PmiRExAt expression matrix was developed by downloading plant small RNA public datasets (comprising in total 4.2 billion+ sequence reads, occupying more than 3.7 Terabyte+ disk space ) and multi-step computational analysis accelerated by using in-house HPC facility.
PmiRExAt users can do desired data-mining in this rich processed resource.

GEO AccessionSRA_IDRead_lengthreadsOrganism, Cultivar, strainTissueDevelopmental stage, treatmentTechnique/Plateform
GSM723050SRR203492333064285Triticum aestivumwhole plant(Polyploid BBAADD)NAIllumina Genome Analyzer
GSM723049SRR203491355633938Triticum aestivumwhole plant(Hybrid BAD)NAIllumina Genome Analyzer
GSM723048SRR203490353458759Aegilops tauschii, TQ113whole plant (parent DDNAIllumina Genome Analyzer
GSM723047SRR203489356421516Triticum durum & Langdon TTR16whole plant (parent BBAA)NAIllumina Genome Analyzer
GSM675617SRR101432355345419Triticum aestivum(TAM (insensitive to heat stress))wheat young leaf,Powdery mildew infection and heat stress (40C)age: two week old, time: 1 hoursIllumina Genome Analyzer
GSM675616SRR101431354788035Triticum aestivum(CK (insensitive to heat stress))wheat young leaf(control)age: two week old, time: 0 hoursIllumina Genome Analyzer
GSM675615SRR101430353561620Triticum aestivum(pm30 (resistant to wheat powdery mildew also designed as R))wheat young leaf(infection: powdery mildew)age: two week old, time: 12 hoursIllumina Genome Analyzer
GSM675614SRR101429354247671Triticum aestivum(pm30 (resistant to wheat powdery mildew also designed as R))wheat young leaf(control)age: two week old, time: 0 hoursIllumina Genome Analyzer
GSM675613SRR101428354475222Triticum aestivum(8866 (susceptible to wheat powdery mildew,also designed as S))wheat young leaf(infection: powdery mildew)age: two week old, time: 12 hoursIllumina Genome Analyzer
GSM675612SRR101427353053266Triticum aestivum(8866 (susceptible to wheat powdery mildew,also designed as S))wheat young leaf(control)age: two week old, time: 0 hoursIllumina Genome Analyzer
GSM548032SRR0574064118118348Triticum aestivum, BobwhiteFlag-leaves, NAM-RNAi(rnai: no apical meristem (NAM))developmental stage: 12 days after anthesisIllumina Genome Analyzer
GSM903670SRR4493703511434861Triticum aestivumspike tissues(control)developmental stage: anther length ~ 3.0 mmIllumina Genome Analyzer
GSM903669SRR4493693513474821Triticum aestivumspike tissues(control)developmental stage: anther length ~ 2.2 mmIllumina Genome Analyzer
GSM903668SRR4493683511727937Triticum aestivumspike tissues(control)developmental stage: anther length ~ 1.5 mmIllumina Genome Analyzer
GSM903667SRR4493673513108272Triticum aestivumspike tissues(Cold treatment)developmental stage: anther length ~ 3.0 mmIllumina Genome Analyzer
GSM903666SRR4493663513151774Triticum aestivumspike tissues(Cold treatment)developmental stage: anther length ~ 2.2 mmIllumina Genome Analyzer
GSM903665SRR449365352218288Triticum aestivumspike tissues(Cold treatment)developmental stage: anther length ~ 1.5 mmIllumina Genome Analyzer
GSM903664SRR4493643513542483Triticum aestivumspike tissues(control against cold stress)developmental stage: anther length ~ 1.0 mmIllumina Genome Analyzer
SRX257225SRR8001585087743861Triticum aestivum, HD2985/HD2329Generic samplepollination stage/42degree heat stressIllumina HiSeq 2000
SRX257224SRR80015750110896604Triticum aestivum, HD2985Generic samplepollination stage/42degree heat stressIllumina HiSeq 2000
SRX005297SRR017199352636966Triticum aestivum ,Chinese Springroot, shoot, leaf, young spikeNAIllumina Genome Analyzer II

GEO Accession/SampleSRA_IDRead_lengthReadsSpecies/OrganismGenotype/Cultivar/strainTissueDev.stage/treatmentTechnique/Plateform
GSM1493824SRR156161040749665Arabidopsis thalianaFLAG-AGO1/ago1-36systemic leaves after mock infectionNAIllumina
GSM1493825SRR1561611406668379Arabidopsis thalianaFLAG-AGO1/ago1-36systemic leaves after virus infectionNAIllumina
GSM1493826SRR156161240832749Arabidopsis thalianaHA-AGO2systemic leaves after mock infectionNAIllumina
GSM1493827SRR1561613403236795Arabidopsis thalianaHA-AGO2systemic leaves after virus infectionNAIllumina
GSM1495677SRR1567670465909060Arabidopsis thalianawild typeinflorescenceNAIllumina
GSM1495678SRR1567671465927024Arabidopsis thalianaddm1-2 +/-InflorescenceNAIllumina
GSM1495679SRR1567672465990865Arabidopsis thalianawild typePollenNAIllumina
GSM1495680SRR1567673465513362Arabidopsis thalianawild typeSpermNAIllumina
GSM1504378SRR1575168509365194 Arabidopsis thalianaNAseedlingNAIllumina
GSM1504379SRR1575169507545079 Arabidopsis thalianaNAseedlingNAIllumina
GSM277608SRR013343369777592 Arabidopsis thalianaColumbia-0 wild typeunopened flower budsunopened flower budsIllumina
GSM277610SRR013344368369324 Arabidopsis thalianadrm1-2 drm2-2 cmt3-11 null mutantunopened flower budsunopened flower budsIllumina
GSM277609SRR013345369688456 Arabidopsis thalianamet1-3 null mutantunopened flower budsunopened flower budsIllumina
GSM277611SRR0133463613401678 Arabidopsis thalianaros1-3 dml2-1 dml3-1 null mutantunopened flower budsunopened flower budsIllumina
GSM343002SRR014255364998881Arabidopsis thalianaago1-25 homozygousinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM343004SRR014256364762471Arabidopsis thalianaago1-25 homozygousinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM343005SRR014257363853582Arabidopsis thalianaago1-25 homozygousinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM342999SRR014258363335442Arabidopsis thalianawild typeinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM343000SRR014259363023839Arabidopsis thalianawild typeinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM343001SRR014260363072591Arabidopsis thalianawild typeinflorescence flower stages 1-12stages 1-12ILLUMINA
GSM366865SRR019670362683276Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM366866SRR019671363722059Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM366867SRR019672362755969Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM366868SRR019674364917809Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM366869SRR019675364869207Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM366870SRR019676364857305Arabidopsis thalianaNAWhole aerial tissue, boltingboltingILLUMINA
GSM424847SRR029634362550664Arabidopsis thalianaNAwhole root tissueNAILLUMINA
GSM424848SRR029635362998711Arabidopsis thalianaNAwhole root tissueNAILLUMINA
GSM442932SRR032112335142120Arabidopsis thalianaCol0rootNAILLUMINA
GSM442933SRR032113334919514Arabidopsis thalianaCol0rootNAILLUMINA
GSM442934SRR032114334862947Arabidopsis thalianaCol0shootNAILLUMINA
GSM442935SRR032115335003481Arabidopsis thalianaCol0shootNAILLUMINA
GSM451894SRR034856352012409Arabidopsis lyrataNArosette leaves8weekILLUMINA
GSM456944SRR036391365932555Arabidopsis thalianaIWR1-type transcription factor mutant, dms4Mixed stage inflorescense tissueNAILLUMINA
GSM456945SRR036392366877795Arabidopsis thalianatrasngenic wild type plant (contains trigger and silencer transgenes)Mixed stage inflorescense tissueNAILLUMINA
GSM512702SRR036640366209409Arabidopsis thalianaNAleavesNAILLUMINA
GSM512703SRR036641366820002Arabidopsis thalianaNAleavesNAILLUMINA
GSM518438SRR037653447448439Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518439SRR037654446974947Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518440SRR037655446515639Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518441SRR037656446368305Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518442SRR037657447713132Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518443SRR0376583610155795Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518444SRR037659368910593Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518445SRR0376603613412834Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518446SRR0376613612232803Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518447SRR0376623612952639Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518448SRR0376633616516992Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518449SRR0376643616602871Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518450SRR0376653616927085Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518451SRR0376663616621385Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518452SRR0376673614971246Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518453SRR0376683615639695Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518454SRR0376693615667039Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518455SRR0376703615586488Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518456SRR0376713614231111Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518457SRR0376723613437641Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518458SRR0376733613192570Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518459SRR0376744218862426Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518460SRR0376753615770499Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518461SRR0376763616061231Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518462SRR0376773616159499Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518463SRR0376783614837074Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518464SRR0376793616035010Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518465SRR0376803616240880Arabidopsis thalianaNAroot total RNANAILLUMINA
GSM518466SRR0376813615859520Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM518467SRR0376823616285675Arabidopsis thalianaNAshoot total RNANAILLUMINA
GSM554062SRR058435368955844Arabidopsis thalianaCol-0 pAGO1:HA-AGO1FlowersNAABI Solid
GSM554063SRR0584363610148884Arabidopsis thalianaCol-0 pAGO1:HA-AGO1FlowersNAILLUMINA
GSM554064SRR05843736999185Arabidopsis thalianaCol-0 pAGO1:HA-AGO1FlowersNAILLUMINA
GSM554065SRR058438363486324Arabidopsis thalianaCol-0 pAGO1:HA-AGO1FlowersNAILLUMINA
GSM575246SRR0649823817340638Arabidopsis thalianawild-typeunopened flower buds, wild-type, smRNAunopened flower budsILLUMINA
GSM575247SRR0649833818850891Arabidopsis thalianardr6 mutantunopened flower buds, rdr6, smRNAunopened flower budsILLUMINA
GSM622040SRR0729573913500617Arabidopsis thalianaNAdissected seedsNAILLUMINA
GSM622041SRR0729583913034265Arabidopsis thalianaNAdissected seedsNAILLUMINA
GSM622042SRR0729593913061256Arabidopsis thalianaNAdissected seedsNAILLUMINA
GSM622043SRR0729603913569218Arabidopsis thalianaNAdissected seedsNAILLUMINA
GSM622044SRR0729613911301808Arabidopsis thalianaNArosette leavesNAILLUMINA
GSM622045SRR072962393963977Arabidopsis thalianaNArosette leavesNAILLUMINA
GSM622046SRR0729633914316771Arabidopsis thalianaNArosette leavesNAILLUMINA
GSM622047SRR0729643913179977Arabidopsis thalianaNArosette leavesNAILLUMINA
GSM1257922SRR1023813509966020Arabidopsis thalianaWild typefloral tissueNAILLUMINA
GSM1257923SRR10238145028656520Arabidopsis thalianaWild typefloral tissueNAILLUMINA
GSM1257924SRR10238155025414643Arabidopsis thalianasuvh2 suvh9floral tissueNAILLUMINA
GSM1257925SRR10238165030682869Arabidopsis thalianaWild typefloral tissueNAILLUMINA
GSM1257926SRR10238175033646518Arabidopsis thalianaWild typefloral tissueNAILLUMINA
GSM1257927SRR10238185033395225Arabidopsis thalianasuvh2 suvh9floral tissueNAILLUMINA
GSM1257934SRR102382550254317751Arabidopsis thalianaWild type w/ Flag-ZincFinger-KRYPTONITE transgene3 week leaf tissue3weekILLUMINA
GSM1257937SRR102382850173273541Arabidopsis thalianaWild type w/ ZincFinger-SUVH2 transgene (BASTA resistant T2 generation)3 week leaf tissue3weekILLUMINA
GSM1257938SRR102382950188315802Arabidopsis thalianaWild type w/ ZincFinger-SUVH2 transgene (BASTA resistant T3 generation)3 week leaf tissue3weekILLUMINA
GSM1257939SRR102383050120048009Arabidopsis thalianasuvh2 suvh93 week leaf tissue3weekILLUMINA
GSM1276517SRR10399305046449680Arabidopsis thalianaCol-0 female X Col-0 malewhole seedsNAILLUMINA

GEO AccessionSRA_IDRead_lengthReadsOrganismCultivarTissueDev. Stage/TreatmentPlateform/technique
GSM417540SRR037746356148861Oryza sativaNAAll 8 tisssuessample pooled from callus,seedling shoot,seedling root,tillering leaf,flowering panicle,flowering leaf,filling panicle and booting panicleIllumina Genome Analyzer
GSM1093499SRR7714953622109226Oryza sativaCultivar Nipponbare RRGRootNAIllumina Genome Analyzer IIx
GSM1093498SRR7714943621009952Oryza sativaCultivar Nipponbare RRFRootNAIllumina Genome Analyzer IIx
GSM960650SRR5212674029963016Oryza rufipogonstrain: dongxiangroot4-leaf stage seedlingIllumina HiSeq 2000
GSM701900SRR1728454219551591Oryza glaberrimaCG14rootNAIllumina Genome Analyzer II
