGAGAGGGUUCCAGmiRBase21
ath-miR2939UAACGCACAACACUAAGCCAU--miRBase21
ath-miR773b-5pGGCAAUAACUUGAGCAAACAmiRBase21
ath-miR773b-3pUUUGAUUCCAGCUUUUGUCUCmiRBase21
ath-miR3434-5pACUUGGCUGAUUCUAUUAUUmiRBase21
ath-miR3434-3pUCAGAGUAUCAGCCAUGUGAmiRBase21
ath-miR774b-5pUGAGAUGAAGAUAUGGGUGAUmiRBase21
ath-miR774b-3pCAUCCAUAUUUUCAUCUCGAAmiRBase21
ath-miR841b-5pUACGAGCCACUGGAAACUGAAmiRBase21
ath-miR841b-3pCAAUUUCUAGUGGGUCGUAUU--miRBase21
ath-miR4221UUUUCCUCUGUUGAAUUCUUGCmiRBase21
ath-miR4227UCACUGGUACCAAUCAUUCCAmiRBase21
ath-miR4228-5pAUAGCCUUGAACGCCGUCGUUmiRBase21
ath-miR4228-3pUCGGAUGCGAAACGGUGGUGUmiRBase21
ath-miR3440b-5pUUUUCUUGGCCCAUCCACUUCmiRBase21
ath-miR3440b-3pUGGAUUGGUCAAGGGAAGCGUmiRBase21
ath-miR4239UUUGUUAUUUUCGCAUGCUCCmiRBase21
ath-miR4240UGACUAGACCCGUAACAUUACmiRBase21
ath-miR4243UUGAAAUUGUAGAUUUCGUAC--miRBase21
ath-miR3932aAACUUUGUGAUGACAACGAAGmiRBase21
ath-miR3932b-5pUUUGACGUGCUCGAUCUGCUCmiRBase21
ath-miR3933AGAAGCAAAAUGACGACUCGG--miRBase21
ath-miR5012UUUUACUGCUACUUGUGUUCCmiRBase21
ath-miR5013UUUGUGACAUCUAGGUGCUUUmiRBase21
ath-miR5014a-5pACACUUAGUUUUGUACAACAUmiRBase21
ath-miR5014a-3pUUGUACAAAUUUAAGUGUACGmiRBase21
ath-miR5015UUGGUGUUAUGUGUAGUCUUCmiRBase21
ath-miR5016UUCUUGUGGAUUCCUUGGAAAmiRBase21
ath-miR5017-5pAUUUGUUACUAAUUUGGAAUGmiRBase21
ath-miR5017-3pUUAUACCAAAUUAAUAGCAAAmiRBase21
ath-miR5018UUAAAGCUCCACCAUGAGUCCAAUmiRBase21
ath-miR5019UGUUGGGAAAGAAAAACUCUUmiRBase21
ath-miR5020aUGGAAGAAGGUGAGACUUGCAmiRBase21
ath-miR5021UGAGAAGAAGAAGAAGAAAAmiRBase21
ath-miR5022GUCAUGGGGUAUGAUCGAAUGmiRBase21
ath-miR5023AUUGGUAGUGGAUAAGGGGGCmiRBase21
ath-miR5020bAUGGCAUGAAAGAAGGUGAGAmiRBase21
ath-miR5024-5pAUGACAAGGCCAAGAUAUAACAmiRBase21
ath-miR5024-3pCCGUAUCUUGGCCUUGUCAUUmiRBase21
ath-miR5025ACUGUAUAUAUGUAAGUGACAmiRBase21
ath-miR5026ACUCAUAAGAUCGUGACACGUmiRBase21
ath-miR5027ACCGGUUGGAACUUGCCUUAAmiRBase21
ath-miR5028AAUUGGGUUUAUGCUAGAGUUmiRBase21
ath-miR5029AAUGAGAGAGAACACUGCAAA--miRBase21
ath-miR5628GAAAUAGCGAAGAUAUGAUUAmiRBase21
ath-miR5629UUAGGGUAGUUAACGGAAGUUAmiRBase21
ath-miR5630aGCUAAGAGCGGUUCUGAUGGAmiRBase21
ath-miR5631UGGCAGGAAAGACAUAAUUUUmiRBase21
ath-miR5020cUGGCAUGGAAGAAGGUGAGACmiRBase21
ath-miR5632-5pUUGAUUCUCUUAUCCAACUGUmiRBase21
ath-miR5632-3pUUGGAUUUAUAGUUGGAUAAGmiRBase21
ath-miR5633UAUGAUCAUCAGAAAACAGUGmiRBase21
ath-miR5634AGGGACUUUGUGAAUUUAGGGmiRBase21
ath-miR5635aUGUUAAGGAGUGUUAACGGUGmiRBase21
ath-miR5636CGUAGUUGCAGAGCUUGACGGmiRBase21
ath-miR5637AAUGCGCAACUCUAUAUUUCCmiRBase21
ath-miR5638aAUACCAAAACUCUCUCACUUUmiRBase21
ath-miR5639-5pUAGUCCACUGUGGUCUAAGGCmiRBase21
ath-miR5639-3pUUUAGCCUCAGACCACGGUGGACUmiRBase21
ath-miR5640UGAGAGAAGGAAUUAGAUUCAmiRBase21
ath-miR5641UGGAAGAAGAUGAUAGAAUUAmiRBase21
ath-miR5642aUCUCGCGCUUGUACGGCUUUmiRBase21
ath-miR5643aAGGCUUUUAAGAUCUGGUUGCmiRBase21
ath-miR5644GUGGGUUGCGGAUAACGGUAmiRBase21
ath-miR5638bACAGUGGUCAUCUGGUGGGCUmiRBase21
ath-miR5645aAUUUGAGUCAUGUCGUUAAGmiRBase21
ath-miR5646GUUCGAGGCACGUUGGGAGGmiRBase21
ath-miR5647UCAAGUUUGAUGACGAUUCCAmiRBase21
ath-miR5648-5pUUUGGAAAUAUUUGGCUUGACUmiRBase21
ath-miR5648-3pAUCUGAAGAAAAUAGCGGCAUmiRBase21
ath-miR5645cAACCUAUUUAACGACAUGACUmiRBase21
ath-miR5649aAUUGAAUAUGUUGGUUACUAUmiRBase21
ath-miR5650UUGUUUUGGAUCUUAGAUACAmiRBase21
ath-miR858bUUCGUUGUCUGUUCGACCUUGmiRBase21
ath-miR833bUGUUUGUUGACAUCGGUCUAGmiRBase21
ath-miR156iUGACAGAAGAGAGAGAGCAGmiRBase21
ath-miR5651UUGUGCGGUUCAAAUAGUAACmiRBase21
ath-miR156jUGACAGAAGAGAGAGAGCACmiRBase21
ath-miR5652UUGAAUGUGAAUGAAUCGGGCmiRBase21
ath-miR5653UGGGUUGAGUUGAGUUGAGUUGGCmiRBase21
ath-miR5654-5pAUAAAUCCCAACAUCUUCCAmiRBase21
ath-miR5654-3pUGGAAGAUGCUUUGGGAUUUAUUmiRBase21
ath-miR5655AAGUAGACACAUAAGAAGGAGmiRBase21
ath-miR5656ACUGAAGUAGAGAUUGGGUUUmiRBase21
ath-miR5657UGGACAAGGUUAGAUUUGGUGmiRBase21
ath-miR5658AUGAUGAUGAUGAUGAUGAAAmiRBase21
ath-miR5659CGAUGAAGGUCUUUGGAACGGUAmiRBase21
ath-miR5660CAGGUGGUUAGUGCAAUGGAAmiRBase21
ath-miR1888bUUAGGCUAAGAUUUGUGAAGAmiRBase21
ath-miR5661AGAGGUACAUCAUGUAGUCUGmiRBase21
ath-miR5662AGAGGUGACCAUUGGAGAUGmiRBase21
ath-miR5663-5pAGCUAAGGAUUUGCAUUCUCAmiRBase21
ath-miR5663-3pUGAGAAUGCAAAUCCUUAGCUmiRBase21
ath-miR5664AUAGUCAAUUUUAUCGGUCUGmiRBase21
ath-miR5665UUGGUGGACAAGAUCUGGGAUmiRBase21
ath-miR5666AUGGGACAUCGAGCAUUUAAUmiRBase21
ath-miR5645eAUUUGAGUCAUGUCGUUAAG--miRBase21
ath-miR5595aACAUAUGAUCUGCAUCUUUGCmiRBase21
ath-miR5996UGACAUCCAGAUAGAAGCUUUGmiRBase21
ath-miR5997UGAAACCAAGUAGCUAAAUAGmiRBase21
ath-miR5998aACAGUUUGUGUUUUGUUUUGUmiRBase21
ath-miR5014bAUUUGUACACCUAGAUCUGUAmiRBase21
ath-miR5999UCUUCACUAUUAGACGGACAA--miRBase21
ath-miR8121AAAGUAUAAUGGUUUAGUGGUUUG--miRBase21
ath-miR8165AAUGGAGGCAAGUGUGAAGGAmiRBase21
ath-miR8166AGAGAGUGUAGAAAGUUUCUCAmiRBase21
ath-miR8167aAGAUGUGGAGAUCGUGGGGAUGmiRBase21
ath-miR8168AGGUGCUGAGUGUGCUAGUGCmiRBase21
ath-miR8169AUAGACAGAGUCACUCACAGAmiRBase21
ath-miR8170-5pAUAGCAAAUCGAUAAGCAAUGmiRBase21
ath-miR8170-3pUUGCUUAAAGAUUUUCUAUGUmiRBase21
ath-miR8171AUAGGUGGGCCAGUGGUAGGAmiRBase21
ath-miR8172AUGGAUCAUCUAGAUGGAGAUmiRBase21
ath-miR8173AUGUGCUGAUUCGAGGUGGGAmiRBase21
ath-miR8174AUGUGUAUAGGGAAGCUAAUCmiRBase21
ath-miR8175GAUCCCCGGCAACGGCGCCAmiRBase21
ath-miR8176GGCCGGUGGUCGCGAGAGGGAmiRBase21
ath-miR8177GUGUGAUGAUGUGUCAUUUAUAmiRBase21
ath-miR8178UAACAGAGUAAUUGUACAGUGmiRBase21
ath-miR8179UGACUGCAUUAACUUGAUCGUmiRBase21
ath-miR8180UGCGGUGCGGGAGAAGUGCmiRBase21
ath-miR8181UGGGGGUGGGGGGGUGACAGmiRBase21
ath-miR8182UUGUGUUGCGUUUCUGUUGAUUmiRBase21
ath-miR8183UUUAGUUGACGGAAUUGUGGCmiRBase21
ath-miR8184UUUGGUCUGAUUACGAAUGUA--miRBase21
ath-miR826bUGGUUUUGGACACGUGAAAAU--miRBase21
aar-miR854UGGAUAUAGAGGAAUAUAACACPNRD
aly-miR3449-3pAGAUAGAAAGCAAUCUGGAUAPNRD
aly-miR4250UCCAAAGGCACAAGAACAUCAPNRD
ath-miR157mUUGACAGAAGAGAGAGAGCACPNRD
ath-miR167mUGAAGCUGCCAGCAUGAUCUGPNRD
ath-miR172eGGAAUCUUGAUGAUGCUGCAUPNRD
ath-miR172mAGAAUCCUGAUGAUGCUGCAGPNRD
ath-miR173mUUCGCUUGGAGAGANAAAUCACPNRD
ath-miR1888aUAAGUUAAGAUUUGUGAAGAAPNRD
ath-miR2935UGGAAUCACACGGUCGUCAUUCPNRD
ath-miR2939UAACGCACAACACUAAGCCAUPNRD
ath-miR3933AGAAGCAAAAUGACGACUCGGPNRD
ath-miR420UAAACUAAUCACGGAAAUGCAPNRD
ath-miR4243UUGAAAUUGUAGAUUUCGUACPNRD
ath-miR426UUUUGGAAAUUUGUCCUUACGPNRD
ath-miR447cUUGGGGACGACAUCUUUUGUUGPNRD
ath-miR5029AAUGAGAGAGAACACUGCAAAPNRD
ath-miR5999UCUUCACUAUUAGACGGACAAPNRD
ath-miR782ACAAACACCUUGGAUGUUCUUPNRD
ath-miR783AAGCUUUGCUCGUUCAUGUUCPNRD
ath-miR8121AAAGUAUAAUGGUUUAGUGGUUUGPNRD
ath-miR8184UUUGGUCUGAUUACGAAUGUAPNRD
ath-miR826bUGGUUUUGGACACGUGAAAAUPNRD
ath-miR841b-3pCAAUUUCUAGUGGGUCGUAUUPNRD
ath-miR870UAAUUUGGUGUUUCUUCGAUCPNRD
ath-miRf10000-nprCCUCGAUCCAGACAACAUUCCCCUPNRD