ERX013628ERR0357803512663429Oryza sativaNAseedling roottwo-weeksIllumina Genome Analyzer
GSM1093501SRR7714973625954323Oryza sativaCultivar Nipponbare RSGshootNAIllumina Genome Analyzer IIx
GSM1093500SRR7714963624449511Oryza sativaCultivar Nipponbare RSFshootNAIllumina Genome Analyzer IIx
GSM1081572SRR7113215019781468Oryza sativagenotype: Spin1 RNAi,ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081571SRR7113205020558370Oryza sativagenotype: Pi9, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081570SRR7113195017662028Oryza sativagenotype: PiZt 11, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081569SRR7113185029401724Oryza sativagenotype: PiZt 11, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081568SRR7113175025823875Oryza sativagenotype: PiZt 11, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081567SRR7113165023678769Oryza sativagenotype: PiZt 11, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081566SRR7113155026509789Oryza sativagenotype: PiZt 11, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081565SRR7113145020075564Oryza sativagenotype: wild type, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081564SRR7113135022206215Oryza sativagenotype: wild type, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1081563SRR7113125027667984Oryza sativagenotype: wild type, ecotype: NipponbareLeafNAIllumina HiSeq 2000
GSM1059887SRR6438803612112303Oryza sativastrain: controlLeaftreatment Mock inoculated rice leafIllumina Genome Analyzer II
GSM960649SRR5212664036137468Oryza rufipogonstrain: dongxiangLeaf4-leaf stage seedlingIllumina HiSeq 2000
GSM701899SRR1728444219746665Oryza glaberrimaCG14LeafNAIllumina Genome Analyzer II
ERX013630ERR0357793528531082Oryza sativaNALeaftwo-weeks seedlingIllumina Genome Analyzer
SRX007338SRR020462356899410Oryza sativastrain:SARII-658flag leavesabout 120 days-flowering stage/Leaf-AutotriploidIllumina Genome Analyzer II
SRX007337SRR020461357956301Oryza sativastrain:SARII-659flag leavesabout 120 days-flowering stage/Leaf-DiploidIllumina Genome Analyzer II
GSM701901SRR1728464220605531Oryza glaberrimaCultivar: CG14panicleNAIllumina Genome Analyzer II
SRX272936SRR836262506035812Oryza sativastrain:CL 161, CL 151panicleinteraction/pathogenesis between rice and B. glumaeIllumina HiSeq 2000
SRX272936SRR836263504999318Oryza sativastrain:CL 161, CL 152panicleinteraction/pathogenesis between rice and B. glumaeIllumina HiSeq 2000
SRX272936SRR836265507460139Oryza sativastrain:CL 161, CL 153panicleinteraction/pathogenesis between rice and B. glumaeIllumina HiSeq 2000
SRX272936SRR836267508135056Oryza sativastrain:CL 161, CL 154panicleinteraction/pathogenesis between rice and B. glumaeIllumina HiSeq 2000
GSM722128SRR2030394013702553Oryza sativasubspecies: Variety: Guichao No.2Male gametophytetricellular pollen (TCP) stageIllumina Genome Analyzer II
ERX013629ERR035782356450464Oryza sativaNAPOLLEN(ANTHER)uninucleate microspores released from tetradIllumina Genome Analyzer
ERX013632ERR0357813514952272Oryza sativaNAPOLLEN(ANTHER)pollen granins after PMII but dehydroded( tricellular pollen (TCP))Illumina Genome Analyzer
ERX013633ERR0357773513497446Oryza sativaNAPOLLEN(ANTHER)pollen granins before PMII and after PMI(bicellular pollen (BCP))Illumina Genome Analyzer
ERX013631ERR0357783514009265Oryza sativaNAcallus of seedlingone month seedlingIllumina Genome Analyzer
GSM1093510SRR77150650140569462Oryza sativaF1 Cultivar Kitaake x Cultivar NipponbareEmbryoNAIllumina HiSeq 2000
GSM1093508SRR77150450140806848Oryza sativaF1 Cultivar Kitaake x Cultivar NipponbareEmbryoNAIllumina HiSeq 2000
GSM1093505SRR7715013626849384Oryza sativaCultivar Kitaake KEAEmbryoNAIllumina Genome Analyzer IIx
GSM1093503SRR7714993626233129Oryza sativaCultivar Nipponbare (Genetic background-KitaakeEmbryoNAIllumina Genome Analyzer IIx
GSM1093511SRR77150750129760391Oryza sativaF1 Cultivar Kitaake x Cultivar NipponbareenodspermNAIllumina HiSeq 2000
GSM1093509SRR77150550145223430Oryza sativaF1 Cultivar Kitaake x Cultivar NipponbareenodspermNAIllumina HiSeq 2000
GSM1093504SRR7715003625438641Oryza sativaCultivar Kitaake KNAEndospermNAIllumina Genome Analyzer IIx
GSM1093502SRR7714983622605850Oryza sativaCultivar Nipponbare NNAEndospermNAIllumina Genome Analyzer IIx
GSM571078SRR062266355992373Oryza sativastrain: indica 93-11,seedlings12day-old, H2O2-treated rice seedlingsIllumina Genome Analyzer
GSM571077SRR062265356320531Oryza sativastrain: indica 93-11seedlings12day-old,controlIllumina Genome Analyzer
GSM455965SRR032102355906338Oryza sativaNAseedlingNAIllumina Genome Analyzer
GSM455964SRR032101355785292Oryza sativaNAseedlingNAIllumina Genome Analyzer
GSM455963SRR032100355743102Oryza sativaNAseedlingNAIllumina Genome Analyzer
GSM455962SRR032099355333429Oryza sativaNAseedlingNAIllumina Genome Analyzer
SRX272880SRR836206507041397Oryza sativastrain:CL 161, CL 151seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836208507123257Oryza sativastrain:CL 161, CL 152seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836212506149533Oryza sativastrain:CL 161, CL 153seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836231506002241Oryza sativastrain:CL 161, CL 154seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836233506284807Oryza sativastrain:CL 161, CL 155seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836238506523780Oryza sativastrain:CL 161, CL 156seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836241506326214Oryza sativastrain:CL 161, CL 157seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
SRX272880SRR836245508036732Oryza sativastrain:CL 161, CL 158seedlingInoculation of B. glumae at the seedling stageIllumina HiSeq 2000
ERX014997ERR0376953525417406Oryza sativaSample-SKU-sd-L8seedling14 Days /normalIllumina Genome Analyzer IIx
ERX014994ERR0376913524488555Oryza sativaSample: SKU-DT-L4seedling14 Days /Draught stressIllumina Genome Analyzer IIx
ERX014992ERR0376933525619267Oryza sativaSample: SKU-ST-L2seedling14 Days /Salt stressIllumina Genome Analyzer IIx
ERX014991ERR0376923523635005Oryza sativaSample: SKU-ST-L1,Oryza sativa cv. Nipponbare seedsseedling14 Days /Salt stressIllumina Genome Analyzer IIx
ERX014990ERR0376903525704250Oryza sativaOryza sativa cv. Nipponbare seeds, SKU-DT-L3,drought stressseedling14 Days /Draught stressIllumina Genome Analyzer IIx
ERX014988ERR0376893525705840Oryza sativaOryza sativa cv. Nipponbare,Sample: SKU-CD-L6,cold stressseedling14 Days /Cold stressIllumina Genome Analyzer IIx
ERX014987ERR0376943523265785Oryza sativaOryza sativa cv. Nipponbare, SKU-sd-L7, 14 day,normal conditionseedling14 Days /normalIllumina Genome Analyzer IIx

GEO Accession/SampleSRA_IDRead_lengthReadsSpecies/OrganismCultivar/strainTissueDev.stage/treatmentTechnique/Plateform
GSM1161950SRR899547345572730Zea maysstrain: UENF 506-9whole plantseven days cultivation, inoculated with diazothrophic bacteriaIllumina Genome Analyzer IIx
GSM1161949SRR899546343057004Zea maysstrain: UENF 506-8whole plantseven days cultivation,controlIllumina Genome Analyzer IIx
SRX222265SRR7684874914847590Zea mayssubsp. maysroot tips15 days seedling,low nitrateIllumina HiSeq 2000
SRX222267SRR7684854942323839Zea mayssubsp. maysroot tips15 days seedling,optimal nitrateIllumina HiSeq 2000
SRX066098SRR2183198027034971Zea maysgenotype: B73primary root tip3 days after germinationIllumina Genome Analyzer II
GSM918109SRR48877540419583Zea maysGENOTYPE: Mo17seedling shoot apex,shoot apex14 days after sowing (3-4 leaf stage)Illumina HiSeq 2000
GSM918108SRR488774401766118Zea maysgenotype: B73seedling shoot apex,shoot apex14 days after sowing (3-4 leaf stage)Illumina HiSeq 2000
GSM918107SRR488773361357875Zea maysgenotype: B73xMo17seedling shoot apex,shoot apex11 days after sowing (3-4 leaf stage)Illumina Genome Analyzer
GSM918106SRR488772361157013Zea maysgenotype: B73xMo17seedling shoot apex,shoot apex11 days after sowing (3-4 leaf stage)Illumina Genome Analyzer
GSM918105SRR488771366595308Zea maysGENOTYPE: Mo17seedling shoot apex,shoot apex11 days after sowing (3-4 leaf stage)Illumina Genome Analyzer
GSM918104SRR48877036377420Zea maysgenotype: B73seedling shoot apex,shoot apex11 days after sowing (3-4 leaf stage)Illumina Genome Analyzer
GSM1178887SRR9242845050282916Zea maysgenotype/variation: wild type, background: B73Seedling leaf(control)seedlings at the five week stageIllumina HiSeq 2000
GSM1178886SRR9242835036577453Zea maysgenotype/variation: hen1-1, background: B73xW22Seedling leafseedlings at the five week stageIllumina HiSeq 2001
GSM433620SRR0340963311285708Zea maysvariety: B73 (wild type)leafage at harvest: 6-weeks-old seedlingsIllumina Genome Analyzer II
SRX222263SRR768489494312641Zea mayssubsp. maysleaves15 days seedling,low nitrateIllumina HiSeq 2000
SRX222261SRR768492494192917Zea mayssubsp. maysleaves15 days seedling,optimal nitrateIllumina HiSeq 2000
GSM918115SRR48878136208981Zea maysgenotype: B73xMo17female inflorescence,developing earV12 growth stageIllumina Genome Analyzer IIx
GSM918114SRR48878036196369Zea maysGENOTYPE: Mo17female inflorescence,developing earV12 growth stageIllumina Genome Analyzer IIx
GSM918113SRR48877936142489Zea maysgenotype: B73female inflorescence, B73/developing earV12 growth stageIllumina Genome Analyzer IIx
GSM918112SRR48877836102757Zea maysgenotype: B73xMo17female inflorescence,developing earV12 growth stageIllumina Genome Analyzer IIx
GSM918111SRR4887773629154Zea maysGENOTYPE: Mo17female inflorescence,developing earV12 growth stageIllumina Genome Analyzer IIx
GSM918110SRR48877636502516Zea maysgenotype: B73female inflorescence,developing earV12 growth stageIllumina Genome Analyzer IIx
GSM767915SRR3171943528124721Zea mayscultivar: W23anthers2mm anthers, environment: field-grownIllumina Genome Analyzer IIx
GSM767914SRR3171933328617970Zea mayscultivar: W23anthers1.5mm anthers, environment: field-grownIllumina Genome Analyzer IIx
GSM767913SRR317192336433541Zea mayscultivar: W23anthers1.0mm anthers, environment: field-grownIllumina Genome Analyzer IIx
GSM433622SRR0340983313481331Zea maysvariety: B73 (wild type)Male inflorescence (tassels)8-week old plants, pre-meiotic stageIllumina Genome Analyzer IIx
GSM433621SRR0340973322090894Zea maysvariety: B73 (wild type)Female inflorescence (ears)10- and 11-week old plants, post-meiotic stageIllumina Genome Analyzer II
GSM448857SRR0320913632561734Zea maysSTRAIN: B73Total RNA from maize tassel tissuesNAIllumina Genome Analyzer
GSM448856SRR032090363057004Zea maysSTRAIN: B73Total RNA from maize seedling tissuesNAIllumina Genome Analyzer
GSM448855SRR032089365572730Zea maysSTRAIN: B73Total RNA from maize root tissuesNAIllumina Genome Analyzer
GSM448854SRR0320883636577453Zea maysSTRAIN: B73Total RNA from maize pollen tissuesNAIllumina Genome Analyzer
GSM448853SRR0320873650282916Zea maysSTRAIN: B73Total RNA from maize ear tissuesNAIllumina Genome Analyzer
GSM1091767SRR768251338327428Zea maysinbred line: B73pollinated silksSilks with approximately 5 cm out of the bractsIllumina Genome Analyzer IIx
GSM1091766SRR768250339173416Zea maysinbred line: B73mature silksSilks with approximately 5 cm out of the bractsIllumina Genome Analyzer IIx
GSM1091765SRR7682493311133002Zea maysinbred line: B73in-vitro germinated pollensSilks with approximately 5 cm out of the bractsIllumina Genome Analyzer IIx
GSM1091764SRR768248336433541Zea maysinbred line: B73mature pollenNAIllumina Genome Analyzer IIx
SRX120259SRR40879351188811Zea maysinbred B73unfertilized outer earNAIllumina HiSeq 2001