ath-miRf10001-nprCCCAGAAAAUCUCAAAGCCCPNRD
ath-miRf10002-nprACUCCUCUUCUUCUUGAUGUAPNRD
ath-miRf10003-nprUCCUUGGCUACCACACAAGUPNRD
ath-miRf10004-nprAAACGACGUCGUUGGUGAUUPNRD
ath-miRf10005-nprGUGCAUGUGCAUGUGCAUGUPNRD
ath-miRf10006-nprUACCUUUCUGUCUUGUGUCAPNRD
ath-miRf10007-nprGAGUCCACCGGAGCCACUCUPNRD
ath-miRf10008-nprUCCACUUCCGUUGUAGCUUCGGPNRD
ath-miRf10009-nprUUUGGAUGGAUCAUUUGGAUPNRD
ath-miRf10010-nprGCUACCGCAGCCGCUGCCGCAPNRD
ath-miRf10011-nprCGGAUCCGGAUACGGAUCCGGPNRD
ath-miRf10012-nprUGCUUUGUCCAAGAACCUGAAAPNRD
ath-miRf10013-nprUUGGUCGCUGAAUCCAGCGACAUGPNRD
ath-miRf10014-nprCCUCGCAAAAGUUGCGAGGGAUPNRD
ath-miRf10015-nprAGAAGACUCUGAAGCUGGCAPNRD
ath-miRf10016-nprUUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10017-nprUACUCGACCAGGGGGUCGAGUAGUPNRD
ath-miRf10018-nprUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10019-nprGUCGCUGCUUUUGGUCGCUGAAPNRD
ath-miRf10020-nprUACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10021-nprCUACUCGACCUCGGGGUCGAGUGGPNRD
ath-miRf10022-nprCACUCGACCCCGAGGUCGAGUGUCUUPNRD
ath-miRf10023-nprUGCUCGAGUGUCUGGUUGAGUGCPNRD
ath-miRf10024-nprUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10025-nprAAGAAGACUCUGAAGCUUGUPNRD
ath-miRf10026-nprACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10027-nprUACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10028-nprUACUCGACCUCUGGGUCGAGUGPNRD
ath-miRf10029-nprCUACUCGACCUCUGGGUCGAAUGPNRD
ath-miRf10030-nprGAUACUUUGCAGCCACAAUCUPNRD
ath-miRf10032-nprCUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10033-nprCUAGUCGACCUCGGGGUCGAGUGPNRD
ath-miRf10034-nprAAGUCACUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10035-nprACUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10036-nprACUUGACCUCUAGGUCGAGUGPNRD
ath-miRf10038-nprCACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10039-nprGAUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10040-nprAUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10041-nprUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10042-nprCUACUCGACCUCUGGGUCGAGUGGUPNRD
ath-miRf10043-nprUCGACCUCUGGGUCGAGUGGUUUGPNRD
ath-miRf10044-nprGGUCGAGUGGUUUGUCAUGAUCAPNRD
ath-miRf10045-nprUCUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10046-nprCUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10047-nprGGUGGUGUCGAUCGACACCAUCPNRD
ath-miRf10048-nprAUGGGAUCGAUCGAUCCCAGGPNRD
ath-miRf10049-nprCUUGCGAGGGAAGGCUUCCUCGPNRD
ath-miRf10050-nprAUCUUGGCCUUGUCAUCUCAPNRD
ath-miRf10052-nprAGUUGUUGGUUCAACAACAUPNRD
ath-miRf10053-nprCCAUUCACCAACUGCAGACAPNRD
ath-miRf10054-nprGUUAGGAGAGCUGUUAAGAAGPNRD
ath-miRf10055-nprUGGUUACCCAUAUGGCCAUCUCPNRD
ath-miRf10056-nprACACCAUCAUGGUCAGAUCCGPNRD
ath-miRf10057-nprUCAUGGUCAGAUCCGUCAUCCCACUUAPNRD
ath-miRf10058-nprGUGAACCACACUUGGAGUCCUCPNRD
ath-miRf10059-nprACCACACUUGGAGUCCUCCCACAPNRD
ath-miRf10060-nprUCCGGAGGGAUUCCUUCCUUPNRD
ath-miRf10061-nprAAGGUGUUAAAAUCCCUUGUPNRD
ath-miRf10063-nprCCAGGAGCUUCCUCGUUCUUPNRD
ath-miRf10064-nprAUCGCCGGUGGAAUCUCUCCGGUGAPNRD
ath-miRf10065-nprCCGGUGGAAUCUCUCCGGUGAPNRD
ath-miRf10066-nprAGGUCUUGGGUUCGAGGAACPNRD
ath-miRf10067-nprUGGGUUCGAGGAACGCCAAGPNRD
ath-miRf10068-nprCACCGGUGGAGGAGUGAGAGPNRD
ath-miRf10069-nprUGAUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10070-nprACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10071-nprUACUCGACCAAAGGGUCGAGUGGUPNRD
ath-miRf10072-nprUCUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10073-nprCUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10076-nprCUACUCGACCAAGGGGUCGAGUGPNRD
ath-miRf10077-nprUCUACUCGACCAGGGGGUCGAGUGGUUPNRD
ath-miRf10080-nprCACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10081-nprUCGACCUCGUGGUCGAGUGGPNRD
ath-miRf10082-nprACUCGACCUGGGGUCGAGUGGUPNRD
ath-miRf10083-nprGUUACUCGACCAUGGGGUCGAGUAUPNRD
ath-miRf10085-nprUACUCGAGCUCGUGGUCGAGUPNRD
ath-miRf10086-nprUGCUCGAUUGUCUGGUUGAGPNRD
ath-miRf10088-nprUACUCGACCAUGGGGUCGAGUGGUGPNRD
ath-miRf10089-nprGGUCGAGUGGUGACGUGAAGUGPNRD
ath-miRf10090-nprCGAAGGUGUCGAUCGAUACCCCUPNRD
ath-miRf10091-nprCUAGUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10092-nprUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10093-nprUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10094-nprGAGGUCGAGUGUCUUCUACUPNRD
ath-miRf10095-nprUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10096-nprGUUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10098-nprUGGUGUCGAUCGACACCCAAGUPNRD
ath-miRf10099-nprUCUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10100-nprCUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10101-nprCUACUCGGCCAUGGGGUCGAPNRD
ath-miRf10102-nprCCUCGCAAAAAUUGCGAGGGAAPNRD
ath-miRf10103-nprGGUUCCCAAAGCGUUUUCUCGAUPNRD
ath-miRf10104-nprCCACUCGACCCCGAGGUCGAGUGPNRD
ath-miRf10105-nprUUGGUGGAGAAUCGUUCGGUPNRD
ath-miRf10106-nprAGUGUAGUUGUUGCCGGAGAPNRD
ath-miRf10107-nprUCAGCAUAUGCUGGAUCUACUPNRD
ath-miRf10108-nprUGCAGUGCAUAUUUGGCUGCAPNRD
ath-miRf10109-nprUGGAGUGGACGAGGGAAUCUPNRD
ath-miRf10110-nprUGUUACCGUUGCCGCUGCCGCPNRD
ath-miRf10111-nprUUUGGCGCUAUCCAUCCUGAPNRD
ath-miRf10112-nprUCCUGAGUUUCAUUGGCUCUPNRD
ath-miRf10113-nprGAUGGCGUAUGAGGAGCCAUPNRD
ath-miRf10114-nprGAUCAUGCUAUCUCUUUGGAPNRD
ath-miRf10115-nprACCAUCUUCUUCGUCUUCGCCPNRD
ath-miRf10116-nprAGUGGCUGCAGCUGCAGCGACUPNRD
ath-miRf10117-nprGCACAUCAUCUUGCUUCCUCPNRD
ath-miRf10118-nprAUCAUCUUGCUUCCUCCACAAPNRD
ath-miRf10119-nprCUCGGUAGAGAUCUUCUUCUCPNRD
ath-miRf10120-nprGUGUGUAUGUCUCUACUUGGACPNRD
ath-miRf10121-nprACCAUUGGAAAGUGCUCUAAPNRD
ath-miRf10122-nprUGCCCACCAAAUUAUCAAGAPNRD
ath-miRf10123-nprCCGACCCGAAUACCCGAACGPNRD
ath-miRf10124-nprAGUUGGUGUCGCUCGACACCPNRD
ath-miRf10125-nprGUGGUCGAUUGCGUGGUCGAPNRD
ath-miRf10126-nprCUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10127-nprCUACUCGACCUAGGGGUCGAGUGGUPNRD
ath-miRf10128-nprCCUCGCAAUUGUCUCGCAAAUUUGPNRD
ath-miRf10129-nprAAGUCACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10130-nprCACUCGACCUGGGGGUCGAGUGAUPNRD
ath-miRf10131-nprUACUCGACCUCUAGGUCGAGUGGUPNRD
ath-miRf10132-nprACCUCUAGGUCGAGUGGUUUGPNRD
ath-miRf10133-nprUACUCGACCUGUUGGUCGAGUGGPNRD
ath-miRf10135-nprUCGACCUCUGGGUCGAGUGGUPNRD
ath-miRf10139-nprCUGCUCGACCUGUGGGUCGAGUGGUPNRD
ath-miRf10141-nprACUCUACCUCAUGGUCGAGUGPNRD
ath-miRf10142-nprAUGCUCGAAUGUCUGGUUGAGUGCPNRD
ath-miRf10143-nprCUACUCGAGCUCGUGGUCGAGUGGUPNRD
ath-miRf10144-nprUCGAGCUCGUGGUCGAGUGGUGPNRD
ath-miRf10145-nprCACUCGACCACCUGGUCGAGUPNRD
ath-miRf10146-nprUGCUCGAGUGUAUGGUUGAGUGCPNRD
ath-miRf10147-nprGAAGAAGGCUCUGAAGCUUUUCPNRD
ath-miRf10148-nprGGUGGUGGAAAGAUCAAGAUPNRD
ath-miRf10149-nprAUCCCUCGCAAAUUUUGCGAPNRD
ath-miRf10151-nprUCUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10152-nprCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10153-nprUGCUCGAGUGUCUAGUUGAGUGCPNRD
ath-miRf10154-nprUAUUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10155-nprUGAUACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf10156-nprACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf10157-nprCUACUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10158-nprUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10159-nprUCGACCCCCUGGUCGAGUAUPNRD
ath-miRf10160-nprACUCGACCAGGGGGUCGAGUAUGPNRD
ath-miRf10163-nprUACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10165-nprUACUCGACCUUGGGGUCGAGUGPNRD
ath-miRf10166-nprCGACCUUGGGGUCGAGUGGUPNRD
ath-miRf10167-nprAGAGGUGUCGAUCGACACCAACPNRD
ath-miRf10168-nprGCGGUACUCGACCAGUGGGUCGAGUPNRD
ath-miRf10169-nprUACUCGACCAGUGGGUCGAGUPNRD
ath-miRf10170-nprCUACUCGACCAGGGGGUCGAGUAGUPNRD
ath-miRf10171-nprGCGGUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10172-nprUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10173-nprCCACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10174-nprUCGGCUUCAGCUCUUCCAUCPNRD
ath-miRf10175-nprGGCACUCGACCACGGGGUCGAGUGPNRD
ath-miRf10176-nprCUCGACCACGGGGUCGAGUGPNRD
ath-miRf10179-nprAGUGGUGGGAUCGAUCGAUCCPNRD
ath-miRf10180-nprGCCGCCAUAUCUCUCCGCCGUCPNRD
ath-miRf10181-nprGUUGUUGCCGUGAACGGCGUGAGPNRD
ath-miRf10182-nprAACGGCGUGAGUGCCGUAGAPNRD
ath-miRf10183-nprAGCCAUCAUCAUGUUCCUGUPNRD
ath-miRf10184-nprAAAUCGAUUUGGGGAUUUAGGPNRD
ath-miRf10185-nprGCGUUGGUGACCAGCCUCUGPNRD
ath-miRf10186-nprCUGCGUUUGCGGGUGGUAGAPNRD
ath-miRf10187-nprGAUCAUGCGAUCUCUUUGGAUPNRD
ath-miRf10188-nprGAUGAUCCGUCACGAUGUGGUPNRD
ath-miRf10189-nprGAUUCUCGCCGGAGAGAAGAPNRD
ath-miRf10190-nprCUACUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10192-nprCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10193-nprGAUACUCGACCAUGGGGUCGAGUGGUGPNRD
ath-miRf10194-nprCUCGACCAUGGGGUCGAGUGGUPNRD
ath-miRf10195-nprUCUACUCGACUAGGGGGUCGAGUGUPNRD
ath-miRf10196-nprGGUCGAGUAGAGGACAUCACPNRD
ath-miRf10197-nprCACUCGACCAAGGGGGUCGAGUGAPNRD
ath-miRf10198-nprUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10199-nprACUCGACCUCUAGGUCGAGUPNRD
ath-miRf10200-nprUACUCGACCUCAGGGUCGAGUGPNRD
ath-miRf10201-nprCUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10202-nprUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10203-nprGGUCGAGUGGUUUGGCAUGAUCAPNRD
ath-miRf10204-nprUCGAGUAUGCAGUCGAGUGGUGPNRD
ath-miRf10205-nprUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10207-nprGGUACUCGACCACAGGGUCGAGUGPNRD
ath-miRf10208-nprCUCGACCACAGGGUCGAGUGPNRD
ath-miRf10209-nprAUGGUGGUACUCGGCCAGGUGGUPNRD
ath-miRf10210-nprCUCGACCAAGGGGUCGAGUGGUPNRD
ath-miRf10211-nprGGUACUCGACCAGGUGGUCUAGUGGUPNRD
ath-miRf10212-nprCUCGACCAGGUGGUCUAGUGGUPNRD
ath-miRf10213-nprUACUCGACCAGGGGGUCGAGUAAUPNRD
ath-miRf10214-nprACCUGGGGGUCGAGUGGUCUPNRD
ath-miRf10217-nprCUACUCGACCGCUGGGUCGAGUGGUPNRD
ath-miRf10218-nprCUCGACCAGGAGGUCGAGUGPNRD
ath-miRf10219-nprUACUCGACCAUGGGGUCGAGUPNRD
ath-miRf10220-nprCACUCGACCUCAUGGUCGAGUGAPNRD
ath-miRf10221-nprGAUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10222-nprCUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10223-nprCACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10224-nprGUAUGGUGUCGAUCGACACUGGAGPNRD
ath-miRf10226-nprAGAUUAGGGUUGAUGCGCUGPNRD
ath-miRf10227-nprACUCGACCCCCUGGUCGAGUGPNRD
ath-miRf10228-nprACUCGACCACGAAGUCGAGUPNRD
ath-miRf10229-nprCCACUCGACCACGAGGUCGAGUGCPNRD
ath-miRf10230-nprAGUUGGUGUCGCUCGACACCGAGPNRD
ath-miRf10231-nprCACUCGACCACGUGGUCGAGUGPNRD
ath-miRf10232-nprACUGCUACUCGACCAAGGGGUCGPNRD
ath-miRf10233-nprCUACUCGACCAAGGGGUCGUGPNRD
ath-miRf10234-nprCCAGCUUUCCAUUGCACUAAPNRD
ath-miRf10235-nprGAGCAUUGUGGAGAUCAAAUPNRD
ath-miRf10236-nprGAAGUUGCGGUGAAGCGGCUPNRD
ath-miRf10237-nprUGCUCGUCUUCGCCGGUUAGPNRD
ath-miRf10238-nprGCGUACAGAGUAGUCAAGCAUPNRD
ath-miRf10239-nprCGCCUUGCAUCAACUGAAUCPNRD
ath-miRf10240-nprAUCGAAGGAGAUGGAGGACGPNRD
ath-miRf10241-nprUCGUGGCCGAUCUGCUGAGGPNRD
ath-miRf10243-nprUGGAGCCAUGGUGGGAGCUGPNRD
ath-miRf10244-nprUUCUUCCGCCGCUUGGAGUCPNRD
ath-miRf10245-nprUGUUGGCUUGAACGACGGCCAUPNRD
ath-miRf10246-nprACUGAUACGGCCCAUUAAGAPNRD
ath-miRf10247-nprAUGUGCCCAUCUUCACCAUCPNRD
ath-miRf10248-nprCUUGGAUUUGGUCUGAUUACPNRD
ath-miRf10249-nprCUUGUACUGGUUAGCGUCCAPNRD
ath-miRf10250-nprGAUGAUGAUGAUACUCAGGAPNRD
ath-miRf10251-nprGUUCCGGCGAGUCUGUUCCCPNRD
ath-miRf10252-nprGGAGCUGUUAUCUCCUCUAGAPNRD
ath-miRf10253-nprUUUGCGAUGAGUUUGCGAGGAUPNRD
ath-miRf10254-nprUGAACCGCUGCCUCCAGCGAPNRD
ath-miRf10255-nprGGACUGCACAUUUAAGAGCCPNRD
ath-miRf10256-nprGCUAUGUGUGCUCACUCUCUPNRD
ath-miRf10257-nprGUGUGCUCACUCUCUAUCCGPNRD
ath-miRf10258-nprCCCAUGCCUUUCUUGUGUAAPNRD
ath-miRf10259-nprUAUCUCUGCAACUGCAACUGCPNRD
ath-miRf10260-nprGAGGUGUCGAUCGACACCAACPNRD
ath-miRf10261-nprUCGCAAAUUUGCGAGGGAGUUGCGPNRD
ath-miRf10262-nprGCGAGGAAUUUGUGAGGGUCGPNRD
ath-miRf10263-nprCGUAUGGUGUCGAUCGACACCAUPNRD
ath-miRf10264-nprUGGUGUCGAUCGACACCAUCPNRD
ath-miRf10265-nprGGAACUGGCUGGUGACGAGUPNRD
ath-miRf10266-nprGCGGCGGUGGAGAAGCUCCUGCGGUPNRD
ath-miRf10267-nprGAUACUCGACUUCCAGAUUGAGUGAPNRD
ath-miRf10268-nprGACACUCAACCUCAUGGUCGAGUGPNRD
ath-miRf10270-nprCUGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10274-nprGAUACUCGACUUCCAGGUUGAGUGPNRD
ath-miRf10276-nprGAUACUCGACUUCCAGGUUGAGUGAPNRD
ath-miRf10277-nprCUCGACUUCCAGGUUGAGUGPNRD
ath-miRf10278-nprCUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10279-nprACUCAGCCUGGGGGUCGAGUGAUPNRD
ath-miRf10282-nprAUUACUCGACCCCUGGGUCGAGUAPNRD
ath-miRf10283-nprUACUCGACCUCUUGGUCGAGUGPNRD
ath-miRf10284-nprAUCUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10285-nprAUCUACUCGACCAGGGGGUCGAGUGUPNRD
ath-miRf10286-nprACUCGACCAGGGGGUCGAGUGUPNRD
ath-miRf10287-nprGUUCUCUCUCAUUCCCGAUCGPNRD
ath-miRf10288-nprUAUGGUGUCGAUCGACACUGPNRD
ath-miRf10289-nprACUCGGCCUGGGGGUCGAGUGAUPNRD
ath-miRf10295-nprGGAUCGAUCGAUCCCGAACUGGPNRD
ath-miRf10296-nprUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10297-nprGUCACUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10298-nprCUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10300-nprGUAGUGUCGGUCGACACUGAPNRD
ath-miRf10301-nprUCCAGCGACAUGCAAACGAACAAPNRD
ath-miRf10302-nprUUGUCGGAGUCGUCAUUUUGCPNRD
ath-miRf10303-nprGUGGUUGUUGUUCUACAGGGPNRD
ath-miRf10304-nprAUGAUGCUGUUGGGUUUCUCPNRD
ath-miRf10305-nprUCUCCAAAUCAGUUUUAACAPNRD
ath-miRf10306-nprGUCACUUCCAGACCAGCGAGPNRD
ath-miRf10307-nprAGAGAUACGACGGAGAUGGAPNRD
ath-miRf10308-nprGCUGUUAGAGAACCAAGUUCCAPNRD
ath-miRf10309-nprGAAUCAGUUGGGGAGAAAGUAPNRD