GSM958940SRR5211403628617970Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958939SRR5211393628124721Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52112618208981Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52112727196369Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52112828142489Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52112929102757Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR5211303029154Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52113119502516Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52113220419583Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR521133211766118Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR521134221357875Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR521135231157013Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR521136246595308Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52113725377420Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958938SRR52113826188811Zea maysstrain: Mo175-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958937SRR5211253629152926Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958936SRR5211243628732589Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52111118277098Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52111227166799Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR5211132863336Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR5211142935863Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR5211153013287Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52111619486942Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52111720519332Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR521118211949898Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR521119221669859Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR521120231293477Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR521121247198356Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52112225405268Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer
GSM958935SRR52112326208821Zea maysSTRAIN: B735-day-old coleoptyle5-day-oldIllumina Genome Analyzer

1859wheatknownmiRfrommiRBAse+PMRD+publicationmiRmiR_sequencedatabase name
tae-miR1127UCCUUCCGUUCGGAAUUACPMRD
tae-miR1131UAGUACCGGUUCGUGGCUAACCPMRD
tae-miR164UGGAGAAGCAGGGCACGUGCAPMRD
tae-miR5084AUACAGUACUGCAGAGGAUCCUAAPMRD
tae-miR1138GCUUAGAUGUGACAUCCUUAAAAPMRD
tae-miR444aUUGCUGCCUCAAGCUUGCUGCmiRBase.V20
tae-miR395bUGAAGUGUUUGGGGGAACUCmiRBase.V20
tae-miR156UGACAGAAGAGAGUGAGCACAmiRBase.V20
tae-miR1118CACUACAUUAUGGAAUGGAGGGAPMRD
tae-miR160UGCCUGGCUCCCUGUAUGCCAPMRD
tae-miR398UGUGUUCUCAGGUCGCCCCCGPMRD
tae-miR159aUUUGGAUUGAAGGGAGCUCUGPMRD
tae-miR171bCGAUUGAGCCGUGCCAAUAUCPMRD
tae-miR1139AGAGUAACAUACACUAGUAACAPMRD
tae-miR1130CCUCCGUCUCGUAAUGUAAGACGPMRD
tae-miR1120ACAUUCUUAUAUUAUGAGACGGAGPMRD
tae-miR395aGUGAAGUGUUUGGGGGAACUCmiRBase.V20
tae-miR399UGCCAAAGGAGAAUUGCCCPMRD
tae-miR171aUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
tae-miR1129CAGCGAGCCAGCGGAGACCGGCAGPMRD
tae-miR1133CAUAUACUCCCUCCGUCCGAAAPMRD
tae-miR408CUGCACUGCCUCUUCCCUGGCPMRD
tae-miR1125AACCAACGAGACCAACUGCGGCGGPMRD
tae-miR167aUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
tae-miR1128UACUACUCCCUCCGUCCGAAAPMRD
tae-miR1119UGGCACGGCGUGAUGCUGAGUCAGPMRD
tae-miR167bUGAAGCUGACAGCAUGAUCUAmiRBase.V20
tae-miR5086ACAUUGGUGGAAGGCGUGGUAmiRBase.V20
tae-miR1134CAACAACAACAAGAAGAAGAAGAUPMRD
tae-miR1123UCCGUGAGACCUGGUCUCAUAGAPMRD
tae-miR5085AAGGACAUUUUUUGUGGCCUGmiRBase.V20
tae-miR1135CUGCGACAAGUAAUUCCGAACGGAPMRD
tae-miR1121AGUAGUGAUCUAAACGCUCUUAPMRD
tae-miR1122UAGAUACAUCCGUAUCUAGAPMRD
tae-miR1124GCAGGACGUGAAGAGCGAGUCCPMRD
tae-miR319UUGGACUGAAGGGAGCUCCCUmiRBase.V20
tae-miR1117UAGUACCGGUUCGUGGCACGAACCPMRD
tae-miR169GGGCAAGUCACCCUGGGCUACCmiRBase.V20
tae-miR1137UAGUACAAAGUUGAGUCAUCPMRD
tae-miR1136UUGUCGCAGGUAUGGAUGUAUCUAPMRD
tae-miR1126UCCACUAUGGACUACAUACGGAGPMRD
tae-miR1132CAUUAUGGAACGGAAGGAGPMRD
tae-miR156aUGACAGAAGAGAGAGAGCACPMRD
tae-miR166CCGGACCAGGCUUCAUUCCCAPMRD
tae-miR171cUAAUUGAGCCGCGCCCAUAUCPMRD
tae-miR172aAGAAUCCUGAUGAUGCUGCAGPMRD
tae-miR172cAGGAUCUUGAUGAUGCUGCAGPMRD
tae-miR2001CGCUCGCCGGAGCAGCGUGCAPMRD
tae-miR2002UGAGAUGAGAUUACCCCAUACPMRD
tae-miR2003CGGUUGGGCUGUAUGAUGGCGAPMRD
tae-miR2004UUUGUUUUUAUGUUAUUUUGUGAAPMRD
tae-miR2005GGGUGUAUAGCUCAGUUGGPMRD
tae-miR2006UACCACGACUGUCAUUAAGCAPMRD
tae-miR2007CAAGAUAUUGGGUAUUUCUGUCPMRD
tae-miR2008GACUCCGUGGCCCAAUGGAPMRD
tae-miR2009aUGAGAAGGUAGAUCAUAAUAGCPMRD
tae-miR2009bUUAGAUGAGAAGGCAGAUCAUAPMRD
tae-miR2009cUCAGAUGAGAAGGCAGAUCAUAAUAPMRD
tae-miR2010UGUGCGCAAUAAGAUUUUGCUAPMRD
tae-miR2011UGCAGUGGCAUAUGCAACUCUPMRD
tae-miR2012UUGGACGAGGAUGUGCAACUGPMRD
tae-miR2013UUGAACGACCUCACCAUGUCGPMRD
tae-miR2014AGCAAACAUAUCUGAGCACAPMRD
tae-miR2015UGCAUCAUCUCGAACUCGUCGPMRD
tae-miR2016UGACCCUGAGGCACUCAUACCGPMRD
tae-miR2017CUUAUGCAACGUCUGAGGAUPMRD
tae-miR2018GCCCGUCUAGCUCAGUUGGUPMRD
tae-miR2019CGGGUCGGCGCUGCACGCGGCPMRD
tae-miR2020AUAGCAUCAUCCAUCCUACCAPMRD
tae-miR2021UUUUGUCACAUAUAAUACAUAPMRD
tae-miR2022UGGCCAAGGUCUCUUGAGGCUPMRD
tae-miR2023aUUUUGCCGGUUGAACGACCUCAPMRD
tae-miR2023bUUUUGCUGGUUGAACGACCUCAPMRD
tae-miR2023cUUUUGCCGGUUGAUCGACCUCAPMRD
tae-miR2024aGCAGUUGCUGUCUCAAGCUUPMRD
tae-miR2024bUGCAGUUGCUGCCUCAAGCUUPMRD
tae-miR2025GUGUUCUCAGGUCGCCCCCGCPMRD
tae-miR2026UGGCCGUUGGUAGAGUAGGAGAPMRD
tae-miR2027GUAUUAGGUUGGUCAAAUUGACGAPMRD
tae-miR2028UAGCUGUGCUUUCAGCAAGAAPMRD
tae-miR2029UUGAGUGCAGCGUUGAUGAACPMRD
tae-miR2030CAGGGCGGGGAACAGGUGGCCPMRD
tae-miR2031AUAAGCACCGGUGCUUAAGAAPMRD
tae-miR2032UGUAGAUACUCCCUAAGGCUUPMRD
tae-miR2033aUAUUUCUUUACAGAGGGAGUAPMRD
tae-miR2033bUAUUUCUUUACAGAAGGAGUAPMRD
tae-miR319aUUGGACUGAAGGGAGCUCCCPMRD
tae-miR319bUUGGAGUGAAGGGAGCUCCAPMRD
tmo-miR1120CUCUGUAAACUAAUAUAAGPMRD
tmo-miR1122UACUCCCUCCGUCCCAAAAUUGUUPMRD
ttu-miR160bUGCCUGGCUCCCUGUAUGCCUPMRD
tur-miR1122UACUCCUUUUGUCCUAAAAUUUGUPMRD
ata-miR169UAGCCAAGGAUGAAUUGCCAGTang, Z. et al. (2012)
ath-miR157aUUGACAGAAGAUAGAGAGCACTang, Z. et al. (2012)
ath-miR165aUCGGACCAGGCUUCAUCCCCCTang, Z. et al. (2012)
ath-miR167dUGAAGCUGCCAGCAUGAUCUGGTang, Z. et al. (2012)
ath-miR169aCAGCCAAGGAUGACUUGCCGATang, Z. et al. (2012)
ath-miR169bCAGCCAAGGAUGACUUGCCGGTang, Z. et al. (2012)
ath-miR171aUGAUUGAGCCGCGCCAAUAUCTang, Z. et al. (2012)
ath-miR172aAGAAUCUUGAUGAUGCUGCAUTang, Z. et al. (2012)
ath-miR172eGGAAUCUUGAUGAUGCUGCAUTang, Z. et al. (2012)
ath-miR394aUUGGCAUUCUGUCCACCUCCTang, Z. et al. (2012)
ath-miR396aUUCCACAGCUUUCUUGAACUGTang, Z. et al. (2012)
ath-miR399bUGCCAAAGGAGAGUUGCCCUGTang, Z. et al. (2012)
bdi-miR319b-3pUUGGACUGAAGGGUGCUCCCUTang, Z. et al. (2012)
cpa-miR160dUGCCUGGCUCCCUGAAUGCCATang, Z. et al. (2012)
cpa-miR167cUGAAGCUGCCAGCAUGAUCUUTang, Z. et al. (2012)
cpa-miR167dUGAAGCUGCCAGCAUGAUCUGATang, Z. et al. (2012)
crt-miR166bUCGGACCAGGCUUCAUUCCCUUTang, Z. et al. (2012)
csi-miR166aUCGGACCAGGCUUCAUUCCCCCTang, Z. et al. (2012)
gma-miR167cUGAAGCUGCCAGCAUGAUCUGTang, Z. et al. (2012)
gma-miR172fAGAAUCUUGAUGAUGCUGCATang, Z. et al. (2012)
gma-miR408dUGCACUGCCUCUUCCCUGGCTang, Z. et al. (2012)
mtr-miR166bUCGGACCAGGCUUCAUUCCUATang, Z. et al. (2012)
mtr-miR166cUCGGACCAGGCUUCAUUCCUCTang, Z. et al. (2012)
osa-miR1432-5pAUCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
osa-miR1436ACAUUAUGGGACGGAGGGAGUTang, Z. et al. (2012)
osa-miR160a-3pGCGUGCAAGGAGCCAAGCAUGTang, Z. et al. (2012)
osa-miR164dUGGAGAAGCAGGGCACGUGCUTang, Z. et al. (2012)
osa-miR166a-5pGGAAUGUUGUCUGGUUCAAGGTang, Z. et al. (2012)
osa-miR166b-5pGGAAUGUUGUCUGGCUCGGGGTang, Z. et al. (2012)
osa-miR166e-3pUCGAACCAGGCUUCAUUCCCCTang, Z. et al. (2012)
osa-miR166k-3pUCGGACCAGGCUUCAAUCCCUTang, Z. et al. (2012)
osa-miR166mUCGGACCAGGCUUCAUUCCCUTang, Z. et al. (2012)
osa-miR168a-5pUCGCUUGGUGCAGAUCGGGACTang, Z. et al. (2012)
osa-miR169eUAGCCAAGGAUGACUUGCCGGTang, Z. et al. (2012)
osa-miR2275aUUUGGUUUCCUCCAAUAUCUCATang, Z. et al. (2012)
osa-miR396c-3pGGUCAAGAAAGCUGUGGGAAGTang, Z. et al. (2012)
osa-miR396e-3pAUGGUUCAAGAAAGCCCAUGGAAATang, Z. et al. (2012)
osa-miR396e-5pUCCACAGGCUUUCUUGAACUGTang, Z. et al. (2012)
osa-miR444bUGUUGUCUCAAGCUUGCUGCCTang, Z. et al. (2012)
osa-miR444bUGCAGUUGUUGUCUCAAGCUUTang, Z. et al. (2012)
osa-miR528-5pUGGAAGGGGCAUGCAGAGGAGTang, Z. et al. (2012)
osa-miR827UUAGAUGACCAUCAGCAAACATang, Z. et al. (2012)
ppt-miR156aUGACAGAAGAGAGUGAGCACTang, Z. et al. (2012)
ppt-miR390aAAGCUCAGGAGGGAUAGCGCCTang, Z. et al. (2012)
pta-miR166aUCGGACCAGGCUUCAUUCCCCTang, Z. et al. (2012)
pta-miR396UUCCACAGCUUUCUUGAACUUTang, Z. et al. (2012)
ptc-miR166nUCGGACCAGGCUUCAUUCCUUTang, Z. et al. (2012)
ptc-miR166pUCGGACCAGGCUCCAUUCCUUTang, Z. et al. (2012)
sbi-miR1432CUCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
sbi-miR156eUGACAGAAGAGAGCGAGCACTang, Z. et al. (2012)
sbi-miR166kUCGGACCAGGCUUCAUUCCUTang, Z. et al. (2012)
smo-miR156aCGACAGAAGAGAGUGAGCACTang, Z. et al. (2012)
sof-miR168bUCGCUUGGGCAGAUCGGGACTang, Z. et al. (2012)
vvi-miR156eUGACAGAGGAGAGUGAGCACTang, Z. et al. (2012)
vvi-miR167cUGAAGCUGCCAGCAUGAUCUCTang, Z. et al. (2012)
zma-miR156l-3pGCUCACUGCUCUAUCUGUCACCTang, Z. et al. (2012)
zma-miR160a-3pGCGUGCAAGGGGCCAAGCAUGTang, Z. et al. (2012)
zma-miR166g-5pGGAAUGUUGUCUGGUUGGAGATang, Z. et al. (2012)
zma-miR2118eUUCCUGAUGUCUCCCAUUCCUATang, Z. et al. (2012)
zma-miR2275b-3pUUCAGUUUCCUCUAAUAUCUCATang, Z. et al. (2012)
zma-miR390a-3pCGCUAUCUAUCCUGAGCUCCATang, Z. et al. (2012)
zma-miR396b-3pGUUCAAUAAAGCUGUGGGAAATang, Z. et al. (2012)
osa-miR1318UCAGGAGAGAUGACACCGACTang, Z. et al. (2012)
tae_1AAACUAAUAUAUGAGCGUUUARitu Pandey et al. (2014)
tae_2AAUUCGGGACGGAGGGAGUAARitu Pandey et al. (2014)
tae_3UUUCUGCGACGAGUAAUUCGGRitu Pandey et al. (2014)
tae_4ACUUCCUCCGUUCGGAAUUACRitu Pandey et al. (2014)
tae_5AGACAAGUAAUUUCGAACGGARitu Pandey et al. (2014)
tae_6AGCGAUCUGCCGAAGCUGUURitu Pandey et al. (2014)
tae_7AGGCCCACUGGGCAGCGCCCCRitu Pandey et al. (2014)
tae_8AGUAAUUUUGGACGGAGGGAGRitu Pandey et al. (2014)
tae_9AUAAGCACCGGUGCUUAAGGARitu Pandey et al. (2014)
tae_10AUUAGUACUGGUUCGUGGCACRitu Pandey et al. (2014)
tae_11AUUUCUGGACGGAGGGAGUAARitu Pandey et al. (2014)
tae_12CAUCUAUUUUGGAACGGAGGGRitu Pandey et al. (2014)
tae_13CCCUGGCAGAUAGCGCGAUCARitu Pandey et al. (2014)
tae_14CGCGCUGCCCUGUGAGCUUGCRitu Pandey et al. (2014)
tae_15CGGUAGGGCUGUAUGAUGGCGARitu Pandey et al. (2014)
tae_16UUUGACCAAGUUUGUAGAGAARitu Pandey et al. (2014)
tae_18CUGACAUACGGGCGUGUGGGCRitu Pandey et al. (2014)
tae_19GGGCGUUCGCGCGGGCCGACCRitu Pandey et al. (2014)
tae_20GGUGAACGCGCCGCCGUCAAACRitu Pandey et al. (2014)
tae_22GUGCGCGGUCUGUUUUGGUCAGRitu Pandey et al. (2014)
tae_23UAAUGUAAGACGCUUUUUGACRitu Pandey et al. (2014)
tae_26UAUGGAUGAAGAUAUGCACUGRitu Pandey et al. (2014)
tae_27UCCCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_29UCUGUAAACUAACAUAAGAGCRitu Pandey et al. (2014)
tae_30UCUGUAAACUAAUGUAAGAGCRitu Pandey et al. (2014)
tae_31UCUGUGACAAGUAAUUCCGAARitu Pandey et al. (2014)
tae_32UCUUACAUUAUGGGACGGAGURitu Pandey et al. (2014)
tae_33UGAACGUGUGCUGAACGCGGARitu Pandey et al. (2014)
tae_34UGACAAAUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_35UGACAACUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_36UGACAAGUACUUUCGGACGGARitu Pandey et al. (2014)
tae_37UGACAAGUAUUCUCGGACGGARitu Pandey et al. (2014)
tae_38UGACAAGUAUUUCGGACGGARitu Pandey et al. (2014)
tae_39UGACAAGUAUUUUCGAACGGARitu Pandey et al. (2014)
tae_40UGAUAAGUAUUUUCGGACGGARitu Pandey et al. (2014)
tae_42UGGCGAGGGACAUACACUGURitu Pandey et al. (2014)
tae_43UUCCGAAAAGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_44UUCCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_45UUCCGAAAGGCUUGAAGCGAAURitu Pandey et al. (2014)
tae_46UUCGAUCGUAAUCGGAUGGUCRitu Pandey et al. (2014)
tae_47UUCUGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae_48UUGUCUUAGAUUCGUCUAGAUARitu Pandey et al. (2014)
tae_49UUUCGAAAGGCUUGAAGCAAAURitu Pandey et al. (2014)
tae-miR3001aAAAATTCAACTCGTTTGGACASun,F. et al. (2014)
tae-miR3002aAAATCCGGTTTATTTTTCTASun,F. et al. (2014)
tae-miR3003aAAATGAACAAAAGGGGATGTASun,F. et al. (2014)
tae-miR3004bAAATTTCAGATCATTTGGACASun,F. et al. (2014)
tae-miR3005aAACAATTGATATGGATCGGAGSun,F. et al. (2014)
tae-miR3006aAACCAAAGCTGGCATACCTTTSun,F. et al. (2014)
tae-miR3007aAACTATTTCGGTACAGAGGGASun,F. et al. (2014)
tae-miR3008aAACTGTGAACTCGCGGGGATGSun,F. et al. (2014)
tae-miR3009aTGGTCTGTGTTTGTTTCAAACSun,F. et al. (2014)
tae-miR3010aAAGCGTAGTCGAACGAATCTGSun,F. et al. (2014)
tae-miR3010bAAGCGTAGTCGAACGAATCTSun,F. et al. (2014)
tae-miR3011aAATGCCATGTTGTTCTGAAGASun,F. et al. (2014)
tae-miR3012aAATTAATTTGGATTGGAGGGASun,F. et al. (2014)
tae-miR3013aTGTTGCATGACAAGTTGAGCASun,F. et al. (2014)
tae-miR3014bAATTTCGAACGGAGGGAGTAGSun,F. et al. (2014)
tae-miR3015aACAAGTAATTCGGAATGAAGGSun,F. et al. (2014)
tae-miR3016aACACTTATGTTGGGACGGAGGSun,F. et al. (2014)
tae-miR3017aACATCTGAGCAGCTCTCGGCASun,F. et al. (2014)
tae-miR3017bAGCATCTGAGAAGCTCTCGGCASun,F. et al. (2014)
tae-miR3017cAGCATCTGAGCAGCTCTCGGCASun,F. et al. (2014)
tae-miR3018aACCTGCAGTTGGGCCAATGACSun,F. et al. (2014)
tae-miR3019aACCTTCAGGAAGGACTGCATCSun,F. et al. (2014)
tae-miR3020aTCGACAAGTATTTCCAGACGGSun,F. et al. (2014)
tae-miR3021aACGACACAAGCAGCAACTCTCSun,F. et al. (2014)
tae-miR3022aACGGCATAGAGGCACTGCAAASun,F. et al. (2014)
tae-miR3023aACGGCGCGTCCGCGGTCGGAASun,F. et al. (2014)
tae-miR3024aAGAACAGCGGGGAGGTGCTACSun,F. et al. (2014)
tae-miR3025aAGAAGAGGGTCAAGAAAGCTGTSun,F. et al. (2014)
tae-miR3026aAGACCCACAGGGCAGTGTGCCSun,F. et al. (2014)
tae-miR3026bAGACCCACAGGGCAGTGCGCCSun,F. et al. (2014)
tae-miR3027aAGACGAGGGTGATCATAAACTSun,F. et al. (2014)
tae-miR3028aAGAGCAGCTCAGATGTCCAAASun,F. et al. (2014)
tae-miR3029aAGAGCGCACCGCCGTCGAGGGSun,F. et al. (2014)