ath-miRf10310-nprUCCGAAUCAGAAUCGGAGUCPNRD
ath-miRf10311-nprACCGCCGCCGUGUUCUGUCGAPNRD
ath-miRf10312-nprUCCUGCUAAUGGUUCUAGCAGAAPNRD
ath-miRf10313-nprUAUCUCUCCUACGUAGCAAUCPNRD
ath-miRf10314-nprCACCCGUCAAGAACGAGGAAPNRD
ath-miRf10315-nprACCUUUAUAUCCGCAUUUGCGPNRD
ath-miRf10316-nprCCAGAAAUUCUCAAAGCCCCPNRD
ath-miRf10317-nprGAGAACGCGUCGUCGACGAGUPNRD
ath-miRf10318-nprUAGAAGGGAGUGAGUUCUCGPNRD
ath-miRf10320-nprCGUCAUCUUCCAAUUCGUCCPNRD
ath-miRf10321-nprAGCUGGCUCUUCCGGGCGAAPNRD
ath-miRf10322-nprUGCUGUCUGGAGAUCGAGCUUPNRD
ath-miRf10323-nprAGUUGGGUCAUCCCAUAACUPNRD
ath-miRf10324-nprCGGAUUGUGGAAUGUUUCAGPNRD
ath-miRf10325-nprAUCCCUCGCAACUUUUGCGAPNRD
ath-miRf10326-nprUCUACUCGAUCUUGGGGUCGAGUGGUPNRD
ath-miRf10328-nprUGUUGGUAGAGUGAUAGGUCPNRD
ath-miRf10329-nprUACUCGACCAGGGGGUCGAGUAGUGPNRD
ath-miRf10331-nprGGUGUCGAUCGACACUGGUUPNRD
ath-miRf10332-nprACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10333-nprACUCGACCUGGAGGUCGAGUPNRD
ath-miRf10334-nprUCUACUCGACCUCAGGGUCGAGUGPNRD
ath-miRf10336-nprUACUCGACCUCAGGGUCGAGUGGUPNRD
ath-miRf10339-nprAAGACACUCGACCUCGGGGUCGAGUGPNRD
ath-miRf10340-nprCUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10341-nprGUACUCGACCAGGUGGUCGAPNRD
ath-miRf10343-nprUACUCGACUUUGGGGUCGAGUPNRD
ath-miRf10345-nprGGCACUCGCCCUCGUGGUCGAGUGAPNRD
ath-miRf10346-nprCUCGGGAUGGUUCCUCGAUGPNRD
ath-miRf10348-nprUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10349-nprGUUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10352-nprUACUCGACCGCGGGGUCGAGUGPNRD
ath-miRf10353-nprACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10354-nprGUGUCGAUCGACACUGGUGUCUPNRD
ath-miRf10355-nprCUGGUGUCGAUCGACACUGGPNRD
ath-miRf10356-nprUACUCGACCAAGGGGUCGAGUGUGPNRD
ath-miRf10357-nprCUUGUCCAAAAGCUGACUAUAPNRD
ath-miRf10358-nprCUUGGGGUCAAGCGGUCCACPNRD
ath-miRf10359-nprUGUGGGAAUUUCUCUCAUUAPNRD
ath-miRf10360-nprCCGAUAGUAACACCGCUGGUPNRD
ath-miRf10362-nprUUGGUCGCUGAAUCCAGCGACAPNRD
ath-miRf10364-nprUGGAUUCCCAAAGCACCGAUPNRD
ath-miRf10365-nprGGGACAGUAGAUGUCACAGGPNRD
ath-miRf10366-nprAAUGCUCCUCCUGUUUCACCUPNRD
ath-miRf10367-nprUUGUCUUGGUCAAUCAUGACUAPNRD
ath-miRf10368-nprACUUGGGUGGUGCUGAUUAUPNRD
ath-miRf10369-nprUCAUGGUCGGAUUCAUCAUCCCPNRD
ath-miRf10370-nprAUGCAAUGCAGCUCCUGAGCUPNRD
ath-miRf10371-nprACACUUGGAGUCCUCCCACAPNRD
ath-miRf10372-nprAGGAGAGUUGCCCUGAAACUPNRD
ath-miRf10373-nprUGACCUGCCAAAGGAGAGUUGPNRD
ath-miRf10374-nprUGAAUCGAUUUGGCCGGGUCPNRD
ath-miRf10375-nprGGCCGUCUUCGUCGACAUCGUPNRD
ath-miRf10376-nprCAUCGUCUUCUUCCUCGAUCPNRD
ath-miRf10377-nprUGGCGACGGUGGUGAGGACGPNRD
ath-miRf10380-nprACCCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10383-nprCGAUCGGUCUGGCCGAUCCGAUCPNRD
ath-miRf10384-nprUCUACUUGACCAGGGGGUUGAGUGPNRD
ath-miRf10385-nprUCUACUCGGCCAAGGGGUCGAGUGGUPNRD
ath-miRf10386-nprUACUCGACCAGGUGGUCGAGUGAUPNRD
ath-miRf10387-nprUCUCGGAGUCUCGUCGGAGAGAPNRD
ath-miRf10388-nprUUCUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10389-nprGGUACUCGACCACGAGGUCGAGUPNRD
ath-miRf10390-nprCUACUCGACCUAAGGGUCGAGUGGUGPNRD
ath-miRf10394-nprAGAAGACUCCGAAGCUGGCAPNRD
ath-miRf10397-nprUCUACUCGACUAGGGGGUCGAGUGGUPNRD
ath-miRf10398-nprCCACUCGACCACGAGGUCGGGUGPNRD
ath-miRf10399-nprCUACUCGACCUCGUGGUCGAGUGPNRD
ath-miRf10401-nprCCACUCGACCACGAGGUCGACUGPNRD
ath-miRf10402-nprACUCGACAAGGGGGUCGAGUGPNRD
ath-miRf10403-nprCCACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10404-nprCCAUUUUGUGGGGACUGAGAPNRD
ath-miRf10405-nprGGGGGUGAAUCCAUUCAUUGAPNRD
ath-miRf10406-nprUGGAAGGUGUCGAUCGACACCAUPNRD
ath-miRf10407-nprAUUUGCGAGGGAAUUGCGACPNRD
ath-miRf10408-nprCUCGCAAAAUUUGCGAGGGAAUPNRD
ath-miRf10409-nprGUUGGUGUCGCUCGACACCGPNRD
ath-miRf10410-nprGGUGUCGAUAGACACCAUCUPNRD
ath-miRf10411-nprUGUCGAUCGACACCCUGGUGPNRD
ath-miRf10412-nprCUACUCGACCUCUGGGUCGAGUGPNRD
ath-miRf10413-nprCACUCGGCCUCGGGGUCAAGUPNRD
ath-miRf10414-nprGAGGUGAAGACACUCGGCCUCGPNRD
ath-miRf10416-nprCACUCGGCCUCGGGGUCGAGUPNRD
ath-miRf10417-nprCCUCGUGGUCGAGUGAUGUGPNRD
ath-miRf10418-nprCACUCGGCCUCGUGGUCGAGUPNRD
ath-miRf10419-nprAGGUGAAGACACUCGGCCUCGPNRD
ath-miRf10423-nprUGCGAUGGUGUCGAUCGACACPNRD
ath-miRf10425-nprGAGAAGACUCUGAAGCUGGCAPNRD
ath-miRf10426-nprCUACUCGACCUCUUGGUCGAGUGGUPNRD
ath-miRf10427-nprAAACGACGUCGUUUCGUUCUPNRD
ath-miRf10428-nprAAGACGGCUGGGAAAUGGCAPNRD
ath-miRf10429-nprUUGAAGGACCUGAAGCUAUGCUPNRD
ath-miRf10431-nprUGAUGCUGCAUCGGCAAUCAACPNRD
ath-miRf10432-nprAGGGUUUUGGCUCCGGAGGUPNRD
ath-miRf10433-nprAACGUUGCCGCAGCCGCUGUPNRD
ath-miRf10434-nprGGCCCAUCAGGCCUAGCUGUPNRD
ath-miRf10435-nprCUCUGCCAAAGGAGAUUUGCPNRD
ath-miRf10436-nprACGGCGAAGAAACACGCCAUPNRD
ath-miRf10437-nprGAAUCCGGCGAAUUUUCAGCPNRD
ath-miRf10438-nprUAGGAUCAAGAUGGGGAUGAPNRD
ath-miRf10439-nprUCUCCAACAUGGAGAUUCUCACCPNRD
ath-miRf10440-nprCUUCUCCAACAUGGAGAUUCPNRD
ath-miRf10441-nprAAGCACAUCCUCUUGCUUCCPNRD
ath-miRf10442-nprGAGGCUGAAGCUGACGUGGCPNRD
ath-miRf10443-nprGGCUGCAGAGAGUUUGGAUUCPNRD
ath-miRf10444-nprUAUAGUUGGGUCACAGCCACPNRD
ath-miRf10445-nprUUGAUGAUGCUGCAGCUGCAPNRD
ath-miRf10446-nprAGCUUCCAAAACGACGUCGUPNRD
ath-miRf10447-nprUGCUGGUGGUGCUCCUCCAUPNRD
ath-miRf10448-nprCUCCGGUGAUUUCUUCGCCGPNRD
ath-miRf10449-nprCAUAUUUAGAAGGUGGUGGUGPNRD
ath-miRf10450-nprUGGAAGAGAUACUCUCUAGGPNRD
ath-miRf10451-nprAAGAAGGAGGAACAACCUGUUGPNRD
ath-miRf10452-nprUCGAACCCGAACCUGAACCGAPNRD
ath-miRf10453-nprAACUCGAACCCGAACCUGAAPNRD
ath-miRf10455-nprCCACUCGACCACGAGGUCGAGUGUPNRD
ath-miRf10456-nprUCACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10459-nprACGGAUCCGGAUCCGGAUGCPNRD
ath-miRf10460-nprCUACUCGACCAGUGGGUCGAGUGUPNRD
ath-miRf10462-nprCACUCGACCACGAGAUCGAGUGPNRD
ath-miRf10464-nprUACUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10465-nprUCUACUCGACCAGGGGGUUGAGUGPNRD
ath-miRf10467-nprUCACUCGACCCCGAGGUCGAGUGUCUPNRD
ath-miRf10468-nprCACUCGACCCCGAGGUCGAGUPNRD
ath-miRf10469-nprCCACUCGACCUCGAGGUCGAGPNRD
ath-miRf10470-nprCCACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10471-nprUCACUCGACCACGAGGUCGAGUGUPNRD
ath-miRf10473-nprUACUCGACCUCUGGGUUGAGUGPNRD
ath-miRf10474-nprUACUCGACCUGGGGUUCGAGUPNRD
ath-miRf10475-nprUCGUGGUCGAGUGUUGAGGUGAAGUPNRD
ath-miRf10476-nprCACUCGACCUCGGGGUCGAGUGAUGPNRD
ath-miRf10477-nprCACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10479-nprUGUUACUCGACCACGUGGUCGAGUGGUGPNRD
ath-miRf10482-nprUCUACUCGACUAGGUGGUCGAGUGGPNRD
ath-miRf10483-nprGGUCGCCCUUGGUCGAGUAAAPNRD
ath-miRf10484-nprCGACGAUUCCUCGUCCUGGUPNRD
ath-miRf10486-nprGACACCCUGAUGCAUCGAUCPNRD
ath-miRf10487-nprCACUCGACCUCGGGGUCGAGUGAUGUGPNRD
ath-miRf10488-nprAAGACACUCGACCUCGGGGUCGAGUGAPNRD
ath-miRf10489-nprGUUACUCGACUUGGGGGUCGAGUAUGPNRD
ath-miRf10491-nprUCGACCUCGGGGUCGAGUGAUGUGPNRD