tae-miR3030aAGAGGCTAACCATGAAAGCGGSun,F. et al. (2014)
tae-miR3031aAGAGGGCAGGCCTGGCGCAGSun,F. et al. (2014)
tae-miR3032aTTAAGAACAGCAGGGCATTTTSun,F. et al. (2014)
tae-miR3033aAGATTGATTAACGAAGATGGCSun,F. et al. (2014)
tae-miR3034aAGCATGTGTTCAGAAGATTAGGSun,F. et al. (2014)
tae-miR3035aAGGACTAGGGTTCCTACCGGCSun,F. et al. (2014)
tae-miR3036aAGGCCCACAGGACAGCGCCCCSun,F. et al. (2014)
tae-miR3037aAGGCCCACAGGGTAGCGTGCASun,F. et al. (2014)
tae-miR3038aTTACTCGTCGCGGAAATGGATSun,F. et al. (2014)
tae-miR3039aAGGTGGAATACTTGAAGAAGASun,F. et al. (2014)
tae-miR3039bAGGTGGAATACCTGAAGAAGASun,F. et al. (2014)
tae-miR3040aAGTAAATCGGAACAGAGGGAGSun,F. et al. (2014)
tae-miR3041aAGTAGAATGAACGACCAGGCTSun,F. et al. (2014)
tae-miR3042aAGTTGAAGATGAGATATTGAASun,F. et al. (2014)
tae-miR3043aATAAAACCTTCAGCTATCCATCSun,F. et al. (2014)
tae-miR3044aATCATGCGATCCTTTTGGAAGSun,F. et al. (2014)
tae-miR3045aATCTAAGACAAGTAATTCGGGSun,F. et al. (2014)
tae-miR3046aATCTGGACAAATCTAAGACAASun,F. et al. (2014)
tae-miR3047aATGACGAGTAAATCAGAACGGSun,F. et al. (2014)
tae-miR3048aATGGATGACACGTGGCATTTASun,F. et al. (2014)
tae-miR3049aATGTAGAAGCACCAGGGTAAGSun,F. et al. (2014)
tae-miR3050aATTACTTGTCGCAGAAGTGGASun,F. et al. (2014)
tae-miR3051aATTGCCATCCTTTAGTCTGCASun,F. et al. (2014)
tae-miR3052aATTGTTCAGTGTTTCGAAGGASun,F. et al. (2014)
tae-miR3053aTTCGCCGGCTGCGCGTTCCCCSun,F. et al. (2014)
tae-miR3054aCAAGGGAAGGAAGTAGCCAACSun,F. et al. (2014)
tae-miR3055bCATCTGAGAAGCTCTCGGCAASun,F. et al. (2014)
tae-miR3056aCCAGGAGAAGTACGTGGCGTGSun,F. et al. (2014)
tae-miR3057aCGAATGTATTTTTTATGGCTTGSun,F. et al. (2014)
tae-miR3058aCGAGTAATATGGAACGGAGGGSun,F. et al. (2014)
tae-miR3059aCGATCCGAATTAATTGACGCASun,F. et al. (2014)
tae-miR3060aCGATTGGTGCTCGTCGGTGACSun,F. et al. (2014)
tae-miR3061aCGGTAGGACTGTTTGATGGCGASun,F. et al. (2014)
tae-miR3061bCGGTATGACTGTATGATGGCGASun,F. et al. (2014)
tae-miR3062aTTCTTCAAGTACTCCACTTTTSun,F. et al. (2014)
tae-miR3063aCGGTTGGCTGTATGATGGCGASun,F. et al. (2014)
tae-miR3064aCTCCGTTCCAAAATAGACGACSun,F. et al. (2014)
tae-miR3064bCTCCGTTCCAGAATAGATGACSun,F. et al. (2014)
tae-miR3064cCTCCGTTCCAAAATAGATTACSun,F. et al. (2014)
tae-miR3065aTTCGCCGGAGCAGCGTGCAGASun,F. et al. (2014)
tae-miR3066aCTTGTTTGTCATTAAGCTTCSun,F. et al. (2014)
tae-miR3066bCTTGTTTGTCATTAAGCTTCTGSun,F. et al. (2014)
tae-miR3067aGAAACGTTGGGTGGTTGTGGCSun,F. et al. (2014)
tae-miR3068aGAAGTACACTTATTCGCGGACSun,F. et al. (2014)
tae-miR3069aTTGAACATCCCAGAGCCACCGSun,F. et al. (2014)
tae-miR3070aGCCTGCAAAAATTCGTCGTGASun,F. et al. (2014)
tae-miR3071aGCGAAGGATTTGCAGATACTCSun,F. et al. (2014)
tae-miR3072aGCGGCGTCGTCGAACTCGCCCSun,F. et al. (2014)
tae-miR3134aTTGAATTTGTCCATAGCATCASun,F. et al. (2014)
tae-miR3073aGCGTGCACGGATCCAAGCATASun,F. et al. (2014)
tae-miR3074aTTGAGACGAACACAGACCAACSun,F. et al. (2014)
tae-miR3075aGGCAAGTCCGTCCTTGGCTACASun,F. et al. (2014)
tae-miR3076aGGCGATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-miR3077aTTGAGCACACCTGAGTCCAGTSun,F. et al. (2014)
tae-miR3078bGGTGAGCGCGCCGCCGTCGAASun,F. et al. (2014)
tae-miR3079aGTAGGATGGCTGGTGCTATGGSun,F. et al. (2014)
tae-miR3080aTTGATGACACGTGCAACATGASun,F. et al. (2014)
tae-miR3081aTAAAGCGTAGTCGAACGAATCSun,F. et al. (2014)
tae-miR3082aTAAGAAGCAAATAGCACATGSun,F. et al. (2014)
tae-miR3082bTAAGAAGCAAAGAGCACATGSun,F. et al. (2014)
tae-miR3083bTAAGACAAGTATTTCCGGACGSun,F. et al. (2014)
tae-miR3084aTAATCTTCTGGATATATGCTTASun,F. et al. (2014)
tae-miR3084bTAATCTTCTGGATACATGCTTASun,F. et al. (2014)
tae-miR3085aTAATGCTGTCAGAGTTGGAACSun,F. et al. (2014)
tae-miR3086aTACGGCCTGATGACATCCACASun,F. et al. (2014)
tae-miR3086bTACGGCCTGATGACATCCACGSun,F. et al. (2014)
tae-miR3087aTACTGTGGGCACTTATTTGACASun,F. et al. (2014)
tae-miR3088aTACTGTTCAGTGCTCACGGTTSun,F. et al. (2014)
tae-miR3089aTAGAATGGCTGGTGCTATGGASun,F. et al. (2014)
tae-miR3090aTAGAGCTCCTCGGATGTCATASun,F. et al. (2014)
tae-miR3091aTAGCTCTCAGGCGCTGCACTAGTSun,F. et al. (2014)
tae-miR3092aTATCTGGACAAATCTGAGACASun,F. et al. (2014)
tae-miR3093aTATGATGGCGATACCGATTGGSun,F. et al. (2014)
tae-miR3094aTATTAGTTGTCGCTGAAACGGSun,F. et al. (2014)
tae-miR3095aTTTTTAATGGCAACTTTAGTSun,F. et al. (2014)
tae-miR3096aTCAGGAAGGACCGCATCATCTSun,F. et al. (2014)
tae-miR3097aTCAGGACGTTGCAACATTAACSun,F. et al. (2014)
tae-miR3098aTCATCTGGCATTGCTTTCTCTSun,F. et al. (2014)
tae-miR3099aTCATGAATTTTTGTACGCATGSun,F. et al. (2014)
tae-miR3100aTCATTTGGAACTCGCCGGTGCSun,F. et al. (2014)
tae-miR3101aTCGCAAATAATGGTGGCTCTCSun,F. et al. (2014)
tae-miR3102aTCGGCTACTTCCTTTCCCTTGCSun,F. et al. (2014)
tae-miR3103aTCGGGACATTCTATGTGCATGSun,F. et al. (2014)
tae-miR3104aTCTCCTCGATGACCATGCTGASun,F. et al. (2014)
tae-miR3105aTCTGATTTACTCGTCGTGGTTSun,F. et al. (2014)
tae-miR3106aTCTGCAAAGTTTGAAGTTCATSun,F. et al. (2014)
tae-miR3107aTCTGGAATTAGTTGACGCTCASun,F. et al. (2014)
tae-miR3108bTCTGTAACTAAATATAAGACGSun,F. et al. (2014)
tae-miR3109aTCTGTCCCTGAATATAAGACGSun,F. et al. (2014)
tae-miR3110aTCTGTTCACAAATGTAAGACGSun,F. et al. (2014)
tae-miR3111aTCTGTTCACTTTTATAAGACGSun,F. et al. (2014)
tae-miR3112aTTTTTGGTGACATGCATGAACSun,F. et al. (2014)
tae-miR3113aTGAAACACTGTGTGAGAGAAGSun,F. et al. (2014)
tae-miR3114aTGAACATCCCAGAGCCACCGGSun,F. et al. (2014)
tae-miR3115aTTTTTTGATCCTTAGGATGGCSun,F. et al. (2014)
tae-miR3116aTGAACTCAGGTGTGCTCAACTSun,F. et al. (2014)
tae-miR3117bTGAGAAAGGACTGCATCATCTSun,F. et al. (2014)
tae-miR3117aTGAAGAAGGACTGCATCATCTSun,F. et al. (2014)
tae-miR3118aTTTGTCTAGATACGGATATATSun,F. et al. (2014)
tae-miR3119aTGAAGTAGAGCAGGGACCTCASun,F. et al. (2014)
tae-miR3119bTGAAGTAGAGCAGAGACCTCASun,F. et al. (2014)
tae-miR3120aTGAATCTTGGGAAAAAGCTGCATSun,F. et al. (2014)
tae-miR3121aTGAATTTGTCCATAGCATCATSun,F. et al. (2014)
tae-miR3121bTGAATTTTTCCATAGCATCAGSun,F. et al. (2014)
tae-miR3121cTTAATTTGTCCATAGCATCCGSun,F. et al. (2014)
tae-miR3122aTGACATGTGGCATTCACAAATCASun,F. et al. (2014)
tae-miR3122bTGACATGTGGCATTCACAAATSun,F. et al. (2014)
tae-miR3123aTGAGACGAGATCTCCCCATACSun,F. et al. (2014)
tae-miR3124bTGAGCATCAACTAATTCCGGASun,F. et al. (2014)
tae-miR3125aTGCAGTCCTCGATGTCGTAGSun,F. et al. (2014)
tae-miR3125bTTGCAGTCCTCGATGTCGTAGSun,F. et al. (2014)
tae-miR3126aTGCGCCCTGCAGTACGTCAGASun,F. et al. (2014)
tae-miR3127aTTTTTTTGCCATATTTTCCACSun,F. et al. (2014)
tae-miR3128aTGGACATCCGAGCAGCTCTCASun,F. et al. (2014)
tae-miR3129aTGGACGAGGATGTGCAGCTGCSun,F. et al. (2014)
tae-miR3130aTGGATGTCATCGTGGCCGTACASun,F. et al. (2014)
tae-miR3131aTGGCATTGAGGGAGTCAAGCASun,F. et al. (2014)
tae-miR3132aTGGGCAAGTCACCCTGGCTACCSun,F. et al. (2014)
tae-miR3133bTTTTGATGACATGCATGGACASun,F. et al. (2014)
tae-lmiR4001aAAAGATTCTGGGAGAAGCTGGGTASun,F. et al. (2014)
tae-lmiR4001bAAAGATTCTGGAAGAAGCTGGGTASun,F. et al. (2014)
tae-lmiR4002aAAAGACGGTCTTAGAAAATGCATTSun,F. et al. (2014)
tae-lmiR4003aAAAGTTAACCTCGAAAAACGCATTSun,F. et al. (2014)
tae-lmiR4004aAGATAAGCTAGTAATAATGTCATASun,F. et al. (2014)
tae-lmiR4004bAGATAAGGTAGTAATAATGTCATASun,F. et al. (2014)
tae-lmiR4005bAAATTACTCGTCGTAGAAATGGATSun,F. et al. (2014)
tae-lmiR4006aAACATAGAGTAGTAACATGGGCATSun,F. et al. (2014)
tae-lmiR4006bAACATAGACTAGTAACATGGGCATSun,F. et al. (2014)
tae-lmiR4007bAACCACTAGTGCAGCGCCTGAGAGSun,F. et al. (2014)
tae-lmiR4007cAACCACTAGTGCAGCGTCTGAGAGSun,F. et al. (2014)
tae-lmiR4008aAACCTAGAACTACGCGAATGACTTSun,F. et al. (2014)
tae-lmiR4009aAACGACCTAGGTACACATGCAAGASun,F. et al. (2014)
tae-lmiR4010aAAGACTTAGATGTGCAATACTTATSun,F. et al. (2014)
tae-lmiR4010bAGGACTTAGATGTGCAATACTTAGSun,F. et al. (2014)
tae-lmiR4011aAAGCCCAGTCGGCCTGCAGTTGGCSun,F. et al. (2014)
tae-lmiR4012aTAGGACAAGTATTTTCGGACGGAGSun,F. et al. (2014)
tae-lmiR4012eTCGGACAAGTATTTCCGGACGGAGSun,F. et al. (2014)
tae-lmiR4013aGAGGCCTTTAGTACCGGTTGGTGGSun,F. et al. (2014)
tae-lmiR4014aAAGTACTTTGATCATCATAGGCTTSun,F. et al. (2014)
tae-lmiR4015bAATATGCGGACTAAATAAAAACGGSun,F. et al. (2014)
tae-lmiR4016aAATCATGTATGTGATCTATGGGACSun,F. et al. (2014)
tae-lmiR4017aAATGGACAAAAAGGGGTGTATCTASun,F. et al. (2014)
tae-lmiR4018aAATTGGCAACCTAGATATACGCGTSun,F. et al. (2014)
tae-lmiR4019aAATTTAACCAACGAGACTGACTGCSun,F. et al. (2014)
tae-lmiR4020aACCCGGCAGTTGGGTAAAGTCACASun,F. et al. (2014)
tae-lmiR4021aACCGGAAAGAAGCAAACCACACGGSun,F. et al. (2014)
tae-lmiR4022aACGAGGCTCCTCTGACGTACTGCASun,F. et al. (2014)
tae-lmiR4023aACGGCGCAAAATGAGTGAATCTACSun,F. et al. (2014)
tae-lmiR4024aACGTCTCTCCTGTAGAAATAGGCASun,F. et al. (2014)
tae-lmiR4025aACTCGGCTCCCCTGACGTACTGCASun,F. et al. (2014)
tae-lmiR4026bACTGATAGGATGGGTCATTTTGGTSun,F. et al. (2014)
tae-lmiR4027aACTGTGCCTTCTAAACTGTGACGGSun,F. et al. (2014)
tae-lmiR4028aAGAAAAGTCTGGTTTATTTCTCTASun,F. et al. (2014)
tae-lmiR4029bAGAAGTACACTTATTCATGGACGGSun,F. et al. (2014)
tae-lmiR4029cAGATGTACACTTATTCATGGACGGSun,F. et al. (2014)
tae-lmiR4029dAGAAGTACACTTATTCACGGACGGSun,F. et al. (2014)
tae-lmiR4029eAGAAGTACACTTATTCGCGGACGGSun,F. et al. (2014)
tae-lmiR4029fAGATGTACACTTATTCACGGACGGSun,F. et al. (2014)
tae-lmiR4030aAGACAAAAGCTAGAAGTACACTTASun,F. et al. (2014)
tae-lmiR4031bAGAGAAAACTGTCTACATCTACAASun,F. et al. (2014)
tae-lmiR4032aAGAGAAAAGTAGGTACATCTAGAASun,F. et al. (2014)
tae-lmiR4033aAGAGCTAGGCGCTGCACTGTATAGSun,F. et al. (2014)
tae-lmiR4034aAGATAAGATAGTAATAATGTCAGTSun,F. et al. (2014)
tae-lmiR4034bAGATAAGGTAGTAATAATGTTAGTSun,F. et al. (2014)
tae-lmiR4034cAGATAAGGTAGTAATAATGTCAGTSun,F. et al. (2014)
tae-lmiR4035aAGATAAGGTAGTAATAATGGCATASun,F. et al. (2014)
tae-lmiR4036aAGATGACACGTGGCATTCACAAATSun,F. et al. (2014)
tae-lmiR4037aTTGGAATCAGACGCACGGATGGCTSun,F. et al. (2014)
tae-lmiR4038aAGATGTACACTCTTCACCGGACGGSun,F. et al. (2014)
tae-lmiR4039aAGATTAATAGTACATGACATGCATSun,F. et al. (2014)
tae-lmiR4040aAGCAACCAGGGCAATTCTTCTGAGSun,F. et al. (2014)
tae-lmiR4041aAGCAAGGCGCTGCACTCTACTGTGSun,F. et al. (2014)
tae-lmiR4042aAGCACCATACGGTACTGCAGAGGASun,F. et al. (2014)
tae-lmiR4043aAGCACCGGTGCTTATTTGTACAAGSun,F. et al. (2014)
tae-lmiR4044aAGCACTACCACCGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4044cAGCGCTACCGCCGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4045aAGCGCTACCGCCGCTGGCCGGACASun,F. et al. (2014)
tae-lmiR4046aAGCGCTACCGACGCTGCCCGGACASun,F. et al. (2014)
tae-lmiR4047aAGCGTCTCTCCTGTAGAAATAGGCSun,F. et al. (2014)
tae-lmiR4048aAGGAAGTGGTGTAGACTGCACGGASun,F. et al. (2014)
tae-lmiR4049aAGGACGTGTGGGCATATTTGCTTCSun,F. et al. (2014)
tae-lmiR4050aAGGACTTGTAAACTAAGACGGAGGSun,F. et al. (2014)
tae-lmiR4050bAGGACTTGTAAACTGAGACGGAGGSun,F. et al. (2014)
tae-lmiR4050cAGGACTTGTAAACTGAGATGGAGGSun,F. et al. (2014)
tae-lmiR4051aAGGACTTGTAAACTGAAACAGAGGSun,F. et al. (2014)
tae-lmiR4052aAGGATCCTCTGCAGTACTGTACGGSun,F. et al. (2014)
tae-lmiR4053aAGGCATATTTTAGAGTGTAGATTCSun,F. et al. (2014)
tae-lmiR4054aAGGCCTGAAGCTAAGCAACGTGCASun,F. et al. (2014)
tae-lmiR4055aAGTGGCAATTCTGGAAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4055cAGTGACAATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4056aAGTGGCAATTCTGGGAGAAGCTGGSun,F. et al. (2014)
tae-lmiR4057aAGTTTGACTTTCGGCAAAACCAATSun,F. et al. (2014)
tae-lmiR4058aTTAAGACAAGAATTTTGAGACGGASun,F. et al. (2014)
tae-lmiR4059aATACGCGGACTAAATAAAAACGGASun,F. et al. (2014)
tae-lmiR4060cATATGCAGACTAAAAAGAAATGGASun,F. et al. (2014)
tae-lmiR4061aATATGCGGAGTAAAAAGAAACGGASun,F. et al. (2014)
tae-lmiR4062bATCAAAATGGATAAAAGAAGATGTSun,F. et al. (2014)
tae-lmiR4063aGTTTTGGATTTGTCTAGATACGGASun,F. et al. (2014)
tae-lmiR4064aATGAAGATAGTAACTTAGACTAGTSun,F. et al. (2014)
tae-lmiR4065aATGATGTTAACTTGTATTTGATGTSun,F. et al. (2014)
tae-lmiR4066aATGGTATGTGTCACTGTAAAGGTTSun,F. et al. (2014)
tae-lmiR4067aATGTAGCTGCAGTAGATGCTCCGGSun,F. et al. (2014)
tae-lmiR4068aATTAACGATCTAGATACACGTGCASun,F. et al. (2014)
tae-lmiR4069aATTCTGCACCCTGGATGATGAATASun,F. et al. (2014)
tae-lmiR4070aATTGACGACCTAAGGATACGCGCASun,F. et al. (2014)
tae-lmiR4070bATTGACGATCTAGGGATACGCGCASun,F. et al. (2014)
tae-lmiR4071aCAAGACAAGTAATTCAGAACGGAGSun,F. et al. (2014)
tae-lmiR4071cTAAGACAAGTAATTCAGAACGGAGSun,F. et al. (2014)
tae-lmiR4072bCACGACGAGTAATTTGAAACGGAGSun,F. et al. (2014)
tae-lmiR4073aCACCAACCGGTACTAATGGGCATCSun,F. et al. (2014)
tae-lmiR4074aCACCATACGGTACTGCAGAGGATCSun,F. et al. (2014)
tae-lmiR4075aCAGCGACACTTATTTTGGGACGGASun,F. et al. (2014)
tae-lmiR4076aCAGCGCTACCGCCGCTGGCCGGACSun,F. et al. (2014)
tae-lmiR4077aCAGGCGCTGCACACTGACTTAGTASun,F. et al. (2014)
tae-lmiR4078aTATAGGAAATGAGATGACATGTATSun,F. et al. (2014)
tae-lmiR4079aCATATTCATTACCACCATATATACSun,F. et al. (2014)
tae-lmiR4080aCATCTCTCCTGTAGAAATAGGCACSun,F. et al. (2014)
tae-lmiR4081aTCTGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081bTCCGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081cCCCGGACAGCTGTGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4081dTCCGGACAGCTGTGGTAGTGTTATSun,F. et al. (2014)
tae-lmiR4081eTCCGGACAGCTATGGTAGTGTTACSun,F. et al. (2014)