ath-miRf10493-nprGCGAUGGUGUCGAUCGACACUGPNRD
ath-miRf10496-nprUCCCAGCAACUCCCUCGCAAPNRD
ath-miRf10497-nprUACUCGACUAAGGGGUCGAGUGGUPNRD
ath-miRf10498-nprGAUACUCGACUUCCAGGUUGAGPNRD
ath-miRf10499-nprUGAUGCUAGCCGUGAAGGAGAAAAPNRD
ath-miRf10500-nprAGGUUAGGGUUGAUGCGCUGPNRD
ath-miRf10501-nprAACAAGGUACUGCUCGUUAGGUUPNRD
ath-miRf10502-nprCCGUGAACGGCGUCAGUGCCAUPNRD
ath-miRf10504-nprGAUUCUUCUGAGCUAGCCUCPNRD
ath-miRf10505-nprACCUACAUACUUGUUCGUCAPNRD
ath-miRf10506-nprUGAACUUGGCUUGUGGGUCUPNRD
ath-miRf10507-nprGCUCCAAUCUCAUGAAGUGCCPNRD
ath-miRf10508-nprACCGUCGAGAAUUUUGGAGAAPNRD
ath-miRf10509-nprUCGCAAAUUUGCGAGGGAUUPNRD
ath-miRf10511-nprCUUUGGGUUUGUCACCAAAGAPNRD
ath-miRf10515-nprGGAGAAGACUCUGAAGCUGGPNRD
ath-miRf10516-nprAUUGCAAACUUUGUGAGGGAPNRD
ath-miRf10517-nprGGGUCGAGUGAUCUGUUGAGAUCPNRD
ath-miRf10518-nprCACUCGACCCCUUGGUCGAGPNRD
ath-miRf10519-nprACUCGACCAGGGGGUCGAGUGGUGPNRD
ath-miRf10520-nprGUUACUCGACCAUGGGGUCGAGUGPNRD
ath-miRf10521-nprCCACUCGACCCCGAGGUCGAGUGCPNRD
ath-miRf10522-nprUUACUCGACCAUGAGGUCGAGUGUPNRD
ath-miRf10524-nprACUCGACCUCUGGGUCGAGUPNRD
ath-miRf10525-nprCUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10528-nprAGGUGAAGACACUCGACCUCGGGGUPNRD
ath-miRf10529-nprCUAUGGUGUCGAUCGACACUAPNRD
ath-miRf10533-nprACUGGUUCAAACCGGUUUACAPNRD
ath-miRf10535-nprAGAGAGGUUAGGGUUGAUGCPNRD
ath-miRf10536-nprUACUCGACUAGGGGGUCGAGUPNRD
ath-miRf10537-nprUACUCGACCCAGUGGUCGAGUGGUPNRD
ath-miRf10541-nprUUCCCUCGCAAAUUUGCGAGPNRD
ath-miRf10542-nprUCUACUCGACGUCGGGGUCGAGUGPNRD
ath-miRf10543-nprUCUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10544-nprUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10546-nprACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10547-nprUACUCGACCUCUUGGUCGAGUGGPNRD
ath-miRf10548-nprGGCACUCGACCACGUGGUCGAGUGPNRD
ath-miRf10550-nprCUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10552-nprGAUGGGUGUCGAGUGAUUCUPNRD
ath-miRf10553-nprCCGCAUGAACCCGAAGAAUUUPNRD
ath-miRf10554-nprGGUCUAAGUGUACGAAUCAAPNRD
ath-miRf10555-nprGCGCUGACGUGGCUCUCGGAPNRD
ath-miRf10556-nprGGAAGCUCUCUCUACAUAUAUAPNRD
ath-miRf10557-nprUUGCCGCUUGUAAUUUACCAUCPNRD
ath-miRf10558-nprCCGGAGAUGGAUAACAACGAPNRD
ath-miRf10559-nprUUCACUGCAGAAGCUGGCGUPNRD
ath-miRf10560-nprUGCACUUCACUGCAGAAGCUGPNRD
ath-miRf10561-nprUUCGUCGCCGUUGUUCGAUCPNRD
ath-miRf10562-nprCCUUUGGCACCUUUGUUGGCPNRD
ath-miRf10564-nprGAGAAUCUUGAUGAUGCUGCPNRD
ath-miRf10565-nprGAUGCAUCUUCACCAGGUGGAPNRD
ath-miRf10567-nprGCGUGCUCACUCUCUUUUUGPNRD
ath-miRf10568-nprUUGAAAAUGUUGUUGCUGCUGCUGPNRD
ath-miRf10569-nprUUGUUCCCCUCCUAAAGGAUPNRD
ath-miRf10570-nprUUGCUCAUAAGGAUGUUACUPNRD
ath-miRf10571-nprUGGAGAUGACGCCGGAGAGAPNRD
ath-miRf10572-nprUCCAUGAAAUGCCAUGAGAGPNRD
ath-miRf10574-nprCGGCAAGUCAUCCUUGGCUGCPNRD
ath-miRf10575-nprAUCACUCCAAGUCUCUAAUUPNRD
ath-miRf10576-nprAGCGUUGCUUCGUCAUCUUCUPNRD
ath-miRf10577-nprGACGAUCGGUCUGGCCGAUCCGPNRD
ath-miRf10578-nprCAACUGCAACUGCUUGUAUAPNRD
ath-miRf10579-nprGACGGUGUCGAUCGACACUGPNRD
ath-miRf10580-nprCCUCGCAAACGUCUCGCAAAUUUGPNRD
ath-miRf10582-nprCCUCGCAAACUUUGCGAGGGAPNRD
ath-miRf10584-nprGGUUGCUCGAGUGGCUGCUCAPNRD
ath-miRf10585-nprCUACUCGACCUUUGGGUCGAGUGGUPNRD
ath-miRf10588-nprUCUGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10590-nprUCUACUCGACCUUGUGGUCGAGUGGUPNRD
ath-miRf10591-nprACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10592-nprGUUGGUGUCGCUCGACACCGAGPNRD
ath-miRf10593-nprUCAAAGCUUUGAUGGUGUAGCUAAAPNRD
ath-miRf10598-nprCACUCGACCUGGGGGUCGAGUAPNRD
ath-miRf10600-nprUCACUCGACCUAGGGGUCGAGUAPNRD
ath-miRf10601-nprACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10602-nprACUCGACCCGGGGGUCGAGUPNRD
ath-miRf10604-nprCUGGUGUCGAUCGACACCCAGPNRD
ath-miRf10605-nprCUCGACCUCUUGGUCGAGUGGUPNRD
ath-miRf10606-nprUGCUCGACCUGGGGGUCGAGUGGUCUPNRD
ath-miRf10607-nprAUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10608-nprCUCGACCUCUUGGUCGAGUGPNRD
ath-miRf10609-nprCACUCGACCAUGAGGUCGAGUGPNRD
ath-miRf10613-nprCCACUCGACCACGAGGUCGAGUGPNRD
ath-miRf10614-nprCACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10618-nprGGUCGAGUGAUGUGAUCGAGUPNRD
ath-miRf10619-nprCACUCGACCUGGGGGUCGAGUGAUGUPNRD
ath-miRf10621-nprUCACUCGACCUGGGAGUCGAGUGAPNRD
ath-miRf10622-nprAUCCCGAGCUGGCGGACAUUPNRD
ath-miRf10625-nprGAAGACUCUGAAGCUCGACAPNRD
ath-miRf10626-nprUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10627-nprAUUGUUGUCCGAGUCGUCAUPNRD
ath-miRf10629-nprACCGGUAUCUGGUCCGGUUUCPNRD
ath-miRf10630-nprCCGGAUACGGAUCCGGAUCCPNRD
ath-miRf10631-nprAAGGAAAGUAUCCUUCUUAAPNRD
ath-miRf10632-nprUCGAUCUCAUCGAUCUCCCAPNRD
ath-miRf10633-nprUGGCGGUGGAUACUUCUUGAUCGGPNRD
ath-miRf10634-nprAUGGUGCUGCAUCUGCGACUPNRD
ath-miRf10637-nprAAAUUGAGACGAGCGUUGUCUCCPNRD
ath-miRf10638-nprCUUCUCCAAGUCAUUCUCUGPNRD
ath-miRf10639-nprUUGGGGCUUUGAGAAUUUCUGGCPNRD
ath-miRf10640-nprUUGCCCUCUUCUGCAGCAGAPNRD
ath-miRf10641-nprGUUUGCCUAUCGCUGAUUCAGCGACPNRD
ath-miRf10642-nprUUGUACAUCACUUUUAGUGUPNRD
ath-miRf10643-nprAAUGAGCUCUCGAAAAGAAGAPNRD
ath-miRf10644-nprUGUUGCCGUAGCUGCAGCGGCPNRD
ath-miRf10645-nprCGUAGCUGCAGCGGCUGUUGPNRD
ath-miRf10646-nprGAGAAGUGGAUUGGAGCAAUUCPNRD
ath-miRf10647-nprCAGCUUCUUGAUACGUCCCAPNRD
ath-miRf10648-nprAUUAGAGUUUUCUGGAUACUPNRD
ath-miRf10649-nprCACCAUCUUCGUUGCUCUCUPNRD
ath-miRf10650-nprGCAGUCAAUGCAACUUAAUPNRD
ath-miRf10651-nprGCUACCGGAGCAUUCCAUGCPNRD
ath-miRf10652-nprGCUGCGAUAGAGUGGUUUUGPNRD
ath-miRf10653-nprUCGCAAAAGUUGCGAGGGAUPNRD
ath-miRf10654-nprACUCGACCCCCUUGUCGAGUAPNRD
ath-miRf10655-nprUUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10656-nprUACUUGACCAGGGGGUCGAGUAPNRD
ath-miRf10657-nprGUUACUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10658-nprCUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10659-nprUGGUGAUGUCUUCUACUCGACCUGGPNRD
ath-miRf10661-nprUACUCGACCCCCAGGUCGAGUGPNRD
ath-miRf10663-nprUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10664-nprUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10666-nprGCUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10668-nprCUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10669-nprUCUACUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10670-nprGUCCUGAGUACUCUCUUCCAPNRD
ath-miRf10671-nprACUCGACCUCGUGGUCGAGUGGUGPNRD
ath-miRf10674-nprACUACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10675-nprCACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10676-nprCUCGACAUGGGGGUCGAGUGGPNRD
ath-miRf10677-nprCACUCGACCAGGUGGUCGAGUGAPNRD
ath-miRf10680-nprCCUCGCAAAAUUUGCGAUGGAPNRD
ath-miRf10681-nprAAUCCCCCGCAAAUUGCGAGGPNRD
ath-miRf10682-nprAUUUCUGAAACAAAGCAAAAGCPNRD
ath-miRf10683-nprUUCCACCCUGAGGAGAUUAUGPNRD
ath-miRf10684-nprCGUAAACCUGUAAUUUUCCCGCCAPNRD
ath-miRf10685-nprACCUGUAAUUUUCCCGCCAAAAACPNRD
ath-miRf10686-nprGUAAUUUUCCCGCCAAAAACUPNRD
ath-miRf10687-nprUUAGCUGAAGAAGCAGAGGAGPNRD
ath-miRf10688-nprUGUUCGUUUGCAUGUCGCUGGAUPNRD
ath-miRf10689-nprUGUCGCUGGAUUCAGCGACCPNRD
ath-miRf10690-nprUUCAGCGACCAAAAGCAGCGAPNRD
ath-miRf10691-nprUCGAUCAAUGCAUUGAAAGUGACPNRD
ath-miRf10692-nprACUUUUCACUGUUUGAUUCGUPNRD
ath-miRf10694-nprACGCUCCUCUGGUUUGAGAUCPNRD
ath-miRf10695-nprCAAGCACAACAUAUCCUCUUPNRD
ath-miRf10696-nprCUUUGAAAGUAGAUACACUAUCAUCPNRD
ath-miRf10697-nprUUAGUCAUGAUUGACCAAGAPNRD
ath-miRf10698-nprAUAGAGCGAGAAAGGCAUCAUPNRD
ath-miRf10699-nprAAAUCUCUCUGUUGUGAAGUCAAACPNRD
ath-miRf10700-nprCUCUCUUUCUCCAUGGCUGACPNRD
ath-miRf10701-nprUGCAGUUCCUGGAGGUGGAGGAPNRD
ath-miRf10702-nprGUGGGAGGACUCCAAGUGUGPNRD
ath-miRf10703-nprGAGGACUCCAAGUGUGGUUAPNRD
ath-miRf10704-nprGCAGAAGUAGCGAGGUUGAGUPNRD
ath-miRf10705-nprGCGAUGGUCAUGACGGUUGAUGUUPNRD
ath-miRf10706-nprUCUUCUUCGUCGCCAUUACUPNRD
ath-miRf10707-nprUCUCUUGCAACCCAUCGAGAPNRD
ath-miRf10708-nprUCUCUGGCUUGGGACUUUUGPNRD
ath-miRf10709-nprACAUUCUUCACAGGGAUUGAPNRD
ath-miRf10710-nprCCGGUGGGAUUUCUCCGGCGAUPNRD
ath-miRf10711-nprGAACCCAAGACCUCACCCUUPNRD
ath-miRf10712-nprGUUUCUCCCACACGGCGGCGPNRD
ath-miRf10713-nprUCCUGAGUACUCUCUUCCAPNRD
ath-miRf10714-nprUGAUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10715-nprCUGGGUUGUGAUGUUCUGCAPNRD
ath-miRf10716-nprCUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10717-nprUCUCCGACGAGACUCCGAGAAAPNRD
ath-miRf10718-nprUACUCGACCCAGGUGGUCGAGUPNRD
ath-miRf10720-nprCCCGCGGUAUACCACGGGUUAAPNRD
ath-miRf10721-nprGAAAGUCAAGGCUGAUUGGUGCPNRD
ath-miRf10722-nprAGGCUGAUUGGUGCAGUCUGPNRD
ath-miRf10723-nprACUUGACCCCGUGGUCGAGUAPNRD
ath-miRf10724-nprAUACUCGACCCACUGGUCGAGUAPNRD
ath-miRf10725-nprACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10726-nprGAUGGUGUCGAACGACACCAACPNRD
ath-miRf10727-nprUGUGGAGGAUACACCUUAUCCUPNRD
ath-miRf10729-nprUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10730-nprACUCGACCAGGGGGUCGAGUGAPNRD
ath-miRf10731-nprUCUACUCGACCAAGAGGUCGAGUGGUPNRD
ath-miRf10732-nprUGGUGAUGUCUUCUACUCGACCUPNRD
ath-miRf10733-nprUACUCGACCAUGGGGUCGAGUAUPNRD
ath-miRf10734-nprUCUAUCUCAGUCCCCACAAAPNRD
ath-miRf10735-nprUACUCGACCACGUGGUUGAGUPNRD
ath-miRf10736-nprAGAUGGUGUCGAUCGACACCUUCPNRD
ath-miRf10737-nprUGGUGAUGUCCUCUAGUCGACCPNRD
ath-miRf10738-nprACUCGACCCAGUGGUCGAGUPNRD
ath-miRf10739-nprGAUACUCGACCUGUUGGUAGAGUGAPNRD
ath-miRf10740-nprAAAGUCGCAAUUCCCUUGCAACAPNRD
ath-miRf10741-nprUCGUUCGAGAGGUCGCUUUGGGPNRD
ath-miRf10742-nprGGUGCGGAUGGUUCUAUCAUAPNRD
ath-miRf10743-nprAGCUGAUUCGAUGAACUUGUPNRD
ath-miRf10744-nprGACAAGGAAGCAUAGCUUCAPNRD
ath-miRf10745-nprGCUUCAGGUCCUUCAAUGGAGGPNRD
ath-miRf10746-nprGCGGCUGUUGCAGCUGCUGCPNRD
ath-miRf10747-nprCAAGCACCAGCUCGAAGAAGCUUAGPNRD
ath-miRf10748-nprAUCAUGAAGGAGAGAUCUUUPNRD
ath-miRf10750-nprUAAGUAUGGCAGGAUUAAGAPNRD
ath-miRf10751-nprCUUGUGGAGAGGAAGCAAGAPNRD
ath-miRf10753-nprCUCUAGCUCUUUAGUCCUGUPNRD
ath-miRf10754-nprUCCUCCACCACCGAGAGCAUPNRD
ath-miRf10755-nprUGCAGCUGCAGCAUCAUCAAPNRD
ath-miRf10756-nprUGGGUUCUUAUUCUGCUGCAPNRD
ath-miRf10757-nprUCCGCCGAGUCUUCUUUUUGPNRD
ath-miRf10758-nprUAGCUUGAGAGUCAAGUUAAUPNRD
ath-miRf10759-nprUUUCUUGGCCCAUCCACUUCUAPNRD
ath-miRf10761-nprAGUCCUAGAGAGUAUCUCUUCCACCAPNRD
ath-miRf10762-nprAGCUUCUGGUCAGAGGCUUGPNRD
ath-miRf10763-nprGGUGGUGAAGAAGCAUGGUUPNRD
ath-miRf10764-nprGAGAAGAUGAAGCUGUUCUGPNRD
ath-miRf10765-nprGAGCUUGGAACCAAUUGUGUUCPNRD
ath-miRf10766-nprGUUCAGGUUCGGGUUCGAGUPNRD
ath-miRf10767-nprCACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10768-nprUCUACUCGGCCUAGGGGUCGAGUGPNRD
ath-miRf10769-nprGGCACUCGACCUCGGGGUCGAGUGGUGGPNRD
ath-miRf10770-nprCUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10774-nprAUAUCUUGAUCUUUCCACCAPNRD
ath-miRf10775-nprUUGAUCUUUCCACCAUCUACPNRD
ath-miRf10776-nprAUGCCUCGCAAUAUUUGCGACGGAPNRD
ath-miRf10778-nprCUACUCAGCCAGGGGGUCGAGUGGUPNRD
ath-miRf10780-nprUGAGGCAUCUCAUUCCUUCUPNRD
ath-miRf10781-nprAUACUCGACCCCCAGGUCGAGUGACPNRD
ath-miRf10783-nprUCACUCGACCCCCUGGUCGAGUAGAPNRD
ath-miRf10785-nprAAGUGGUGAAGUCUUCUACUCGACCPNRD
ath-miRf10787-nprUACUCGACCAGGAGGUCGAGUGPNRD
ath-miRf10788-nprACUCGACCUCAUCAUUCUACCUAGAPNRD
ath-miRf10789-nprGUCCAAGCAGACAAAACUGUPNRD
ath-miRf10790-nprUCGACCUCGAGGUCGAGUGAPNRD
ath-miRf10792-nprGAGGAAAGUCUUUUUCUCCUUCAPNRD
ath-miRf10793-nprAAAGUCUUUUUCUCCUUCACPNRD
ath-miRf10794-nprGUGAGUUUAGGGUUCUUGAAPNRD
ath-miRf10795-nprCUCUGUGGGAGAAGUUCCUUPNRD
ath-miRf10796-nprACGACGGCGUUUAGAUGAAGPNRD
ath-miRf10797-nprCUUUUAGGUCGAGCUUCAUUGPNRD
ath-miRf10798-nprUUCCGCAACUUUUGGCGUUGPNRD
ath-miRf10799-nprGGCAUACUUGUUGUGAUGCUUGUGPNRD
ath-miRf10800-nprCAUUAUCACAGUACUAUGAUPNRD
ath-miRf10803-nprUGGUUGAGUGCGGAAUGGAGAAGACPNRD
ath-miRf10807-nprUGUCUUCAUCGUCAUCACAAPNRD
ath-miRf10808-nprUCUCUCGCAAUAUUUGCGAGGPNRD
ath-miRf10814-nprCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10816-nprUACUCGACCACAUGGUCGAGUPNRD
ath-miRf10817-nprUACUCGACCCCCUGGUCGGGUAPNRD
ath-miRf10820-nprUCUAGUGUCGAUCGACACCAUPNRD
ath-miRf10821-nprGGUACUCGACCACGGGGUCGAGUGPNRD
ath-miRf10822-nprCUACUCGACCAAGGGGUCGAGUGGUGPNRD
ath-miRf10823-nprUCGACCUCAAGGUCGAGUGAPNRD
ath-miRf10824-nprCUCUACUCGACCUGGUUGUCGAGUGPNRD
ath-miRf10825-nprUCGACCUGGUUGUCGAGUGGUPNRD
ath-miRf10829-nprCUCGACCAUGGGGUCGAGUGPNRD
ath-miRf10832-nprUACUCGACCAGGGGGUUGAGUAAPNRD
ath-miRf10833-nprUCCAGUGUCGAUCGACACUAGPNRD
ath-miRf10834-nprGGUGUUGGUGUCGAUCGACACCPNRD
ath-miRf10835-nprAAGACACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10836-nprGUGAUGUCCUCUACUCGACCPNRD
ath-miRf10837-nprCAUCAACCCUAACCUCUCUCAUGPNRD
ath-miRf10838-nprACUUGACCCCCUGGUCGAGUAPNRD
ath-miRf10839-nprAGUCGUCCAAGUACGACUAUPNRD
ath-miRf10840-nprGUGAUGUCCUCUACUCGACCAGGPNRD
ath-miRf10841-nprUAUUCGACCCCCAGGUCGAGPNRD
ath-miRf10843-nprUAGCCGCUUCACCGCAACUUPNRD
ath-miRf10844-nprAUAGCCGCCGUUGAGAUCUCUPNRD
ath-miRf10845-nprUCAUGUUAUGUGAUUCUUCUPNRD
ath-miRf10846-nprUGAAUACGACCCACUAGAAAUUGAAPNRD
ath-miRf10847-nprUCAGCUGUGUCUUCGUUGUCAUCPNRD
ath-miRf10848-nprAGCUAAGGCGCUUAUCUUCUPNRD
ath-miRf10849-nprUGCAGAGGACAGACCAAAGAPNRD
ath-miRf10850-nprGUCUCUAGAGGAGCCAGAGCCAPNRD
ath-miRf10851-nprGGUCUAAACGCAAACGCUGUPNRD
ath-miRf10852-nprUGGUGGUGAAUCAGCCAGUCCUPNRD
ath-miRf10853-nprUCCUCCAUGCAUAGGGGGAGGPNRD
ath-miRf10855-nprAGAGUGUCGGCGAUGGCGAGGAUPNRD
ath-miRf10856-nprUGAGGCAUGUGUCUGGGGUCPNRD
ath-miRf10857-nprUAAUCCUCCUAAAUGUGCCGPNRD
ath-miRf10860-nprUCCUUAUGAGCAAUCUCCAAUPNRD
ath-miRf10861-nprAAGGAUGACUUGCCGGAACGPNRD
ath-miRf10862-nprGAGGAGACUGCGUUAUGCAUUUGPNRD
ath-miRf10863-nprUACAAGCAGUUGCAGUUGCAPNRD