tae-lmiR4082aCCGGATTTTTCTGAAGCACCGGTGSun,F. et al. (2014)
tae-lmiR4083aCCGTTCGGAATTACTTGTCGCGGASun,F. et al. (2014)
tae-lmiR4084aCCTCCGTCACGGTTTAGAAGGCGCSun,F. et al. (2014)
tae-lmiR4085aCGCGGACACGAGACGGACGCGCGCSun,F. et al. (2014)
tae-lmiR4086aCGGGTTTTTCTGAAGCACCGGTGCSun,F. et al. (2014)
tae-lmiR4086bCGGATTTTTCTGAAGCACCGGTGCSun,F. et al. (2014)
tae-lmiR4087aCGGTCTTGATAGTTAAATTTACGGSun,F. et al. (2014)
tae-lmiR4088aCTAATAAAATATTAATGCATGTCASun,F. et al. (2014)
tae-lmiR4089aCTAGAACTCATCTAGATGAGACATSun,F. et al. (2014)
tae-lmiR4090bCTCTGTTCACTTTTATAAGACGTTSun,F. et al. (2014)
tae-lmiR4091aGAAGATAGTAACTTAGACTAGTGTSun,F. et al. (2014)
tae-lmiR4092aGACAAGTAATTCGGAACGAAGGGASun,F. et al. (2014)
tae-lmiR4092bGACAAGTAATTCGGAACAGAGGGASun,F. et al. (2014)
tae-lmiR4093dGACAAGTATTTCTGAACGGAGGGASun,F. et al. (2014)
tae-lmiR4094aGACGACCTAGGGATACGCGCACGCSun,F. et al. (2014)
tae-lmiR4095aGACGAGCACTGCAATATAGACTAGSun,F. et al. (2014)
tae-lmiR4096aGACGAGTAATTTGGAACGGATGGASun,F. et al. (2014)
tae-lmiR4097aGACTTATAAGTTGGGTCTGTTTGGSun,F. et al. (2014)
tae-lmiR4098aGAGCATCTGAGCAGCTCTCGGCAASun,F. et al. (2014)
tae-lmiR4099aGAGGCTCCTCTGACGTACTGCAGGSun,F. et al. (2014)
tae-lmiR4100aGATAACACCCCTTAAGACCTTATTSun,F. et al. (2014)
tae-lmiR4101aGATGTACACTTATTCGCGGACGGASun,F. et al. (2014)
tae-lmiR4102aGCAGGACTTGTAAACTGAAACGGASun,F. et al. (2014)
tae-lmiR4102bGTAGGACTTGTAAACTGAGACGGASun,F. et al. (2014)
tae-lmiR4103aGCATATTAGGTTTGTCTGAAGTCASun,F. et al. (2014)
tae-lmiR4104aGCATGCACATAGAATGTCCGGATASun,F. et al. (2014)
tae-lmiR4105aGCGCTACATTGTGGAACGGAGGGASun,F. et al. (2014)
tae-lmiR4106aGGCTCGAACCGGGACAGAAGGCTGSun,F. et al. (2014)
tae-lmiR4107aGGGACGAACCAGGACCAATGGGCCSun,F. et al. (2014)
tae-lmiR4108aGGGGATAAAGAGGATGCTTACAGCSun,F. et al. (2014)
tae-lmiR4109aGGGTCCAGTCGGCCTGCAGTTGGCSun,F. et al. (2014)
tae-lmiR4110aGTAGGACAAGTATTTCCGGACGGASun,F. et al. (2014)
tae-lmiR4111aGTCTCTCCTGTAGAAATAGGCATCSun,F. et al. (2014)
tae-lmiR4112aGTCTTAGATTTGTGTAGATACGGASun,F. et al. (2014)
tae-lmiR4113aGTGAGACCCGCTCTGATGGATGACSun,F. et al. (2014)
tae-lmiR4114aGTTAAATTTATGATCAAAGTTGGASun,F. et al. (2014)
tae-lmiR4115aGTTCGGGCAGTTGCGGTAGTGCTGSun,F. et al. (2014)
tae-lmiR4116aGTTTACAGACGGCAAAGTGAGCTCSun,F. et al. (2014)
tae-lmiR4117aGTTTGATTGTTTAATAGTAGTGGASun,F. et al. (2014)
tae-lmiR4118aTAAGACTCTAGAGGGTGTTATCATSun,F. et al. (2014)
tae-lmiR4119aTAAGCATGTGTTCAGAAGATTAGGSun,F. et al. (2014)
tae-lmiR4120aTAAGGTCTTAAGGGGTGTTATCATSun,F. et al. (2014)
tae-lmiR4121aTAGAGGGCAGAGCAATCTTCAACTSun,F. et al. (2014)
tae-lmiR4122aTAGCTCTCAGGCGCTGCACTAGTGSun,F. et al. (2014)
tae-lmiR4123aTAGCTGTAGCGGTTTCCTAGCCCCSun,F. et al. (2014)
tae-lmiR4124aTAGGAACCAAACGGGAGGGACTTTSun,F. et al. (2014)
tae-lmiR4125aTCGGGCAGACTGCTGAGCAGTCGGSun,F. et al. (2014)
tae-lmiR4126aTCGTCATTCACGGTGTGCACGATCSun,F. et al. (2014)
tae-lmiR4127aTCTGCGACAAGTAATTCCAAACGGSun,F. et al. (2014)
tae-lmiR4128aTCTAGACAAATGTAAGACAAGAATSun,F. et al. (2014)
tae-lmiR4129aTCTCCTGTAGAAATAGGCACTGGTSun,F. et al. (2014)
tae-lmiR4130aTCTGCAACAAGTAATTCCGAACGGSun,F. et al. (2014)
tae-lmiR4130cTCTGAGACAAGTAATTCCGAACGGSun,F. et al. (2014)
tae-lmiR4131aTCTGGCCAACCGCGACTAAAGGACSun,F. et al. (2014)
tae-lmiR4132aTCTGTCCCAGAATATAAGAACGTTSun,F. et al. (2014)
tae-lmiR4133aTGAAGCACGTGGATAGAGGAAGCASun,F. et al. (2014)
tae-lmiR4134aTGACATGTGGCATTCACAAATCACSun,F. et al. (2014)
tae-lmiR4134cTGACACGTGGCATTCACAAATCATSun,F. et al. (2014)
tae-lmiR4135aTGAGACCCGCCCTGATGGATGACASun,F. et al. (2014)
tae-lmiR4136bTGATAGATGACACGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4136cTGATGGATGACATGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4136dTGATGGATAACACGTGGCATTCACSun,F. et al. (2014)
tae-lmiR4137aTGGATGACATGTGGCATTCACAAASun,F. et al. (2014)
tae-lmiR4138aTGGCAACTATAGTGTAAACATCATSun,F. et al. (2014)
tae-lmiR4139aTGGCACGAAGTAGCTGCGCCCACASun,F. et al. (2014)
tae-lmiR4140aTGTGTCAGTGACTCAAAGGTAGGCSun,F. et al. (2014)
tae-lmiR4141aTTGAACTGTTTCCTCTGAAATTCCSun,F. et al. (2014)
tae-lmiR4142aTTGAATTTCCTCTATAAGCGCATTSun,F. et al. (2014)
aau-miR2086GACATGAATGCAGAACTGGAAMayer et al (2014)
ahy-miR159TTTGGATTGAAGGGAGCTCTAMayer et al (2014)
ahy-miR167-3pAGATCATGTGGCAGTTTCACCMayer et al (2014)
ahy-miR3513-5pTTAATTTCTGAGTTTGTCATCMayer et al (2014)
ahy-miR398TGTGTTCTCAGGTCACCCCTMayer et al (2014)
aly-miR156aQGCTCACTGCTCTTTCTGTCAGAMayer et al (2014)
aly-miR156bQGCTCACCTCTCTTTCTGTCAGTMayer et al (2014)
aly-miR156cQGCTCACTGCTCTATCTGTCAGAMayer et al (2014)
aly-miR156dQGCTCACTCTCTTTCTGTCATAMayer et al (2014)
aly-miR156eQGCTTACTCTCTCTCTGTCACCMayer et al (2014)
aly-miR156fQGCTCACTCTCTATCTGTCACCMayer et al (2014)
aly-miR156hQGCTCTCTTTCCTTCTGCCACCMayer et al (2014)
aly-miR157dQGCTCTCTATGCTTCTGTCATCMayer et al (2014)
aly-miR158aQCTTTGTCTACAATTTTGGAAAMayer et al (2014)
aly-miR158bQTTTGTCTACAATTTTGGAAAMayer et al (2014)
aly-miR159aQGAGCTCCTTGAAGTTCAAACGMayer et al (2014)
aly-miR159bTTTGGATTGAAGGGAGCTCTTMayer et al (2014)
aly-miR159bQGAGCTCCTTGAAGTTCAATGGMayer et al (2014)
aly-miR159cTTTGGATTGAAGGGAGCTCCTMayer et al (2014)
aly-miR160cQGCGTACAAGGAGCCAAGCATGMayer et al (2014)
aly-miR161_1QCCGGTTTAGTCACTTTCACMayer et al (2014)
aly-miR164aQCACGTACTCCCCTTCTCCAACMayer et al (2014)
aly-miR164cTGGAGAAGCAGGGCACGTGCGMayer et al (2014)
aly-miR165aTCGGACCAGGCTTCATCCCCMayer et al (2014)
aly-miR167cTAAGCTGCCAGCATGATCTTGMayer et al (2014)
aly-miR167cQAGGTCATGCTGGTAGTTTCACMayer et al (2014)
aly-miR167dQAGGTCATCCTGCAGCTTCAGTMayer et al (2014)
aly-miR168aTCGCTTGGTGCAGGTCGGGAAMayer et al (2014)
aly-miR169aQGGCAAGTTGTCCTTGGCTACAMayer et al (2014)
aly-miR169bQGGCAAGTTGTCCTTCGGCTACAMayer et al (2014)
aly-miR169dTGAGCCAAGGATGACTTGCCGMayer et al (2014)
aly-miR169hTAGCCAAGGATGACTTGCCTGMayer et al (2014)
aly-miR169hQGGCAGTCTCCTTGGCTATTMayer et al (2014)
aly-miR169jQGGCAGTCTCCTTGGCTATCMayer et al (2014)
aly-miR169mQGGCAGTCTTCTTGGCTATCMayer et al (2014)
aly-miR169nTAGCCAAAGATGACTTGCCTGMayer et al (2014)
aly-miR170TGATTGAGCCGTGTCAATATCMayer et al (2014)
aly-miR171cQAGATATTGGTGCGGTTCAATCMayer et al (2014)
aly-miR172aQGTGGCATCATCAAGATTCACAMayer et al (2014)
aly-miR172bQGCAGCACCATCAAGATTCACAMayer et al (2014)
aly-miR172cQGGAGCATCATCAAGATTCACAMayer et al (2014)
aly-miR172eGAATCTTGATGATGCTGCATMayer et al (2014)
aly-miR172eQGCAGCACCATTAAGATTCACMayer et al (2014)
aly-miR319aQAGAGCTTCCTTGAGTCCATTCMayer et al (2014)
aly-miR319cTTGGACTGAAGGGAGCTCCTTMayer et al (2014)
aly-miR3434TCAAAATCAGAGAATCAACCAMayer et al (2014)
aly-miR3437QCGGTGGATCTTGTTTTTTGTMayer et al (2014)
aly-miR3439QTTGGGGTTTCGAAATCAAGAGMayer et al (2014)
aly-miR3444TTGGGAGCTCGATGAGATCGAMayer et al (2014)
aly-miR3448TCTGAGGATTTTTTTTGTGGTCMayer et al (2014)
aly-miR390bQCGCTATCCATCCTGAGTTCCAMayer et al (2014)
aly-miR393aTCCAAAGGGATCGCATTGATCCMayer et al (2014)
aly-miR393bQATCATGCGATCTCTTTGGATTMayer et al (2014)
aly-miR395bCTGAAGTGTTTGGGGGGACTCMayer et al (2014)
aly-miR395cCTGAAGTGTTTGGGGGGACTTMayer et al (2014)
aly-miR395iCTGAAGTGTTTGGAGGAACTCMayer et al (2014)
aly-miR396aQGTTCAATAAAGCTGTGGGAAGMayer et al (2014)
aly-miR396bQGCTCAAGAAAGCTGTGGGAAAMayer et al (2014)
aly-miR398aTGTGTTCTCAGGTCACCCCTTMayer et al (2014)
aly-miR398bTGTGTTCTCAGGTCACCCCTGMayer et al (2014)
aly-miR398cQGGGTCGACATGAGAACATATGMayer et al (2014)
aly-miR399aTGCCAAAGGAGATTTGCCCGGMayer et al (2014)
aly-miR399bQGGGCGCCTCTCCATTGGCAGGMayer et al (2014)
aly-miR399dTGCCAAAGGAGATTTGCCCCGMayer et al (2014)
aly-miR399eTGCCAAAGGAGATTTGCCTCGMayer et al (2014)
aly-miR399fTGCCAAAGGAGATTTGCCCTGMayer et al (2014)
aly-miR399fQGGGCAAGATCACCATTGGCAGAMayer et al (2014)
aly-miR399gQGGGCAAATACTCCATTGGCAGAMayer et al (2014)
aly-miR408QCAGGGAACAAGCAGAGCATGGMayer et al (2014)
aly-miR4232TCACATTTATTAGGATGTGTGCMayer et al (2014)
aly-miR4233CACATCATCAACATCAACTCCMayer et al (2014)
aly-miR4245ACAAAGTTTTATACTGACAATMayer et al (2014)
aly-miR4248aACATTTTATTTTTGGCAATCAMayer et al (2014)
aly-miR771QGGGCTCCTCAGATGTTCATGMayer et al (2014)
aly-miR774bTGAGATGAAGATTTGGATGACMayer et al (2014)
aly-miR825TTCTCGAGAAGGTGCATGAACMayer et al (2014)
aly-miR827TTAGATGACCATCAACAAACGMayer et al (2014)
aly-miR828TCTTGCTTAAATGAGTATTCCAMayer et al (2014)
aly-miR829CAAATCAAATCTTCAAGGTACMayer et al (2014)
aly-miR829QACTTTGAATCTTTGATTTGAAMayer et al (2014)
aly-miR834TGGTAGCAGTAGCGGTGGTAAMayer et al (2014)
aly-miR837-5pCATTGTTTCTTGTTTTTTTCAMayer et al (2014)
aly-miR838TTTTCTTCTTCTTCTTGCACAMayer et al (2014)
aly-miR845aCGGCTCTGATACCAGTTGATGMayer et al (2014)
aly-miR845bTCGCTCTGATACCAAATGATGMayer et al (2014)
aly-miR848QGGCAATCCCATGTCAAAMayer et al (2014)
aly-miR857TTTTGTATGTTGAAGGTGTATMayer et al (2014)
aly-miR859TCTCTCCGTTGTAAAATCAAAMayer et al (2014)
aly-miR861-3pGATGGATATATCTTCAAGAACMayer et al (2014)
aly-miR862-3pACATGCTGGATCTACTTGAAGMayer et al (2014)
aqc-miR159TTTGGACTGAAGGGAGCTCTAMayer et al (2014)
aqc-miR167TCAAGCTGCCAGCATGATCTAMayer et al (2014)
aqc-miR169aTAGCCAAGGATGACTTGCCTAMayer et al (2014)
aqc-miR171cTAATTGAACCGCACTAATATCMayer et al (2014)
aqc-miR171fTAATTGAGCCGTGCCAATATCMayer et al (2014)
aqc-miR398bTGTGTTCTCAGGTCGCCCCTGMayer et al (2014)
aqc-miR399TGCCAAAGGAGAGTTGCCCTAMayer et al (2014)
aqc-miR477cCTCTCCCTCAAGTTCTTCTAMayer et al (2014)
ath-miR156iTGACAGAAGAGAGAGAGCAGMayer et al (2014)
ath-miR169gQTCCGGCAAGTTGACCTTGGCTMayer et al (2014)
ath-miR406TAGAATGCTATTGTAATCCAGMayer et al (2014)
ath-miR407TTTAAATCATATACTTTTGGTMayer et al (2014)
ath-miR413ATAGTTTCTCTTGTTCTGCACMayer et al (2014)
ath-miR414TCATCTTCATCATCATCGTCAMayer et al (2014)
ath-miR420TAAACTAATCACGGAAATGCAMayer et al (2014)
ath-miR5015aTTGGTGTTATGTGTAGTCTTCMayer et al (2014)
ath-miR5017TTATACCAAATTAATAGCAAAMayer et al (2014)
ath-miR5019TGTTGGGAAAGAAAAACTCTTMayer et al (2014)
ath-miR5020cTGGCATGGAAGAAGGTGAGACMayer et al (2014)
ath-miR5021TGAGAAGAAGAAGAAGAAAAMayer et al (2014)
ath-miR5024-5pATGACAAGGCCAAGATATAACAMayer et al (2014)
ath-miR5631TGGCAGGAAAGACATAATTTTMayer et al (2014)
ath-miR5639TAGTCCACTGTGGTCTAAGGCMayer et al (2014)
ath-miR5650TTGTTTTGGATCTTAGATACAMayer et al (2014)
ath-miR5652TTGAATGTGAATGAATCGGGCMayer et al (2014)
ath-miR5658ATGATGATGATGATGATGAAAMayer et al (2014)
ath-miR5660CAGGTGGTTAGTGCAATGGAAMayer et al (2014)
ath-miR779_1TTCTGCTATGTTGCTGCTCATMayer et al (2014)
ath-miR827TTAGATGACCATCAACAAACTMayer et al (2014)
ath-miR830TAACTATTTTGAGAAGAAGTGMayer et al (2014)
ath-miR835-3pTGGAGAAGATACGCAAGAAAGMayer et al (2014)
ath-miR838TTTTCTTCTACTTCTTGCACAMayer et al (2014)
ath-miR845bTCGCTCTGATACCAAATTGATGMayer et al (2014)
ath-miR854aGATGAGGATAGGGAGGAGGAGMayer et al (2014)
ath-miR863-5pTTATGTCTTGTTGATCTCAATMayer et al (2014)
bdi-miR1122TAGATACATCCGTATTTGGAMayer et al (2014)
bdi-miR1127AACTACTCCCTCCGTCCGATAMayer et al (2014)
bdi-miR1135TTTCGACAAGTAATTCCGACCGGAMayer et al (2014)
bdi-miR1139GAGTAACATACACTAGTAACAMayer et al (2014)
bdi-miR159CTTGGATTGAAGGGAGCTCTMayer et al (2014)
bdi-miR164fTGGAGAAGAAGGGCACATGCAMayer et al (2014)
bdi-miR166eCTCGGACCAGGCTTCATTCCCMayer et al (2014)
bdi-miR166fTCTCGGACCAGGCTTCATTCCMayer et al (2014)
bdi-miR169dTAGCCAAGAATGACTTGCCTAMayer et al (2014)
bdi-miR319TGAGGGAGCTTTCTTCTGTCCMayer et al (2014)
bdi-miR393aTCCAAAGGGATCGCATTGATCMayer et al (2014)
bdi-miR395dAAGTGTTTGGGGAACTCTAGGMayer et al (2014)
bdi-miR399TGCCAAAGGAGAATTACCCTGMayer et al (2014)
bdi-miR437GAACTTAGAGAAGTTTGACTTMayer et al (2014)
bdi-miR5054TCCCCACGGTCGGCGCCAMayer et al (2014)
bdi-miR5056AGGAAGAACCGGTAATAAGCAMayer et al (2014)
bdi-miR5057AAATTTCAAATCATTTTGACAMayer et al (2014)
bdi-miR5064CGAATTTGTCCATAGCATCAGMayer et al (2014)
bdi-miR5066AAGTGTATAAGTGGAGTGCCTMayer et al (2014)
bdi-miR5067TCAGCGACAACTAATATGGATMayer et al (2014)
bdi-miR5068ATCGGGTAGAGCGGGTATGGGTATMayer et al (2014)
bdi-miR5069TAGGTTATTGATTTGACCAACMayer et al (2014)
bdi-miR5070AACTAAGTAGGGTCAGAGGGTMayer et al (2014)
bdi-miR5164CGCAACTTTGTCTAGATACGCMayer et al (2014)
bdi-miR5169TTTGACCAAGTTTGTAGAACAMayer et al (2014)
bdi-miR5171ACTTAATATGGGACGGAAGAAMayer et al (2014)
bdi-miR5174CTCCGTTCCATAAAGATTGGCMayer et al (2014)
bdi-miR5175aAAGAATTTAGGAACGGAGGGAMayer et al (2014)
bdi-miR5175bCCTCTGTTCCTAAATTCTTGTMayer et al (2014)
bdi-miR5176-3pTGTGATGATGTGGCATAGAATMayer et al (2014)
bdi-miR5180aTAAGTGTCTCAGTTTTGAACTMayer et al (2014)
bdi-miR5181aTGATCCATAATAAGTGTCAGGMayer et al (2014)
bdi-miR5181bTCCGATCCATAATAAGTGTCGMayer et al (2014)
bdi-miR5182TGATGATCTTGGAACACGTGCMayer et al (2014)
bdi-miR5183TATTTGGACAAATTTGAGTCAMayer et al (2014)
bdi-miR5185aTTCTAGTTCATTTTTCAAATCMayer et al (2014)
bdi-miR5198GGGGAAAAGAGATTGAGGGAGMayer et al (2014)
bdi-miR5200TGTAGATACTCTCTAAGGCTTMayer et al (2014)
bdi-miR5202TTACGTGAGTTAAATCGTCGAMayer et al (2014)
bdi-miR5203ACTTATTATGGACCGGAGGGAMayer et al (2014)
bna-miR169gTAGCCAAGGATGACTTGCCTGCMayer et al (2014)