ath-miRf10864-nprCUCGCAAAUCCCUCGCAGAAPNRD
ath-miRf10865-nprCGCCUCGCAAAUCCCUCGCAGAAPNRD
ath-miRf10867-nprCACUCGACCACCAGGUCGAGUPNRD
ath-miRf10868-nprACUCGACCACGAGGUCGAGUAGPNRD
ath-miRf10870-nprCUACUCGACCAGGUGGUCGAGUGGUPNRD
ath-miRf10871-nprUGGUGAUGUCCUUUGCUCGACCPNRD
ath-miRf10872-nprUUGCUCGACCCGGGGGUCGAGUPNRD
ath-miRf10874-nprACUCGACCCCCAGGUCGAGCAPNRD
ath-miRf10875-nprGGCUUUUAAGAUCUGGUUGCGGUUPNRD
ath-miRf10880-nprGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10884-nprCCUGGGGGUCGAGUGAUGUGPNRD
ath-miRf10887-nprUGGUGAUGUCCUCUGCUCGACCPNRD
ath-miRf10888-nprGCUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10890-nprCUACUCGACCUGAGGGUCGAGUGPNRD
ath-miRf10891-nprCUCGACCUGAGGGUCGAGUGGUPNRD
ath-miRf10892-nprUCUACUCGACCUGAGGGUCGAGUGPNRD
ath-miRf10894-nprAUACUCGACCACGAGGUCGAGUGPNRD
ath-miRf10895-nprUACUCGACCCCCUGGUCGAGUGAPNRD
ath-miRf10896-nprGGAGGAGGAGUACGAUACGAPNRD
ath-miRf10897-nprACUCGACCUGGGGGUCGAGUGAUPNRD
ath-miRf10899-nprAGGGGGUCGAGUAAUGUCAUPNRD
ath-miRf10903-nprUACUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10904-nprGACGAAGAAGAUGGUGAUGUGAUPNRD
ath-miRf10906-nprUGGUCCUUCUUCCAUAUCCUPNRD
ath-miRf10908-nprAUGUGGAUUCCAACAGGAAGPNRD
ath-miRf10909-nprAAGGGACGAGAAAGUGUUGGUPNRD
ath-miRf10910-nprUCCUUGAAAGGUUCAUUAUCPNRD
ath-miRf10911-nprCAAACGCAGCGUUUGCGGUUPNRD
ath-miRf10912-nprAAGCCGAGACCAAAGCUGGUPNRD
ath-miRf10913-nprAUGAUGCGCAAAUGCGGAUAPNRD
ath-miRf10914-nprUGGGGCUUUGAGAUUUUCUGGPNRD
ath-miRf10915-nprACCCAAUCUCUACUUCAGUCUPNRD
ath-miRf10916-nprGCAAGAUGAUCACUGUGGUCPNRD
ath-miRf10917-nprUGUACAUCACUUUUAGUGUAPNRD
ath-miRf10918-nprUCUUAAUAGCGCUCCUAACAPNRD
ath-miRf10919-nprGAGAGCAAGAGCAGCAGCUUUPNRD
ath-miRf10920-nprAACCGGAUUCUGGUUUGGUUAPNRD
ath-miRf10921-nprGUGACGGUGGGACGAAUGUUPNRD
ath-miRf10922-nprGGUGGUGCGACAGGCUUUGGUPNRD
ath-miRf10923-nprUCAGCGGUUGGAGUUGCUCCPNRD
ath-miRf10924-nprUGAGGCGUAUCAGGAGGUAGUPNRD
ath-miRf10925-nprGGAAAACAGAGCAUGAUGAUGAPNRD
ath-miRf10926-nprGAGGCUUCAGGGCAUUACCAGPNRD
ath-miRf10927-nprGGACCGGAGACCAUAUAAACAPNRD
ath-miRf10928-nprGUUGAGCUCGGCUUAACUGCPNRD
ath-miRf10929-nprAUGUCCCAUGGUGAAACUUUGUCPNRD
ath-miRf10931-nprGGCGGCGGCAAACUCUACUGPNRD
ath-miRf10932-nprGUGUCGAUCGACACUGGGPNRD
ath-miRf10933-nprAGAGUUUCCUCAAAAAUAGAGGAPNRD
ath-miRf10934-nprCCGGGUCCGAGUUCGGGUUCGGPNRD
ath-miRf10935-nprACGUCGCAUAUUUGCGAGGGPNRD
ath-miRf10937-nprUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10940-nprUACUCGACAAGGGGGUCGAGUGGPNRD
ath-miRf10941-nprACCACUCGACCACCUGGUCGAGUAPNRD
ath-miRf10947-nprUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10948-nprCUUCUACUCGACCUGGUGGUCGAPNRD
ath-miRf10949-nprUACUCGACCUGGUGGUCGAAUGGUPNRD
ath-miRf10951-nprAAGUGGUGAUGUCUUCUACUCGACCPNRD
ath-miRf10952-nprUACUCGACUUGGUGGUCGAGUGGUCPNRD
ath-miRf10953-nprUACUCGACUUGGUGGUCGAGUPNRD
ath-miRf10954-nprAAGUGGUGAUGUCUUCUACUCGACPNRD
ath-miRf10956-nprCACUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10957-nprCUCGCCCUCGUGGUCGAGUGAPNRD
ath-miRf10958-nprCACUCGACCUGGUUGUCGAGUGGUPNRD
ath-miRf10959-nprUACUCGACCUGGGGGUCGAGUAUGUPNRD
ath-miRf10960-nprGGUUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10965-nprUCGACCCGGUGGUCGAGUGGPNRD
ath-miRf10966-nprCACUCGACCUCGGGGUUGAGUGAUPNRD
ath-miRf10967-nprCACUCGACCUCGGGGUUGAGPNRD
ath-miRf10968-nprUUGGUGUCGAUCGACACACAPNRD
ath-miRf10971-nprUCCUGAGUACUCUCUUCCAAPNRD
ath-miRf10973-nprUGUUGUGUCGGUCGACACCAPNRD
ath-miRf10974-nprAUUUUCCCGCCAAAAGCGUAAACPNRD
ath-miRf10975-nprACCCGGAAUUUUCCCGCCAAAAPNRD
ath-miRf10976-nprAAAACCCGGAAUUUUCCCGCPNRD
ath-miRf10977-nprGUUGAGAUGACAAGGCCAAGPNRD
ath-miRf10978-nprGAUUAAUGCAGUGAAAGUGACPNRD
ath-miRf10981-nprUAUCAGGAGGUUCAGUCAUGPNRD
ath-miRf10982-nprGCUGGAGGAACUGCAGCUAUGUAPNRD
ath-miRf10983-nprUUGUGACAAGAGCAAGUCCAAPNRD
ath-miRf10984-nprUUCUUUGCUUCCCCAAUGCUPNRD
ath-miRf10985-nprCUUCUUGGUGCAGCCAUGUUUGGCPNRD
ath-miRf10986-nprCGGAUCUGACCAUGAUGGUGUUUPNRD
ath-miRf10988-nprGGCGCCUCUCCAUUGGCAGGPNRD
ath-miRf10989-nprUGGUGAGACUCCAUGUUCUUPNRD
ath-miRf10990-nprACAAACGAAGCAGCUUGUUUGUPNRD
ath-miRf10991-nprUUCUUAAUAGCGCUCCUAACPNRD
ath-miRf10993-nprAAGAGAGAGGGUUUAAGGCUUPNRD
ath-miRf10994-nprUCCUGCACCGCUCGAUCCGCPNRD
ath-miRf10995-nprGGUGAUGCCAUCUACUCGACPNRD
ath-miRf10997-nprUUCUCCGACCUCCUCCGAGAPNRD
ath-miRf10998-nprACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10999-nprCUCGACCCAGGUGGUCGAGUPNRD
ath-miRf11000-nprUACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf11001-nprGGUCGAGUGAAUGAUGAUGGUGPNRD
ath-miRf11002-nprUACUCGACUUGGUGGUAGAGUGPNRD
ath-miRf11004-nprCUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf11005-nprUACUCGAUCAUGGGGUCGAGUGGUGPNRD
ath-miRf11006-nprUACUCGAUCAUGGGGUCGAGUPNRD
ath-miRf11009-nprGUGUUGGUGUCGAUCGACACCUPNRD
ath-miRf11010-nprCUCUGUAUUCUUCCACAGCUPNRD
ath-miRf11011-nprUACUCGAUCACUUGGUCGAGUPNRD
ath-miRf11012-nprGUACUCGACCUCGUGGUCGAGUPNRD
ath-miRf11016-nprGGUAUCGAUCGACACCUUCGPNRD
ath-miRf11017-nprUUUCUUCGCAAGUCCCUCGCPNRD
ath-miRf11021-nprGAGGUUUGCGAUGAGAAAGAGPNRD
ath-miRf11022-nprAUUGUUGUCUUCACUACCGAPNRD
ath-miRf11023-nprCCUUUAAGCUCCUCGAUAUCAUCAUPNRD
ath-miRf11024-nprUUAUGGUCAGUUUUUGGACAPNRD
ath-miRf11025-nprAUUGCAAUGGCAACACUAAAPNRD
ath-miRf11026-nprCUUGUAAAGAGAUUUGUAGUCPNRD
ath-miRf11027-nprUUCAUUGCCAUGUUCUAGUUPNRD
ath-miRf11028-nprAACAACUGAUAGAGCUGCAAUPNRD
ath-miRf11029-nprAGCUCCAUAUCCUUCAAUGGPNRD
ath-miRf11030-nprAUUGUGGUUUCUUCUCUGGAPNRD
ath-miRf11031-nprAACUUCAGCAAGUGACUUUGPNRD
ath-miRf11032-nprUCGCGAGCAACUUCAGCAAGUPNRD
ath-miRf11033-nprGCUGUGGCAUCAUCAAGAUUCAPNRD
ath-miRf11034-nprGAGAGGAGAGAUAGCGUCGGGUAAUPNRD
ath-miRf11035-nprACACUCUCUUGGUCCCGAAAPNRD
ath-miRf11036-nprGAGGAGGAGGAGCACCACCGUPNRD
ath-miRf11037-nprUCAUCGGAGAAACAGAGGAGCPNRD
ath-miRf11038-nprUGGGCCUUAAAGCCCAGUUUPNRD
ath-miRf11039-nprACUGAGCUAUAGGCUCUUCUPNRD
ath-miRf11041-nprACGACGGUAGUCACGUGAGACPNRD
ath-miRf11042-nprGGAAGAGGCAGUGCAUGGGUAPNRD
ath-miRf11043-nprUUCUGGAGCUUACCUUCGAGPNRD
ath-miRf11044-nprAGAAGAAGAGGCGUCCUCCUPNRD
ath-miRf11045-nprUUUCUUGUGGAGGAAGCAAGAUPNRD
ath-miRf11046-nprCGGACCCGAAACCUGACCCGPNRD
ath-miRf11047-nprCAUGAUCUUGUCUUCCUCUCPNRD
ath-miRf11048-nprGAUGAAGAAGCUGAAGUACAGGPNRD
ath-miRf11049-nprCCAUGCAUUUGGGAUCCGAPNRD
ath-miRf11050-nprGGAUUUGCUUACUUUGGCCUUPNRD
ath-miRf11051-nprCGCUGUUGGAGCAUCAUCAAPNRD
ath-miRf11052-nprACUCAGAUAGAGAACGAAAGPNRD
ath-miRf11053-nprUACCAUCUCUUGAGGAACUUGGPNRD
ath-miRf11055-nprCAGCUCCCAUGGAAGCAGAAPNRD
ath-miRf11056-nprGAGAGGAGAGAGUCUUUGUUPNRD
ath-miRf11058-nprCCAUUGUUGCCUGAGAAGAAAPNRD
ath-miRf11059-nprCACUCGACCCACAGGUCGAGPNRD
ath-miRf11062-nprACUCGACCAGGUGGUCGAGUGPNRD
ath-miRf11065-nprAAGUGGUGAUGUCUUCUACUCGACCUPNRD