bna-miR169mTGAGCCAAAGATGACTTGCCGMayer et al (2014)
bra-miR172bQGCAGCACCATTAAGATTCACAMayer et al (2014)
cme-miR168TCGCTTGGTGCAGGTCGGGAMayer et al (2014)
cre-miR1166_2AGGTCCATGACCTCATGGGMayer et al (2014)
cre-miR1167GGGGTGTGATGATTTGAAACMayer et al (2014)
cre-miR1171TGGAGTGGAGTGGAGTGGAGTGGMayer et al (2014)
cre-miR905QAGGTCCCTGGATATGGCACCMayer et al (2014)
crt-miR166aTCGGACCAGGCTTCATTCCCGTMayer et al (2014)
csi-miR166cTCGGACCAGGCTTCATTCCCMayer et al (2014)
csi-miR169GAGCCAAGAATGACTTGCCGAMayer et al (2014)
csi-miR171aTTGAGCCGCGCCAATATCACMayer et al (2014)
csi-miR172aQGCAGCGTCCTCAAGATTCACAMayer et al (2014)
csi-miR172bAGAATCTTGATGATGCGGCAAMayer et al (2014)
csi-miR172cTGGAATCTTGATGATGCTGCAGMayer et al (2014)
csi-miR319TTTGGACTGAAGGGAGCTCCTMayer et al (2014)
csi-miR393ATCCAAAGGGATCGCATTGATCMayer et al (2014)
csi-miR3951TAGATAAAGATGAGAGAAAAAMayer et al (2014)
csi-miR396cTTCAAGAAATCTGTGGGAAGMayer et al (2014)
csi-miR479TGTGATATTGGTTCGGCTCATCMayer et al (2014)
csi-miR827TTAGATGACCATCAACAAACAMayer et al (2014)
far-miR1134CGACAACAACAACAAGAAGAAGAGMayer et al (2014)
far-miR164aTGGAGAAGCAGGGCACTTGCTMayer et al (2014)
far-miR437AAACATAGAGAAGTTTGACTTMayer et al (2014)
ghr-miR156cTGTCAGAAGAGAGTGAGCACMayer et al (2014)
ghr-miR393TCCAAAGGGATCGCATTGATCTMayer et al (2014)
ghr-miR399cTGCCAAAGGAGAGTTGGCCTTMayer et al (2014)
ghr-miR479CGTGATATTGGTTCGGCTCATCMayer et al (2014)
ghr-miR482aTCTTTCCTACTCCTCCCATACCMayer et al (2014)
gma-miR1507cQGAGGTGTTTGGGATGAGAGAAMayer et al (2014)
gma-miR1511AACCAGGCTCTGATACCATGMayer et al (2014)
gma-miR1514aTTCATTTTTAAAATAGGCATTMayer et al (2014)
gma-miR1514bTTCATTTTTAAAATAGACATTMayer et al (2014)
gma-miR1516bAGCTTCTCTACAGAAAATATAMayer et al (2014)
gma-miR1519TAAGTGTTGCAAAATAGTCATTMayer et al (2014)
gma-miR1530TTTTCACATAAATTAAAATATMayer et al (2014)
gma-miR1533ATAATAAAAATAATAATGAMayer et al (2014)
gma-miR1534TATTTTGGGTAAATAGTCATMayer et al (2014)
gma-miR159a-5pGAGCTCCTTGAAGTCCAATTGMayer et al (2014)
gma-miR159cATTGGAGTGAAGGGAGCTCCGMayer et al (2014)
gma-miR159e-5pGAGCTCCTTGAAGTCCAATTMayer et al (2014)
gma-miR164bTGGAGAAGCAGGGCACGTGCMayer et al (2014)
gma-miR166j-3pTCGGACCAGGCTTCATTCCCGMayer et al (2014)
gma-miR169cAAGCCAAGGATGACTTGCCGAMayer et al (2014)
gma-miR169dTGAGCCAAGGATGACTTGCCGGTMayer et al (2014)
gma-miR169eAGCCAAGGATGACTTGCCGGMayer et al (2014)
gma-miR169j-3pTTTCGACGAGTTGTTCTTGGCMayer et al (2014)
gma-miR169j-5pTAGCCAAGAATGACTTGCCGGMayer et al (2014)
gma-miR169kCAGCCAAGAATGACTTGCCGGMayer et al (2014)
gma-miR169nCAGCCAAGGGTGATTTGCCGGMayer et al (2014)
gma-miR171i-5pATAAGAAAGCAATGCTCAAAMayer et al (2014)
gma-miR172b-5pGTAGCATCATCAAGATTCACMayer et al (2014)
gma-miR172cGGAATCTTGATGATGCTGCAGMayer et al (2014)
gma-miR172dGGAATCTTGATGATGCTGCAGCAGMayer et al (2014)
gma-miR172gGCAGCACCATCAAGATTCACMayer et al (2014)
gma-miR172h-5pGCAGCAGCATCAAGATTCACAMayer et al (2014)
gma-miR2108aTTAATGTGTTGTGTTTGTCGGMayer et al (2014)
gma-miR319cTTGGACTGAAAGGAGCTCCTMayer et al (2014)
gma-miR319gTTGGACTGAAGGGAGCTCCTTCMayer et al (2014)
gma-miR3522AGACCAAATGAGCAGCTGAMayer et al (2014)
gma-miR390bAAGCTCAGGAGGGATAGCACCMayer et al (2014)
gma-miR396a-3pTTCAATAAAGCTGTGGGAAGMayer et al (2014)
gma-miR396b-3pGCTCAAGAAAGCTGTGGGAGAMayer et al (2014)
gma-miR396hTCCACAGCTTTCTTGAACTGMayer et al (2014)
gma-miR403aTTAGATTCACGCACAAACTTGMayer et al (2014)
gma-miR4347AAGCTTCTTACGGATCAAGTTGATMayer et al (2014)
gma-miR4352aATTTCTAGGACATACTACGACGGTMayer et al (2014)
gma-miR4412-5pTGTTGCGGGTATCTTTGCCTCMayer et al (2014)
gma-miR4413AAGAGAATTGTAAGTCACTGMayer et al (2014)
gma-miR482b-3pTCTTCCCTACACCTCCCATACCMayer et al (2014)
gma-miR5031TTAATGATTAACATCTAATTTMayer et al (2014)
gma-miR5032AGAGCCACTTTTGGGTTCCCTATMayer et al (2014)
gma-miR5035CTTCTAAACATTTTTTCCCTTAMayer et al (2014)
gma-miR5040ATGATATATAACAAGCATGAGMayer et al (2014)
gma-miR530TGCATTTGCACCTGCACTTTMayer et al (2014)
gma-miR530bTGCATTTGCACCTGCACTTTAMayer et al (2014)
gma-miR5369TGAGAAAAGGAGGATGTCAMayer et al (2014)
gma-miR5674TAATTGTGTTGTACATTATCAMayer et al (2014)
gma-miR5675TAGAGACGACAACAATGGAAAMayer et al (2014)
gma-miR5678TTCCATGATAAGATCTTTGACMayer et al (2014)
gso-miR3522aTGAGACCAAATGAGCAGCTGAMayer et al (2014)
gso-miR482aTCTTCCCTACACCTCCCATACMayer et al (2014)
hvu-miR1120ACATTCTTATATTATGGGACGGAGMayer et al (2014)
hvu-miR1126TCAACTATGGACTACATACGGAAMayer et al (2014)
hvu-miR5048TATTTGCAGGTTTTAGGTCTAAMayer et al (2014)
hvu-miR5049TCCTAAATACTTGTTGTTGGGMayer et al (2014)
hvu-miR5050TTGAGGTCGTTCAACCAGCAAMayer et al (2014)
mtr-miR1510bQCCATGGATCCCTACCATGTGGMayer et al (2014)
mtr-miR156jTGACAGAAGAGGGTGAGCACMayer et al (2014)
mtr-miR164dTGGAGAAGCAGGGCACATGCTMayer et al (2014)
mtr-miR167bQGATCATGTTGGAGCTTCACCMayer et al (2014)
mtr-miR169dAAGCCAAGGATGACTTGCCGGMayer et al (2014)
mtr-miR169eGGAGCCAAGGATGACTTGCCGMayer et al (2014)
mtr-miR169fAAGCCAAGGATGACTTGCCTAMayer et al (2014)
mtr-miR169hGAGCCAAAGATGACTTGCCGGMayer et al (2014)
mtr-miR169mGAGCCAAGGATGACTTGCCGGMayer et al (2014)
mtr-miR171TGATTGAGTCGTGCCAATATCMayer et al (2014)
mtr-miR171cTGATTGAGCCGTGCCAATATTMayer et al (2014)
mtr-miR171eAGATTGAGCCGCGCCAATATCMayer et al (2014)
mtr-miR172cQGTAGCATCATCAAGATTCACAMayer et al (2014)
mtr-miR2592blQGAGTAATTCAAACTTGTTAAAMayer et al (2014)
mtr-miR2592sAAATGCTTGAGTCATGTTGTTMayer et al (2014)
mtr-miR2593aTTAAATGAATGAACCTAGAATMayer et al (2014)
mtr-miR2607ATGTGATTATGTGATAAGTGTMayer et al (2014)
mtr-miR2611TATTTGTCAGTGTTTGATGAAMayer et al (2014)
mtr-miR2628CATGAAAGAATGATGAGTAAMayer et al (2014)
mtr-miR2637AAATACTTCCTCTGATCACTGMayer et al (2014)
mtr-miR2642ATGAGTTTCATCAAATCATGTMayer et al (2014)
mtr-miR2643TTTGGGATCAGAAATTAGAGAMayer et al (2014)
mtr-miR2645TTTCTAGAGATGAGCATATATMayer et al (2014)
mtr-miR2651TTTGATTGGTATGCCTGCATTMayer et al (2014)
mtr-miR2652aTATGCAGGGTGCATAAGGATTMayer et al (2014)
mtr-miR2656aAAGTTGCATAATCGAGTTGGMayer et al (2014)
mtr-miR2661TAGGTTTGAGAAAATGGGCAGMayer et al (2014)
mtr-miR2673aCCTCTTCCTCTTCCTCTTCCACMayer et al (2014)
mtr-miR395bATGAAGTATTTGGGGGAACTCMayer et al (2014)
mtr-miR395hATGAAGTGTTTGGGGGAACTTMayer et al (2014)
mtr-miR399aTGCCAAAGGAGATTTGCCCAGMayer et al (2014)
mtr-miR399bTGCCAAAGGAGAGCTGCCCTGMayer et al (2014)
mtr-miR399dTGCCAAAGGAGAGCTGCCCTAMayer et al (2014)
mtr-miR399jCGCCAAAGAAGATTTGCCCCGMayer et al (2014)
mtr-miR399kTGCCAAAGAAGATTTGCCCTGMayer et al (2014)
mtr-miR399qTGCCAAAGGAGAGCTGCTCTTMayer et al (2014)
mtr-miR399rTGCCAAAGAAGATTTGCCCCGMayer et al (2014)
mtr-miR4414bTGTGAATGATGCGGGAGCTAAMayer et al (2014)
mtr-miR5205aCATACAATTTGGGACGGAGGGAGMayer et al (2014)
mtr-miR5205bCTTATAATTAGGGACGGAGGGAGTMayer et al (2014)
mtr-miR5205cCTTATAATTAGGGACGGAGGTAGTMayer et al (2014)
mtr-miR5212TGGATTTCGTATTTCTTTGGTAMayer et al (2014)
mtr-miR5227TGAAGAGAAGAAGATTGATGAAMayer et al (2014)
mtr-miR5235aATAAGGTCAATGATTGGCGTGMayer et al (2014)
mtr-miR5240TTGAAAAAATTGTGGATTTGAMayer et al (2014)
mtr-miR5248TTTTTAGTTGGCATGCATTCAMayer et al (2014)
mtr-miR5252TGAGAGCTCACTGAAGTCTGCMayer et al (2014)
mtr-miR5254AGGAGGTGGAAGCATTTGTGAMayer et al (2014)
mtr-miR5268aCCAGAGTGGAATGAAGATATGGTTMayer et al (2014)
mtr-miR5281aCTCTTGTAAATAGGATCGGAGGGAMayer et al (2014)
mtr-miR5281bTCTTATAAATAGGACCGGAGGGAGMayer et al (2014)
mtr-miR5287bTGCTTATAATAGTGATCGGAGGGTMayer et al (2014)
mtr-miR5293GATGAAGAAGTGGAAGGAAGAAGAMayer et al (2014)
mtr-miR5298bTGATGGAGATGATATGAAGATGAAMayer et al (2014)
mtr-miR5556QTGGAATTCTTCCGCCATCCAAMayer et al (2014)
mtr-miR5557QAACAAGTACTAAGGAAGCACAMayer et al (2014)
mtr-miR5561CATTTGGAGAGACATAGACAAMayer et al (2014)
osa-miR1320TGGAACGGAGGAATTTTATAGMayer et al (2014)
osa-miR1429-5pGTAATATACTAATCCGTGCATMayer et al (2014)
osa-miR1435TTTCTTAAGTCAAACTTTTTMayer et al (2014)
osa-miR1439TTTTGGAACGGAGTGAGTATTMayer et al (2014)
osa-miR1440TGCTCAAATACCACTCTCCTMayer et al (2014)
osa-miR156lCGACAGAAGAGAGTGAGCATAMayer et al (2014)
osa-miR159cATTGGATTGAAGGGAGCTCCAMayer et al (2014)
osa-miR159dATTGGATTGAAGGGAGCTCCGMayer et al (2014)
osa-miR159eATTGGATTGAAGGGAGCTCCTMayer et al (2014)
osa-miR159fCTTGGATTGAAGGGAGCTCTAMayer et al (2014)
osa-miR164cTGGAGAAGCAGGGTACGTGCAMayer et al (2014)
osa-miR164eTGGAGAAGCAGGGCACGTGAGMayer et al (2014)
osa-miR169dTAGCCAAGGATGAATTGCCGGMayer et al (2014)
osa-miR169pTAGCCAAGGACAAACTTGCCGGMayer et al (2014)
osa-miR171hGTGAGCCGAACCAATATCACTMayer et al (2014)
osa-miR171iGGATTGAGCCGCGTCAATATCMayer et al (2014)
osa-miR172cTGAATCTTGATGATGCTGCACMayer et al (2014)
osa-miR1846d-3pTATCCGGCGCCGCAGGGAGGMayer et al (2014)
osa-miR1847_2TGGCCCACATGTTAGTGCCACAACMayer et al (2014)
osa-miR1850_2TTGTGTGTGAACTAAACGTGGMayer et al (2014)
osa-miR1853-3pTAATTGGGGATGTTCGGTTGCTMayer et al (2014)
osa-miR1857-3pTCATGCTCCAAGAAAACCAGGMayer et al (2014)
osa-miR1861hCGGTCTTGAGGCAGGAACTGAGMayer et al (2014)
osa-miR1867TTTTTTTTCTAGGACAGAGGGAGTMayer et al (2014)
osa-miR1884b-3pAAAGTCAACGGTGTCATATATTTAMayer et al (2014)
osa-miR2092-5pCAACTGAAGTCGGTGTTTACTMayer et al (2014)
osa-miR2095-3pCTTCCATTTATGATAAGTATMayer et al (2014)
osa-miR2118aTTCTCGATGCCTCCCATTCCTAMayer et al (2014)
osa-miR2118cTTCCCGATGCCTCCTATTCCTAMayer et al (2014)
osa-miR2118dTTCCTGATGCCTCCCATGCCTAMayer et al (2014)
osa-miR2118eTTCCCAATGCCTCCCATGCCTAMayer et al (2014)
osa-miR2118fTTCCTGATGCCTCCCATTCCTAMayer et al (2014)
osa-miR2118lTTCCTAATGCTTCCCATTCCTAMayer et al (2014)
osa-miR2120AAAGATCTTTAGTCCCGGTTGTTCMayer et al (2014)
osa-miR2275cAGAATTGGAGGAAAACAAACTGAMayer et al (2014)
osa-miR2275dCTTGTTTTTCTCCAATATCTCAMayer et al (2014)
osa-miR2871a-3pTATTTTAGTTTCTATGGTCACMayer et al (2014)
osa-miR2905TACATGTCAGTGACAAAGGCAMayer et al (2014)
osa-miR2919AAGGGGGGGGGGGGAAAGAMayer et al (2014)
osa-miR2923AGACAAAAATATAAATAACAAAMayer et al (2014)
osa-miR319a-3p_2TTGGACTGAAGGGTGCTCCCMayer et al (2014)
osa-miR393b-3pTCAGTGCAATCCCTTTGGAATMayer et al (2014)
osa-miR395aGTGAAGTGCTTGGGGGAACTCMayer et al (2014)
osa-miR395cGTGAAGTGTTTGGAGGAACTCMayer et al (2014)
osa-miR395fGTGAATTGTTTGGGGGAACTCMayer et al (2014)
osa-miR395oATGAAGTGTTTGGAGGAACTCMayer et al (2014)
osa-miR395tGTGAAGTGTTTGGGGAAACTCMayer et al (2014)
osa-miR396fTCTCCACAGGCTTTCTTGAACTMayer et al (2014)
osa-miR396gTCCACAGGCTTTCTTGAACGGMayer et al (2014)
osa-miR3982-5pGCGCTCCACGTAGGCAACAATMayer et al (2014)
osa-miR399hTGCCAAAGGAGACTTGCCCAGMayer et al (2014)
osa-miR399kTGCCAAAGGAAATTTGCCCCGMayer et al (2014)
osa-miR413CTAGTTTCACTTGTTCTGCACMayer et al (2014)
osa-miR414TCATCCTCATCATCATCGTCCMayer et al (2014)
osa-miR415AACAGAACAGAAGCAGAGCAGMayer et al (2014)
osa-miR417GAATGTAGTGAATTTGTTCCAMayer et al (2014)
osa-miR435TTATCCGGTATTGGAGTTGAMayer et al (2014)
osa-miR437AAAGTTAGAGAAGTTTGACTTMayer et al (2014)
osa-miR438TTCCCACGCGTTATAGTGAAAMayer et al (2014)
osa-miR5079TTTGGATCTGTTATTTTGGTATMayer et al (2014)
osa-miR5083AGACTACAATTATCTGATCAMayer et al (2014)
osa-miR5161TCTGGATCAGAGGGAGTATAMayer et al (2014)
osa-miR5162AAATGACCAAAATACCCCTAGAACMayer et al (2014)
osa-miR529aCTGTACCCTCTCTCTTCTTCMayer et al (2014)
osa-miR530-5pTGCATTTGCACCTGCACCTAMayer et al (2014)
osa-miR5337AAATTACTTGTCGTTCTAGCTMayer et al (2014)
osa-miR5340TGATGACGTGGATGAATTTCAAAMayer et al (2014)
osa-miR5485TGACAACTGGTAGCAGAGCAAMayer et al (2014)
osa-miR5496CCAGCCGGTGGCATAGTTCTCMayer et al (2014)
osa-miR5532ATGGAATATATGACAAAGGTGGMayer et al (2014)
osa-miR815aAAGGGGATTGAGGAGATTGGGMayer et al (2014)
osa-miR816GTGACATATTTTACTACAACMayer et al (2014)
osa-miR818aAATCCCTTATATTATGGGACGGMayer et al (2014)
osa-miR820aTCGGCCTCGTGGATGGACCAGMayer et al (2014)
pab-miR3700GACGCCCAAAACTGAAGGTCAMayer et al (2014)
pab-miR3706TTTCGGAGAAATGGATAAGAMayer et al (2014)
pab-miR395CTGAAGTGTTTGGAGGAACTTMayer et al (2014)
pab-miR396aTTCCACAGCTTTCTTGAACTAMayer et al (2014)
pab-miR396bTTCCACGGCTTTCTTGAACTTMayer et al (2014)
pab-miR482aTCTTCCCTACTCCTCCCATTCCMayer et al (2014)
pab-miR482cTCTTTCCTACTCCTCCCATTCCMayer et al (2014)
ppt-miR1023c-5pCCACTCTCTCCGTTTCCCTTCCMayer et al (2014)
ppt-miR1025TGCCACAACAAAGCTAATAACMayer et al (2014)
ppt-miR1027aTTTCTATCTTCTCTTCCAATCMayer et al (2014)
ppt-miR1028a-3pTGACATTGTAGATCTACGTGCMayer et al (2014)
ppt-miR1029TCTCTCTCAACCAACCATACMayer et al (2014)
ppt-miR1030aTCTGCATCTGCACCTGCACCAMayer et al (2014)
ppt-miR1030hTCTGCATCTGCACCTGCACCGMayer et al (2014)
ppt-miR1030iCCTGCATCTGCACCTGCACCGMayer et al (2014)
ppt-miR1030jCCTGCATCTGCACCTGCACCAMayer et al (2014)
ppt-miR1044-3pTTGTAGTGCATATTTGTTTTMayer et al (2014)
ppt-miR1046-3pTGGTGAAAAATATGAAAAATCMayer et al (2014)
ppt-miR1046-5pTGGATTTCATATTTTTCACGMayer et al (2014)
ppt-miR1049TCTCTCTTAGCCAAACAGTCTMayer et al (2014)
ppt-miR1054TAAACCCTCTCTCTATTCCTGMayer et al (2014)
ppt-miR1217-3pAATTTGAAGCATGATGTCAAGMayer et al (2014)
ppt-miR1217-5pTGGTATCATGTTGCAAATGGCMayer et al (2014)
ppt-miR160cCGCCTGGCTCCCTGCATGCCAMayer et al (2014)