ath-miRf11066-nprUCCUCGCAAAAUUUGCGAGGGAPNRD
ath-miRf11068-nprGCCUGAGCUGAGGAUACUCGACCPNRD
ath-miRf11069-nprCACUCGACCCCCUGGUCGAGUAGAPNRD
ath-miRf11070-nprUGGCAUGUGAUACCUUUUUGPNRD
ath-miRf11072-nprUCUACUCGACCUGGGGUUCGAGUGGUPNRD
ath-miRf11073-nprAUACUCGACCACCAGGUCGUGUGPNRD
ath-miRf11078-nprUACUCGACCAUGGGGUCGAGUAAUGPNRD
ath-miRf11080-nprACUCGACCCCGAGGUCGAGUPNRD
ath-miRf11081-nprUUGGUGUCGAUCGACACCUCPNRD
ath-miRf11085-nprAAAGUCCUUUUCUCCUUCACGGPNRD
ath-miRf11086-nprAGUGUUUGAACCUAACGAGCPNRD
ath-miRf11087-nprUUGUGAAGAAAGGGUUCUUAPNRD
ath-miRf11088-nprGAAUAAAGCCAUGGAUGGAUCUPNRD
ath-miRf11092-nprUCAUGGUCGUGAUCGUGGUCAUCPNRD
ath-miRf11095-nprGAGGAAAGUGUCCCUCGCAAAPNRD
ath-miRf11096-nprAACAGAGACCAUCUCUUCCCPNRD
ath-miRf11098-nprACUCGGCCAGGUGGUCGAGUGGUPNRD
ath-miRf11100-nprACUCGACCUGGUGGUCGAGUGPNRD
ath-miRf11101-nprUCCUCUGUAUCUUCGUUGUCAPNRD
ath-miRf11103-nprUUGAGUUGUAUGUGAAUACGPNRD
ath-miRf11104-nprAAGUCACUCGACCUCGGGGUCAAGUGAPNRD
ath-miRf11105-nprUGAAGUCACUCGACCUCGGGGUCPNRD
ath-miRf11107-nprACUCGACCAUGGGGUCGAGUGPNRD
ath-miRf11109-nprACUCGACCCCUUGGUCGAGUPNRD
ath-miRf11110-nprUACUCGACUAGGGGGUCGAGUAAUPNRD
ath-miRf11112-nprUCUAGUGUCGAUCGACACUAGPNRD
ath-miRf11113-nprGGCCCAUUCGAAGCCCAUUAPNRD
ath-miRf11115-nprUGCUCUCUGGCGUAUUCUUCPNRD
ath-miRf11117-nprGCUUGUGGCUGCAACGUAUCGPNRD
ath-miRf11118-nprACUCGACCACCUGGUCGUGUGPNRD
ath-miRf11121-nprCUCUCUUCCAAGUUUAUGCGPNRD
ath-miRf11123-nprAAUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf11124-nprAAGUCACUCGGCCUGGGGGUCGAGUGAUPNRD
ath-miRf11125-nprUAUUCCUCGCAAAUUUUGCGACGPNRD
ath-miRf11127-nprCCUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf11131-nprUGGGUGUCGAUCGACACCAUPNRD
ath-miRf11133-nprUGGAUCAUCGUUGUAAGCAUPNRD
ath-miRf11134-nprCACAUCAGACGGUUGAGUUGCUPNRD
ath-miRf11136-nprUCGAGCACAUGACAUCCAGAPNRD
ath-miRf11137-nprUCCGUGUGUUCCUCUUGGUACPNRD
ath-miRf11138-nprUCAUCGCGGUGGAGGAGGAGGAPNRD
ath-miRf11139-nprAGAGAAUGAGGUUGAGCCAAPNRD
ath-miRf11140-nprAUGAGAGAAGCUUCAUCUACAPNRD
ath-miRf11141-nprCAUCCAGAUGAUCCAUCCAAPNRD
ath-miRf11142-nprGUAUAGCAUCAUGAGCAAUCAPNRD
ath-miRf11143-nprUGACAGAAAGAGAGGUGAGCAPNRD
ath-miRf11145-nprUCUGCAUGCUCCUUGUUGAUGPNRD
ath-miRf11146-nprCUUCUGAGGAUUCACCCGUUGAPNRD
ath-miRf11147-nprGUUCGAUCUCCGCCGCUACUPNRD
ath-miRf11148-nprAGAGUAAGCACACAUAGCUUCPNRD
ath-miRf11150-nprAGUAACGUCCUUAUGAGCAAUCUCPNRD
ath-miRf11151-nprAGCUCCGGCAAUGAUUGAGGPNRD
ath-miRf11152-nprACCCUCACAAAUUCCUCGCAPNRD
ath-miRf11153-nprUCGCAAACUUUGCGAGGGAUPNRD
ath-miRf11156-nprGGCACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf11157-nprUGUUGGUGUCGGUCGACACUGPNRD
ath-miRf11158-nprGAUCGACACCCUGUUGGUGUCGGUCPNRD
ath-miRf11164-nprUCACUCGACCUCGAGGUCGAGUGUPNRD
ath-miRf11165-nprCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf11166-nprGGUUACUCGACCACGAGGUCGAGUAGPNRD
ath-miRf11167-nprGAGAAGUGUAUGUGAGGACCUAGACPNRD
ath-miRf11170-nprACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf11176-nprUCGACCUGGGGGUCGAGCGAPNRD
ath-miRf11177-nprUUACUCGACCCAGGGGUCGAGUAPNRD
ath-miRf11178-nprACUCGACCUGGGGGUCGAGUAGPNRD
ath-miRf11180-nprCACUCGACCCCCUGGUCGAGPNRD
ath-miRf11181-nprUACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf11182-nprACUCGACCUAGGGGUCGAGUAPNRD
ath-miRf11186-nprUCUACUCGACUUGGGGGUCGAGUGGUPNRD
ath-miRf11188-nprUCCAGUGUUGAUCGACACUAGPNRD
ath-miRf11189-nprUACUCGACCUGAGGGUCGAGUAGPNRD
ath-miRf11194-nprGUUUACUUACUCGUGGUGGGCPNRD
ath-miRf11195-nprAGAGAAACCCAACAGCAUCAUPNRD
ath-miRf11198-nprUCUUCUUCGAUCGGUUCUGAPNRD
ath-miRf11199-nprGUCUGGCACGAGGCCCUUAAPNRD
ath-miRf11200-nprCCUUGAAGAGUGUUGUUGCUPNRD
ath-miRf11203-nprCAAGCCCAAAAAACGUUUUGPNRD
aly-miR869*CACUUAUCUCAACCCUAGUGA--PMRD
ath-miR3434ACUUGGCUGAUUCUAUUAUUPMRD
ath-miR3434*UCAGAGUAUCAGCCAUGUGAPMRD
ath-miR3440b-5pUUUUCUUGGCCCAUCCACUUCPMRD
ath-miR3440b-3pUGGAUUGGUCAAGGGAAGCGUPMRD
ath-miR3932aAACUUUGUGAUGACAACGAAGPMRD
ath-miR3933AGAAGCAAAAUGACGACUCGGPMRD
ath-miR4221UUUUCCUCUGUUGAAUUCUUGCPMRD
ath-miR4227UCACUGGUACCAAUCAUUCCAPMRD
ath-miR4228AUAGCCUUGAACGCCGUCGUUPMRD
ath-miR4239UUUGUUAUUUUCGCAUGCUCCPMRD
ath-miR4240UGACUAGACCCGUAACAUUACPMRD
ath-miR4243UUGAAAUUGUAGAUUUCGUACPMRD
ath-miR5012UUUUACUGCUACUUGUGUUCCPMRD
ath-miR5013UUUGUGACAUCUAGGUGCUUUPMRD
ath-miR5014-5pACACUUAGUUUUGUACAACAUPMRD
ath-miR5014-3pUUGUACAAAUUUAAGUGUACGPMRD
ath-miR5015aUUGGUGUUAUGUGUAGUCUUCPMRD
ath-miR5015bUCUGUUGUUGUUGGUGUUAUGPMRD
ath-miR5016UUCUUGUGGAUUCCUUGGAAAPMRD
ath-miR5017UUAUACCAAAUUAAUAGCAAAPMRD
ath-miR5018UUAAAGCUCCACCAUGAGUCCAAUPMRD
ath-miR5019UGUUGGGAAAGAAAAACUCUUPMRD
ath-miR5020aUGGAAGAAGGUGAGACUUGCAPMRD
ath-miR5020bAUGGCAUGAAAGAAGGUGAGAPMRD
ath-miR5020cUGGCAUGGAAGAAGGUGAGACPMRD
ath-miR5021UGAGAAGAAGAAGAAGAAAAPMRD
ath-miR5022GUCAUGGGGUAUGAUCGAAUGPMRD
ath-miR5023AUUGGUAGUGGAUAAGGGGGCPMRD
ath-miR5024-5pAUGACAAGGCCAAGAUAUAACAPMRD
ath-miR5024-3pCCGUAUCUUGGCCUUGUCAUUPMRD
ath-miR5025ACUGUAUAUAUGUAAGUGACAPMRD
ath-miR5026ACUCAUAAGAUCGUGACACGUPMRD
ath-miR5027ACCGGUUGGAACUUGCCUUAAPMRD
ath-miR5028AAUUGGGUUUAUGCUAGAGUUPMRD
ath-miR5029AAUGAGAGAGAACACUGCAAAPMRD
ath-miR5628GAAAUAGCGAAGAUAUGAUUAPMRD
ath-miR5629UUAGGGUAGUUAACGGAAGUUAPMRD
ath-miR5630aGCUAAGAGCGGUUCUGAUGGAPMRD
ath-miR5631UGGCAGGAAAGACAUAAUUUUPMRD
ath-miR5632UUGGAUUUAUAGUUGGAUAAGPMRD
ath-miR5633UAUGAUCAUCAGAAAACAGUGPMRD
ath-miR5634AGGGACUUUGUGAAUUUAGGGPMRD
ath-miR5635aUGUUAAGGAGUGUUAACGGUGPMRD
ath-miR5636CGUAGUUGCAGAGCUUGACGGPMRD
ath-miR5637AAUGCGCAACUCUAUAUUUCCPMRD
ath-miR5638aAUACCAAAACUCUCUCACUUUPMRD
ath-miR5638bACAGUGGUCAUCUGGUGGGCUPMRD
ath-miR5639UAGUCCACUGUGGUCUAAGGCPMRD
ath-miR5640UGAGAGAAGGAAUUAGAUUCAPMRD
ath-miR5641UGGAAGAAGAUGAUAGAAUUAPMRD
ath-miR5642aUCUCGCGCUUGUACGGCUUUPMRD
ath-miR5643aAGGCUUUUAAGAUCUGGUUGCPMRD
ath-miR5644GUGGGUUGCGGAUAACGGUAPMRD
ath-miR5645aAUUUGAGUCAUGUCGUUAAGPMRD
ath-miR5645cAACCUAUUUAACGACAUGACUPMRD
ath-miR5646GUUCGAGGCACGUUGGGAGGPMRD
ath-miR5647UCAAGUUUGAUGACGAUUCCAPMRD
ath-miR5648-5pUUUGGAAAUAUUUGGCUUGACUPMRD
ath-miR5648-3pAUCUGAAGAAAAUAGCGGCAUPMRD
ath-miR5649aAUUGAAUAUGUUGGUUACUAUPMRD
ath-miR5650UUGUUUUGGAUCUUAGAUACAPMRD
ath-miR5651UUGUGCGGUUCAAAUAGUAACPMRD
ath-miR5652UUGAAUGUGAAUGAAUCGGGCPMRD
ath-miR5653UGGGUUGAGUUGAGUUGAGUUGGCPMRD
ath-miR5654AUAAAUCCCAACAUCUUCCAPMRD
ath-miR5655AAGUAGACACAUAAGAAGGAGPMRD
ath-miR5656ACUGAAGUAGAGAUUGGGUUUPMRD
ath-miR5657UGGACAAGGUUAGAUUUGGUGPMRD
ath-miR5658AUGAUGAUGAUGAUGAUGAAAPMRD
ath-miR5659CGAUGAAGGUCUUUGGAACGGUAPMRD
ath-miR5660CAGGUGGUUAGUGCAAUGGAAPMRD
ath-miR5661AGAGGUACAUCAUGUAGUCUGPMRD
ath-miR5662AGAGGUGACCAUUGGAGAUGPMRD
ath-miR5663AGCUAAGGAUUUGCAUUCUCAPMRD
ath-miR5664AUAGUCAAUUUUAUCGGUCUGPMRD
ath-miR5665UUGGUGGACAAGAUCUGGGAUPMRD
ath-miR5666AUGGGACAUCGAGCAUUUAAUPMRD