ppt-miR160gTGCCTGGCTCCTTGTATGCCAMayer et al (2014)
ppt-miR160hCGCCTGGCTCCTTGTATGCCAMayer et al (2014)
ppt-miR166jTCCGGACCAGGCTTCATTCCCMayer et al (2014)
ppt-miR166mTCGGACCAGGCATCATTCCTTMayer et al (2014)
ppt-miR167GGAAGCTGCCAGCATGATCCTMayer et al (2014)
ppt-miR171bTTGAGCCGCGCCAATATCACAMayer et al (2014)
ppt-miR2079AGAGTTGATGTTGATGACGCAMayer et al (2014)
ppt-miR319aCTTGGACTGAAGGGAGCTCCMayer et al (2014)
ppt-miR390cGAGCTCAGGAGGGATAGCGCCMayer et al (2014)
ppt-miR414TCATCCTCATCATCCTCGTCCMayer et al (2014)
ppt-miR534aTATGTCCATTGCAGTTGCATACMayer et al (2014)
ppt-miR536fTTCGTGCCAAGCTGTGTGCAMayer et al (2014)
ppt-miR902d-3pATGAAGGTCTGCATCGTAGCMayer et al (2014)
ppt-miR902k-3pACGAAGGATCTGCAATATAAAMayer et al (2014)
pta-miR159aTTGGATTGAAGGGAGCTCCAMayer et al (2014)
pta-miR159bTTGGATTGAAGAGAGCTCCCMayer et al (2014)
pta-miR159cCTTGGATTGAAGGGAGCTCCCMayer et al (2014)
pta-miR319TTGGACTGAAGGGAGCTCCMayer et al (2014)
pta-miR390AAGCCCAGGATGGATAGCGCCMayer et al (2014)
pta-miR482dTCCTCCCTACTCCTCCCATTMayer et al (2014)
pta-miR783ATGCTTTGCTGGTTCATTTTCMayer et al (2014)
pta-miR952bAACTGAGAATGCCATTGGTGMayer et al (2014)
ptc-miR156kTGACAGAAGAGAGGGAGCACMayer et al (2014)
ptc-miR159dCTTGGATTGAAGGGAGCTCCTMayer et al (2014)
ptc-miR159fATTGGAGTGAAGGGAGCTCGAMayer et al (2014)
ptc-miR160hTGCCTGGCTCCCTGCATGCCAMayer et al (2014)
ptc-miR167hTGAAGCTGCCAACATGATCTGMayer et al (2014)
ptc-miR169aaGAGCCAAGAATGACTTGTCGGMayer et al (2014)
ptc-miR169abTAGCCAAGGACGACTTGCCCAMayer et al (2014)
ptc-miR169oAAGCCAAGGATGACTTGCCTGMayer et al (2014)
ptc-miR169qTAGCCAAGGACGACTTGCCTGMayer et al (2014)
ptc-miR169sTCAGCCAAGGATGACTTGCCGMayer et al (2014)
ptc-miR169tGAGCCAAGAATGACTTGCCGGMayer et al (2014)
ptc-miR169uTAGCCAAGGACGACTTGCCTAMayer et al (2014)
ptc-miR169vTAGCCAAGGATGACTTGCCCAMayer et al (2014)
ptc-miR169xTAGCCAAGGATGACTTGCTCGMayer et al (2014)
ptc-miR169zCAGCCAAGAATGATTTGCCGGMayer et al (2014)
ptc-miR171jGGATTGAGCCGCGCCAATACTMayer et al (2014)
ptc-miR171kGGATTGAGCCGCGCCAATATCMayer et al (2014)
ptc-miR172iAGAATCCTGATGATGCTGCAAMayer et al (2014)
ptc-miR319eTTGGACTGAAGGGAGCTCCTMayer et al (2014)
ptc-miR319iTTGGGCTGAAGGGAGCTCCCMayer et al (2014)
ptc-miR394a-3pCTGTTGGTCTCTCTTTGTAAMayer et al (2014)
ptc-miR396fTTCCACGGCTTTCTTGAACTGMayer et al (2014)
ptc-miR397cTCATTGAGTGGAGCTTTGATGMayer et al (2014)
ptc-miR399hTGCCAAAGGAGAGTTTCCCTGMayer et al (2014)
ptc-miR399jTGCCAAAGGAGATTTGTCCGGMayer et al (2014)
ptc-miR399lCGCCAAAGGAGAGTTGCCCTCMayer et al (2014)
ptc-miR476aTAGTAATCCTTCTTTGCAAAGMayer et al (2014)
ptc-miR482_1CCTACTCCTCCCATTCCMayer et al (2014)
ptc-miR482_2TCTTGCCTACTCCTCCCATTMayer et al (2014)
rgl-miR5138AAAAATCGTTAGGCGCTAMayer et al (2014)
rgl-miR5139AAACCTGGCTCTGATACCAMayer et al (2014)
sbi-miR1435aTTTCTTAAGTCAAACTTTTCMayer et al (2014)
sbi-miR1435bTTTCTTAAGTCAAACCTTTTMayer et al (2014)
sbi-miR169oTAGCCAAGGATGATTTGCCTGMayer et al (2014)
sbi-miR171fATGAGCCGAACCAATATCACTMayer et al (2014)
sbi-miR172bGGAATCTTGATGATGCTGCAMayer et al (2014)
sbi-miR172fAGAATCCTGATGATGCTGCACMayer et al (2014)
sbi-miR399kTGCCAAAGGGGATTTGCCCGGMayer et al (2014)
sbi-miR5382CCAATCTAAACAGGCCCTMayer et al (2014)
sbi-miR5387TAACACGAACCGGTGCTAAAGGATCMayer et al (2014)
sbi-miR5387bCGTGGCTCTGACCGGTGCTAAAGGMayer et al (2014)
sbi-miR5565eTTGTTTGGATGTTGTCGGAMayer et al (2014)
sbi-miR5566TCAGCATCACCTCCCTGTTGTMayer et al (2014)
sbi-miR5570AAAAGACAAATCAGCATGTCAMayer et al (2014)
sly-miR1919aACGAGAGTCATCTGTGACAGGMayer et al (2014)
smo-miR1081TGAGGCTTGCCTTTGATTCTCMayer et al (2014)
smo-miR1088-5pCAGAAGAAAGAGAGCACGCATMayer et al (2014)
smo-miR1090TGAAAGCCATTCTCAACAAAAMayer et al (2014)
smo-miR1092TGACAGGAATGCATTGGTGTTMayer et al (2014)
smo-miR1094bTACTTCTCTGTTCCACAGTACMayer et al (2014)
smo-miR1103-3pTGGAAAAAGGAGGTGCATTCTTGTMayer et al (2014)
smo-miR396TTCCACGGCTTTCTTGAACCMayer et al (2014)
sof-miR159eTTTGGATTGAAAGGAGCTCTTMayer et al (2014)
ssl-miR1078CTTGATTGATTCAATTGTGATMayer et al (2014)
ssl-miR164aTGGAGAAGYAGGGCACGTGCAMayer et al (2014)
ssl-miR171bTTGAGCCGCGCCAATATCACTMayer et al (2014)
ssl-miR398TGTGTTCTCAGGTCACCCCTCMayer et al (2014)
ssl-miR828TCTTGCTCAAATGAGTATTCCAMayer et al (2014)
tcc-miR169fAAGCCAAGAATGACTTGCCTGMayer et al (2014)
tcc-miR169gTAGCCAGGGATGACTTGCCTAMayer et al (2014)
tcc-miR169iTAGCCAAGGATGAGTTGCCTGMayer et al (2014)
tcc-miR169nTGAGTCAAGAATGACTTGCCGMayer et al (2014)
tcc-miR172dAGAATCCTGATGATGCTGCATMayer et al (2014)
tcc-miR399aCGCCAAAGGAGAGTTGCCCTGMayer et al (2014)
tcc-miR399cTGCCAATGGAGATTTGCCCAGMayer et al (2014)
tcc-miR399eCGCCAAAGGAGAATTGCCCTGMayer et al (2014)
tcc-miR399fTGCCAGAGGAGATTTGCCCTGMayer et al (2014)
vun-miR164TGGAGAAGGGGAGCACGTGCAMayer et al (2014)
vun-miR319bCTTGGACTGAAGGGAGCTCCTMayer et al (2014)
vvi-miR156hTGACAGAAGAGAGAGAGCATMayer et al (2014)
vvi-miR159aCTTGGAGTGAAGGGAGCTCTCMayer et al (2014)
vvi-miR166aTCGGACCAGGCTTCATTCCMayer et al (2014)
vvi-miR169bTGAGCCAAGGATGGCTTGCCGMayer et al (2014)
vvi-miR169iGAGCCAAGGATGACTGGCCGTMayer et al (2014)
vvi-miR169lGAGCCAAGGATGACTTGCCGTMayer et al (2014)
vvi-miR169oGAGCCAAGGATGACTTGCCGCMayer et al (2014)
vvi-miR169rTGAGTCAAGGATGACTTGCCGMayer et al (2014)
vvi-miR169tCGAGTCAAGGATGACTTGCCGMayer et al (2014)
vvi-miR169vAAGCCAAGGATGAATTGCCGGMayer et al (2014)
vvi-miR169yTAGCGAAGGATGACTTGCCTAMayer et al (2014)
vvi-miR171gTTGAGCCGAACCAATATCACCMayer et al (2014)
vvi-miR171hTGGTTGAGCCGCGCCAATATCMayer et al (2014)
vvi-miR172aTGAATCTTGATGATGCTACATMayer et al (2014)
vvi-miR172bTGAATCTTGATGATGCTACACMayer et al (2014)
vvi-miR3632TTTCCCAGACCCCCAATACCAAMayer et al (2014)
vvi-miR396bTTCCACAGCTTTCTTGAACTMayer et al (2014)
vvi-miR399fTGCCGAAGGAGATTTGTCCTGMayer et al (2014)
vvi-miR399gTGCCAAAGGAGATTTGCCCCTMayer et al (2014)
vvi-miR479TGTGGTATTGGTTCGGCTCATCMayer et al (2014)
vvi-miR845aTAGCTCTGATACCAATTGATAMayer et al (2014)
zma-miR156aQGCTCACTTCTCTCTCTGTCAGTMayer et al (2014)
zma-miR156bQGCTCACCCTCTATCTGTCAGTMayer et al (2014)
zma-miR156dQGCTCACTTCTCTTTCTGTCAGCMayer et al (2014)
zma-miR156eQGCTCACTGCTCTCTCTGTCATCMayer et al (2014)
zma-miR156hQGCTCACTGCTCTTTCTGTCATCMayer et al (2014)
zma-miR156iQGCTCACTGCTCTATCTGTCATCMayer et al (2014)
zma-miR159bQGTGCTCCCTTCAAACCAATAAMayer et al (2014)
zma-miR159cQGAGCTCCCTTCGATCCAATCCMayer et al (2014)
zma-miR159eATTGGTTTGAAGGGAGCTCCAMayer et al (2014)
zma-miR159gTTTGGAGTGAAGGGAGTTCTGMayer et al (2014)
zma-miR159hTTTGGAGTGAAGGGAGCTCTGMayer et al (2014)
zma-miR160dQGCGTGCGTGGAGCCAAGCATGMayer et al (2014)
zma-miR164cQCATGTGCCCTTCTTCTCCATCMayer et al (2014)
zma-miR164dQCACGTGGTCTCCTTCTCCATMayer et al (2014)
zma-miR164fQCACGTGCGCTCCTTCTCCAACMayer et al (2014)
zma-miR164hTGGAGAAGCAGGGCACGTGTGMayer et al (2014)
zma-miR166hQGGAATGACGTCCGGTCCGAACMayer et al (2014)
zma-miR167bQGATCATGCTGTGACAGTTTCACTMayer et al (2014)
zma-miR167cQGATCATGCTGTGGCAGCCTCACTMayer et al (2014)
zma-miR167eQGATCATGCTGTGCAGTTTCATCMayer et al (2014)
zma-miR167hQGATCATGTTGCAGCTTCACMayer et al (2014)
zma-miR167jQGATCATGTGGCAGTTTCATTMayer et al (2014)
zma-miR169aQGGCAAGTTGTTCTTGGCTACAMayer et al (2014)
zma-miR169cQGGCAAGTCTGTCCTTGGCTACAMayer et al (2014)
zma-miR169dTAGCCAAGGAGACTGCCTATGMayer et al (2014)
zma-miR169eTAGCCAAGGAGACTGCCTACGMayer et al (2014)
zma-miR169fQGGCATGTCTTCCTTGGCTACTMayer et al (2014)
zma-miR169lTAGCCAGGGATGATTTGCCTGMayer et al (2014)
zma-miR169oQGGCAGGTCTTCTTGGCTAGCMayer et al (2014)
zma-miR171aTGATTGAGCCGCGCCAATATMayer et al (2014)
zma-miR171aQTATTGGCGAGGTTCAATCAGAMayer et al (2014)
zma-miR171bTTGAGCCGTGCCAATATCACMayer et al (2014)
zma-miR171bQGATATTGGCGCGGTTCAATCMayer et al (2014)
zma-miR171cQTATTGGTGCGGTTCAATCAGAMayer et al (2014)
zma-miR171dQTGTTGGCTCGGCTCACTCAGAMayer et al (2014)
zma-miR171fQCGATGTTGGCATGGCTCAATCMayer et al (2014)
zma-miR171hQTGGTATTGTTTCGGCTCATGTMayer et al (2014)
zma-miR171lQTATTGGCGTGCCTCAATCCGAMayer et al (2014)
zma-miR171mQTATTGGCGCGCCTCAATCCGAMayer et al (2014)
zma-miR172bQCAGCACCATCAAGATTCACAMayer et al (2014)
zma-miR172cQCAGCACCACCAAGATTCACAMayer et al (2014)
zma-miR2118gTTCCTGATGCCTCCTATTCCTAMayer et al (2014)
zma-miR2275a-3pTTTGTTTTCCTCCAATATCTCAMayer et al (2014)
zma-miR2275b-5pAGGATTAGAGGCAACTGAACCMayer et al (2014)
zma-miR2275d-3pTTTGTTTTCCTCTAATATCTCAMayer et al (2014)
zma-miR319aQGAGCTCTCTTCAGTCCACTCMayer et al (2014)
zma-miR319bQAGAGCGTCCTTCAGTCCACTCMayer et al (2014)
zma-miR393aQATCAGTGCAATCCCTTTGGAATMayer et al (2014)
zma-miR393bQATCAATGCGATCCTTTTGGAGGMayer et al (2014)
zma-miR393cQGTCAGTGCAATCCCTTTGGAATMayer et al (2014)
zma-miR395bQGTTCCCTACAAGCACTTCACAAMayer et al (2014)
zma-miR395cQGTTCCCTGCAAACACTTCACCAMayer et al (2014)
zma-miR395eQGTTCCCTTCAAGCACTTCACATMayer et al (2014)
zma-miR395iQGTTCCCTACAAGCACTTCACGAMayer et al (2014)
zma-miR395kGTGAAGTGTTTGAGGAAACTCMayer et al (2014)
zma-miR395kQGTTTCCTTCAAGCACTTCACATMayer et al (2014)
zma-miR395lQGTTCCTTCCAAACACTTCACCAMayer et al (2014)
zma-miR395mQGTTCCTTTCAAACACTTCACATMayer et al (2014)
zma-miR395nQGTTCTCTACAAGCACTTCACGAMayer et al (2014)
zma-miR395oGTGAAGTGTTTGGGTGAACTCMayer et al (2014)
zma-miR395oQGTTCTCTTCAAGCACTTCACGAMayer et al (2014)
zma-miR396eQGGTCAAGAAAGCCGTGGGAAGMayer et al (2014)
zma-miR396gTCCCACAGCTTTATTGAACTGMayer et al (2014)
zma-miR396gQGTTCAAGAAAGCTGTGGAAGAMayer et al (2014)
zma-miR398aQGGGGCGAACTGAGAACACATGMayer et al (2014)
zma-miR398bQGGGGCGGACTGGGAACACATGMayer et al (2014)
zma-miR399bTGCCAAAGGAGAGCTGTCCTGMayer et al (2014)
zma-miR399fQGGGCAACTTCTCCTTTGGCAGAMayer et al (2014)
zma-miR399hQGTGCAGTTCTCCTCTGGCACGMayer et al (2014)
zma-miR827QTTTGTTGGTGGTCATTTAACCMayer et al (2014)
wheat-miR-201AUUGGGCCAUACGGGAAUAGAXingli Ma et al (2015)
wheat-miR-202GCCUUGAAGACUUUGGCCAUGUXingli Ma et al (2015)
wheat-miR-203ACUUGUGUGUCUAUGGGGUGCCXingli Ma et al (2015)
wheat-miR-204UUAUAUUUUGAUACAGAGGAXingli Ma et al (2015)
wheat-miR-205ACAAUUAUCGUCAUAGAAGUGUCAXingli Ma et al (2015)
wheat-miR-206UCCGUCCCAUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-207UUUGGAUCACGACGAGUACGACXingli Ma et al (2015)
wheat-miR-208AUAGAACUUGGCUUGUAUAUUCCXingli Ma et al (2015)
wheat-miR-209GUUCAUGAACCGGGACUAAAGGCCXingli Ma et al (2015)
wheat-miR-211ACGGCACCACAUACGAUGUAGAUAXingli Ma et al (2015)
wheat-miR-212UCUGUAAAGAAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-213UACCCAAGGACAUCUCUAGAAGAXingli Ma et al (2015)
wheat-miR-214CCCCUACCUGGCGUGCCAXingli Ma et al (2015)
wheat-miR-215GGUGAUCAUGAGGAGUAGAXingli Ma et al (2015)
wheat-miR-216AUAUAAGAACGUUUUUGGCACUXingli Ma et al (2015)
wheat-miR-217GUCCGGACAGCUGUGGUAGUGUUXingli Ma et al (2015)
wheat-miR-218UAGCAGACGGCAAAGAAAGUGGCCXingli Ma et al (2015)
wheat-miR-219AAACUGGAUCAAACACUUGGCAUUXingli Ma et al (2015)
wheat-miR-220UUCUUAUAUUGUGGGAUAGAGXingli Ma et al (2015)
wheat-miR-221UCUGUAAACUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-222UGAGCCGAACCAAUAUCACUCXingli Ma et al (2015)
wheat-miR-223UGGGCACAACCCACCAGGGCGXingli Ma et al (2015)
wheat-miR-224CUCCGUUCCAAAAUAGAUGACXingli Ma et al (2015)
wheat-miR-225AGGGAUGGAGCGCAGAUUXingli Ma et al (2015)
wheat-miR-226AUGAUACGUCGACACGUGGCACGGXingli Ma et al (2015)
wheat-miR-227UCUUCUAUAGAAAUAGGCACCAXingli Ma et al (2015)
wheat-miR-228AGGACCUUAGGUAGGACGUAUAGXingli Ma et al (2015)
wheat-miR-229UUCCUCGUCGGAAUCCGGAACCUXingli Ma et al (2015)
wheat-miR-230CCAUGAUGAGGUCGUUCAACCXingli Ma et al (2015)
wheat-miR-231UUCCAAAGGGAUCGCAUUGAUXingli Ma et al (2015)
wheat-miR-232UCCGUCCGAAAAUACUUGUCAXingli Ma et al (2015)
wheat-miR-233UCCGUAAACUAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-234GAUCUUGAUCGUACACAUUUGCGUXingli Ma et al (2015)
wheat-miR-235CCUCUGUAAACUAAUAUAAGAXingli Ma et al (2015)
wheat-miR-236UAUAUUAGUUUACAGAGGGAGXingli Ma et al (2015)
wheat-miR-237ACAAGUAUUUUCGGACGGAGGXingli Ma et al (2015)
wheat-miR-238UGAAAGCAAUGUCGCAAGUUAGGXingli Ma et al (2015)
wheat-miR-239ACAUAGUUCUCGAACCCGUAGGGUXingli Ma et al (2015)
wheat-miR-240AAUGGUUUGUGAUUUGUGAAUGCCXingli Ma et al (2015)
wheat-miR-241UCCGUAAACUAAUAUAAGAGUXingli Ma et al (2015)
wheat-miR-242AGAGAAUUCCUUAUUUGACACUACXingli Ma et al (2015)
wheat-miR-243AAAACGUCUUACAUUAUGGGAXingli Ma et al (2015)
wheat-miR-244AUCAGUACCCAGGGGACACGGUACXingli Ma et al (2015)
wheat-miR-245UCCGUCCCACAAUAUAAGAUCXingli Ma et al (2015)
wheat-miR-246CGCCCCACGGUGGGCGCCAXingli Ma et al (2015)
wheat-miR-247GCGGUUAUGCCUCUAAGUCGUGCCXingli Ma et al (2015)
wheat-miR-248AUCUCCGCGUUGUAUUUUCUAGAAXingli Ma et al (2015)
wheat-miR-249AUCUUAUAUUGUGGGACAGAGXingli Ma et al (2015)
wheat-miR-250CGCGGCACCCACGAAUGUUAUXingli Ma et al (2015)
wheat-miR-251GCCCCUACCGUCUCGUGGXingli Ma et al (2015)
wheat-miR-252AAAUGGAUGUAUCUAGACGUAUUXingli Ma et al (2015)
wheat-miR-253UACACCAACCGGGACAGAUGGGCCXingli Ma et al (2015)
wheat-miR-254GAAGAAGGUUGUGUAGUAGACAUCXingli Ma et al (2015)
wheat-miR-255CAUUAGUAACUCGCCACACAGAUXingli Ma et al (2015)
wheat-miR-256UCUCCUGUAGAAAUAGGCACCXingli Ma et al (2015)
wheat-miR-257AGGUAUGUCUGUGUAGUCCGAAUCXingli Ma et al (2015)
wheat-miR-258CAAAUUUGAAGGGAGACAACUAGXingli Ma et al (2015)
wheat-miR-259CCGUGGCCAAGGUCUCUUGAGGCUUXingli Ma et al (2015)
wheat-miR-260ACUAAGAGUUAGCUGUAGCGCCUXingli Ma et al (2015)
wheat-miR-261GACCGCGUGGCCUAAUGGXingli Ma et al (2015)
wheat-miR-262AAAAAUUGUUAGUAGUGGCGCACCXingli Ma et al (2015)
wheat-miR-263AUCUAUUUUGGAACGGAGGGAXingli Ma et al (2015)
wheat-miR-264AUCGAGAUUAGGAUUUGUCACUCCXingli Ma et al (2015)
wheat-miR-265CUUGCCGGCGCGUGCGUGCAUCCGXingli Ma et al (2015)
wheat-miR-266AUGACGAGAACCACUUAGUAGUAGXingli Ma et al (2015)
wheat-miR-267AGUAAAGUUACCGAUGAACGAAGXingli Ma et al (2015)
wheat-miR-268UUAUAAUUUGGGACAGAGGAXingli Ma et al (2015)
wheat-miR-269UUGGGUCAUCUAUUUUGGAACXingli Ma et al (2015)
wheat-miR-270UUUGCAUGACCGAGGAGCCGCXingli Ma et al (2015)
wheat-miR-271AUGAAUACCGGAGUCCUGUUAGCCXingli Ma et al (2015)
wheat-miR-272GAUGCGGGGUCUGCUAGAGUUGCUXingli Ma et al (2015)
wheat-miR-273GUGCCGGAGUUGAACUAUAGCUUCUXingli Ma et al (2015)
wheat-miR-274UCCAAACCUGUAUGCGGACGXingli Ma et al (2015)
wheat-miR-275AGAGCAGAGAUUGAAGAAGCACGAXingli Ma et al (2015)
wheat-miR-276UCCGUAAAGAAAUAUAAGAGCXingli Ma et al (2015)
wheat-miR-277UAGUGAUCUAAACGCUCUXingli Ma et al (2015)
wheat-miR-278AUCGGGAUUUGUCGGCACAUCXingli Ma et al (2015)
wheat-miR-279CCCGGGACAUGCCAUAGUAGUAGXingli Ma et al (2015)
wheat-miR-280AUUCCGAGAACUUUUAUUUCUGCAXingli Ma et al (2015)
wheat-miR-281UCCGUUCCUAAAUAUUUGUCUXingli Ma et al (2015)
wheat-miR-282ACGAAGACCGAAGACUGCACCCGUXingli Ma et al (2015)
wheat-miR-283AGAACAGCGGGGAGGUGCUGCXingli Ma et al (2015)
wheat-miR-284AUAAUAUAAGAGCGUUUUUGACACXingli Ma et al (2015)
wheat-miR-285ACUCCCGGAUACCGUAGGAAUGCUXingli Ma et al (2015)
wheat-miR-286GCUAUGGUGUUGAUGUAGAAGCCCXingli Ma et al (2015)
wheat-miR-287ACAUUCGUGGAAGUCGUGGCAXingli Ma et al (2015)
wheat-miR-288AAAACAUCCUAGCUCAACUGXingli Ma et al (2015)
wheat-miR-289ACGUUACUUGCCCGAGAUUCGAUCXingli Ma et al (2015)
wheat-miR-290AAGGCAGGUGCCUUAAGGCACXingli Ma et al (2015)
wheat-miR-291AUGGGGUAAUCUCAUCUCAACXingli Ma et al (2015)
wheat-miR-293UGCAUGCCGUCGUCUGUACUCCCUXingli Ma et al (2015)
wheat-miR-294CAGAUCCGAGACCGUGGAAGACGXingli Ma et al (2015)
wheat-miR-295GCACACAUUGGACUGGAAGGCUGXingli Ma et al (2015)
wheat-miR-296AAAGAAUCUUUGCCGUCUGCUGGCAXingli Ma et al (2015)
wheat-miR-297AAAUUGUAGCCAAGAGAUUCAACGXingli Ma et al (2015)
wheat-miR-298UGCCCUACCCAAACGGACAGAAUCXingli Ma et al (2015)
wheat-miR-299UUCUAGGACUCUUCUUUUXingli Ma et al (2015)
wheat-miR-300GUUCCAGAACCGGUACUAAAGGUCXingli Ma et al (2015)
wheat-miR-301UUCCGCGAGAGGCACGGUUGUGAUXingli Ma et al (2015)
wheat-miR-302CAUCAACCGUGGUAACCUXingli Ma et al (2015)
wheat-miR-303UUAUGGAACGGAGGGAGUACUXingli Ma et al (2015)
wheat-miR-304UUACAUUAUGGGACGGAGGGAGUXingli Ma et al (2015)
wheat-miR-305UAUAGUGACCUAUCAUGGCAAUUXingli Ma et al (2015)
wheat-miR-306AUGUCAAGUGAACUCGGUGGCGCCXingli Ma et al (2015)
wheat-miR-307GACAUCCGGAGUCCUGCCUAGCCUXingli Ma et al (2015)
wheat-miR-308AAUAUGGACAUUAAUGGCGCACCAXingli Ma et al (2015)
wheat-miR-309CCCAGACAACCAGUCGGAAGCGGCXingli Ma et al (2015)
wheat-miR-310AAUGGAGCAGUUGGUAGUCUCGCUXingli Ma et al (2015)
wheat-miR-311GAUAAGAUAGUGAUUGAUAGAGUXingli Ma et al (2015)
wheat-miR-312GUGAAGUGCUUGGGGGAACUXingli Ma et al (2015)
wheat-miR-313AUAUUCGGACAUCGGAAAGGUUCCXingli Ma et al (2015)
wheat-miR-314ACAAGUAUUUCCGGACGGAGGXingli Ma et al (2015)
wheat-miR-315ACAUCAAUCGACAAACCUGAGGCAUXingli Ma et al (2015)
wheat-miR-316UCACUGAAUGGUCACUGUUUXingli Ma et al (2015)
wheat-miR-317UGUCUACCGUGAAGUUGUGCACUCXingli Ma et al (2015)
wheat-miR-318AGUUUGGACCAACACUCAGAGGAGXingli Ma et al (2015)
wheat-miR-319CACGAGAUCGUAAUGGCUAAACCCXingli Ma et al (2015)
wheat-miR-320AUGAUACGUCGACACGUGGCACGXingli Ma et al (2015)
wheat-miR-321GCUUAGGCUUUUGGUUGUCCUXingli Ma et al (2015)
wheat-miR-322ACUUGUGCACGGGCAGUCAGAGCCXingli Ma et al (2015)
wheat-miR-323AAAGGCUGCAGCGGUACUACCXingli Ma et al (2015)
wheat-miR-324CACCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-325AUUUGACGGUAUGCUUUGUGUAACXingli Ma et al (2015)
wheat-miR-326AUCCGAGUGGCGGCAGCAXingli Ma et al (2015)
wheat-miR-327UUGUGGUGGCCUUCGGGAXingli Ma et al (2015)
wheat-miR-328AAGGAAGUCACCUCGGUCUCGAGAXingli Ma et al (2015)
wheat-miR-329AAUUAGAGCACGUGGCUGXingli Ma et al (2015)
wheat-miR-330AACUGAAUUUGAAAUGAUXingli Ma et al (2015)
wheat-miR-331AGAGGAGAACCCAAAACAXingli Ma et al (2015)
wheat-miR-332UGGGAAGCUGCAUCUGCAXingli Ma et al (2015)
wheat-miR-333GCACCCUAGAACACACAAGUUGAUXingli Ma et al (2015)
wheat-miR-334AUAAAUACAUGGGUAUGGGCACUCXingli Ma et al (2015)
wheat-miR-335CACGUGGGAGAUAUAGCCGCAXingli Ma et al (2015)
wheat-miR-336AACGCUUGUGUCUGUACUGAUGCUXingli Ma et al (2015)
wheat-miR-337AUUCCAGAACCGGGACUAAAGGCCXingli Ma et al (2015)
wheat-miR-338GCCAAAUUGGAAGGGUGUUGGGCUXingli Ma et al (2015)
wheat-miR-340UGGACCUGCCUCGACGUCAUCUXingli Ma et al (2015)
wheat-miR-341UCUAGUCUAGUCCCUGUAACCAAAXingli Ma et al (2015)
wheat-miR-342GGGCCCAUGUAGGUGGCAUGACAAXingli Ma et al (2015)
wheat-miR-343UUUCCCGGCUAGUGCACCXingli Ma et al (2015)
wheat-miR-344AUCUAUUUUGGAACGAAGGGAXingli Ma et al (2015)
wheat-miR-345UCGGACCCGGCGUCAUUCCCCXingli Ma et al (2015)
wheat-miR-346UUGGUGGCUUGAACCGGGACCXingli Ma et al (2015)
wheat-miR-347CCCCCCUGACUGCUGGGACCXingli Ma et al (2015)
wheat-miR-349ACAUGUCAGUGACCCAAAGGCXingli Ma et al (2015)
wheat-miR-350UGUGUUUCGUUGGCUCCCXingli Ma et al (2015)
wheat-miR-351UUACAGACGGCAAAGUGAGCUCUUXingli Ma et al (2015)
wheat-miR-352AUCCGUAUUUAGACAAAUCUAAGAXingli Ma et al (2015)
wheat-miR-353GGGACCUUUCUUUGGAUAXingli Ma et al (2015)
wheat-miR-354UGUUGACUAAGUUGACAAAGCCCUXingli Ma et al (2015)
wheat-miR-355GCUGGCUCUGUUACCGGCGUGAACXingli Ma et al (2015)
wheat-miR-356AAACGUUCUUAUAUUAUGGGAXingli Ma et al (2015)
wheat-miR-357AUUAACGGGCCAGAUCUGGCUUCGXingli Ma et al (2015)
wheat-miR-358UUUUGUCACGGCAGAUGUCCUAGXingli Ma et al (2015)
wheat-miR-359UUGCAACUGGGACAACAACAAXingli Ma et al (2015)
wheat-miR-360GUUUGAGAAACGGAUGACCGAGACXingli Ma et al (2015)
wheat-miR-361UUCCUCAGACCCAAUACCCAUUXingli Ma et al (2015)
wheat-miR-362UAGUUCAAGGAGAAUACGGUGAGGXingli Ma et al (2015)
wheat-miR-363UCCCCAGCGGAGUCGCCAXingli Ma et al (2015)
wheat-miR-364AAGAUAUGACUCUAUAUGAAUGCCXingli Ma et al (2015)
wheat-miR-365UCGACCACAGUCUCGGGGACUXingli Ma et al (2015)
wheat-miR-366AGCCCAGCAGCCGCACCAXingli Ma et al (2015)
wheat-miR-367CCCUUCGGCCGUAGUACCGCAXingli Ma et al (2015)
wheat-miR-368ACGGGUGCGCUGCGACCGGCCXingli Ma et al (2015)
wheat-miR-369GACAAGUAUUUUCGGACGGAGGGAXingli Ma et al (2015)
wheat-miR-370AAAAAUUGUUACUAGUGGCGCACCXingli Ma et al (2015)
wheat-miR-371CGAGUGCUUGUAACCUGAGXingli Ma et al (2015)
wheat-miR-372AGCCUUUGUUGGGCAUGUCGAGAAXingli Ma et al (2015)
wheat-miR-373AUCCUACUUGGGGCGCCUXingli Ma et al (2015)
wheat-miR-374AAUUAACUGAUGCUGAAAUGXingli Ma et al (2015)
wheat-miR-375ACGGUAUAUGUGGAUUGCACUAGCXingli Ma et al (2015)
wheat-miR-376UUCGCCGGAGCAGCGUGCUGUGAXingli Ma et al (2015)
wheat-miR-377AAUUUCCGUGCCAAAAACUAUACAXingli Ma et al (2015)
wheat-miR-378AGUCCCGAGGCACCCACGAGXingli Ma et al (2015)
wheat-miR-379AAUGUAAGACGUUUUUUGACACUAXingli Ma et al (2015)
wheat-miR-380CCUCCGUCCCAUAAUGUAAGAXingli Ma et al (2015)
wheat-miR-381GAGUGUAUGCGCGUGUAUAUGAGCXingli Ma et al (2015)
wheat-miR-382UCCGUCCGGAAAUACUUGUCCXingli Ma et al (2015)
wheat-miR-383CUCAGCCCCUCUUAUAGCGUXingli Ma et al (2015)
wheat-miR-384AUGAACCGGGACUAAAGGGCAGCCXingli Ma et al (2015)
wheat-miR-385AAUGUAAGACGUUUUUUGACACUXingli Ma et al (2015)
wheat-miR-386GGGGGCCGCAGUGACCAGGCCCGGGXingli Ma et al (2015)
wheat-miR-387UUGAAACUGUAGAUGUGCGGUXingli Ma et al (2015)
wheat-miR-388GUUUUUUGUUCGUUUGGAUCGGCCXingli Ma et al (2015)
wheat-miR-389AGGUUUCACUAUAGACCACAUACGXingli Ma et al (2015)
wheat-miR-390GACCUGUAUGGGGCACCAXingli Ma et al (2015)
wheat-miR-391AAAACGGACAAACCAGACAGCCCXingli Ma et al (2015)
wheat-miR-392UCGUCUCUGAAUCGUCCAAGAXingli Ma et al (2015)
wheat-miR-393GGUGGCUGUAGUUCGGUGGUXingli Ma et al (2015)
wheat-miR-394AAAUAUUGGCUAGAGAUUGGUUGCXingli Ma et al (2015)
wheat-miR-395AGGGUUUAGUCCGUAGAGGCAAUCXingli Ma et al (2015)
wheat-miR-396UCCCGACUGCCAGGCACUUCCXingli Ma et al (2015)
wheat-miR-397AAUUAAUAUGGAUCGGAGGGAXingli Ma et al (2015)
wheat-miR-398AGCCCAGAGAUCGAGGAGAAGUCUXingli Ma et al (2015)
wheat-miR-399UCCGUUCCUAAAUGUAAGUCUXingli Ma et al (2015)
wheat-miR-400AGACACUUAUUUUGGGACGGAXingli Ma et al (2015)
wheat-miR-401CGGAUUGUGACUGAACGCCGXingli Ma et al (2015)
wheat-miR-402AACUAACUCUAACCCAUGGAUCCAXingli Ma et al (2015)
wheat-miR-403AAUAGAUGACCCAACUUUGUXingli Ma et al (2015)
wheat-miR-404GAGGAAACGGACUUGUGUUGGAGCXingli Ma et al (2015)
wheat-miR-405UUCGCCGGUGACGCGUUUCCCUXingli Ma et al (2015)
wheat-miR-406AAACGUCUGGGCUGACCGGCACCCXingli Ma et al (2015)
wheat-miR-407AUAUUAUGGGACGGAGGGAGUXingli Ma et al (2015)
wheat-miR-408UAAACCGGAUUUUUCUGAAGCACCXingli Ma et al (2015)
wheat-miR-409AUAUACUAAUGGCGCAUCUGAGGUXingli Ma et al (2015)
wheat-miR-410AAAAGUCCCUGUAAACAAACACCCXingli Ma et al (2015)
wheat-miR-411AUGUAGAACCACCCCGAUUXingli Ma et al (2015)
wheat-miR-412GCCCGGGCAGUUAGGUAAAGUCACAXingli Ma et al (2015)
wheat-miR-413UCGUAAACUGAAAUUAACGACCUXingli Ma et al (2015)
wheat-miR-414UCCAUGACUGAAUAAUAAAUACGXingli Ma et al (2015)
wheat-miR-416AUUCUUGUCUUAGAUUUGUCUAGAXingli Ma et al (2015)
wheat-miR-417AGCGUGACUGGGAGCUAGGUCGCCXingli Ma et al (2015)
wheat-miR-418AGUAGAACCAAGUCGACUGCCXingli Ma et al (2015)
wheat-miR-419GCGACUGGGCCGAUUUUUUGGCGCXingli Ma et al (2015)
wheat-miR-420UCACCGGCGCUGCACACAAUGXingli Ma et al (2015)
wheat-miR-421UAUCCUGUACAAAUAAGCACCXingli Ma et al (2015)
wheat-miR-422ACGAUGUGGUAGAUGCAUXingli Ma et al (2015)
wheat-miR-423AAAAAAAGUUACUAAUGGCGCACCXingli Ma et al (2015)
wheat-miR-424AGAUAUCAUGACCAAGGGCUUGCCXingli Ma et al (2015)
wheat-miR-425CACCAAGAUGUACGAGUUCAGGCCXingli Ma et al (2015)
wheat-miR-426GCCGGACUCAUCGUCAUUGAAGCCXingli Ma et al (2015)
wheat-miR-427GAAAUGUUGGGUGGCUGUGGCACAXingli Ma et al (2015)
wheat-miR-428AAUUACUUGUCGCAGAAAUUAAUGXingli Ma et al (2015)
wheat-miR-429AGGAUAUUUUACUGCCGGCGCCCAXingli Ma et al (2015)
wheat-miR-430AGUGAAAUCUCUCCAAAGACUXingli Ma et al (2015)
wheat-miR-431AACCUAGAGACUCGUAGUAGCACGXingli Ma et al (2015)
wheat-miR-432UCCGCGAUCAUCAUGACCAAAXingli Ma et al (2015)
wheat-miR-433AGACACAACAAUUGAUCGXingli Ma et al (2015)
wheat-miR-434GAUCCGGUCGGUCUUGAGCUCGCCXingli Ma et al (2015)
wheat-miR-435CGGGGAGCUUUGUCCCAUUXingli Ma et al (2015)
wheat-miR-437CAAGAAUAAAGUUGCGUAGUAGACXingli Ma et al (2015)
wheat-miR-438AGGGCACCAAUAGUGGAAUCACGGXingli Ma et al (2015)
wheat-miR-439ACAUAUCUGGUUGUUGCCUGCUGAXingli Ma et al (2015)
wheat-miR-440AGUAGUAUACUUUUGACAUGCACCXingli Ma et al (2015)
wheat-miR-441AACGCGGUUGAUGUAGUCGXingli Ma et al (2015)
wheat-miR-442UCCGUCCCAAAAUAAUUGUCUXingli Ma et al (2015)
wheat-miR-443GUUUCUACGGCCCGUAGAAGGCCCXingli Ma et al (2015)
wheat-miR-444UGAAGCAGUCUGGACCGACAUUXingli Ma et al (2015)
wheat-miR-445UGCGUCAUUAGUGUGAACUAAGAXingli Ma et al (2015)
wheat-miR-446GCAGGCACACCAUCAUCACCXingli Ma et al (2015)
wheat-miR-447AGUGGAACUCUCAAUGAAAGCACCAXingli Ma et al (2015)
wheat-miR-448CGGGUUCAGUUAGAGCCAACGCCUXingli Ma et al (2015)
wheat-miR-449CACCCCCUACCUGGCGCGCCAXingli Ma et al (2015)
wheat-miR-450ACUGGGCUCAGUCGGCCUGCAGCGXingli Ma et al (2015)
wheat-miR-451GUUCACUAGUUCGGCUGCGGUGUGXingli Ma et al (2015)
wheat-miR-452UGACAGAAAAGAGAGAGCACXingli Ma et al (2015)
wheat-miR-453AAAGAUCGAUAUAUUGGACGACUXingli Ma et al (2015)
wheat-miR-454UUUCGUCGACUCCCCUAGGGUUUCXingli Ma et al (2015)
wheat-miR-455AUAGCCGGUAUCAUGCACUCGGGAXingli Ma et al (2015)
wheat-miR-456UGCAGAUGAGGAGACAUGXingli Ma et al (2015)
wheat-miR-457AAAAAGUCCCUAGGAACCAAACGXingli Ma et al (2015)
wheat-miR-458AACGGUAGUACCGUAGGCAUCCAXingli Ma et al (2015)
wheat-miR-459CUUCGCCGGCUGCGCGUUCGCCUXingli Ma et al (2015)
wheat-miR-460GGGCACCGCACACGGCUAAGGAAXingli Ma et al (2015)
wheat-miR-461CUCUUAUAUUAUGGGACGGAXingli Ma et al (2015)
wheat-miR-462CGAAAUGGACUUUUCGGCCUUGCCXingli Ma et al (2015)
wheat-miR-463ACUGAUGUGAUGGGUCAUUGUAAAXingli Ma et al (2015)
wheat-miR-464GCACCCCAUGACACACAAGUUGAUXingli Ma et al (2015)
wheat-miR-465AUGUAUAUUGUAUAGCCUGGCCCAXingli Ma et al (2015)
wheat-miR-466AAAUCGUGUCCGCCUGGCGUCCGCXingli Ma et al (2015)
wheat-miR-467AAAAAUUGUUAGCAGUGGCACACCXingli Ma et al (2015)
wheat-miR-468UGGUUAGAGGGACUGUGGUAUCCCXingli Ma et al (2015)
wheat-miR-469GCCCCUCGCGUCUAGUGGXingli Ma et al (2015)
wheat-miR-470UUUGUAACCGACCUUGUGUAACCCXingli Ma et al (2015)
wheat-miR-471UCCUCAGUAGCUCAGUGGXingli Ma et al (2015)
wheat-miR-472UCGGUUGGCCACCGUGGCACCXingli Ma et al (2015)
wheat-miR-473GAUUUUUUGUCAUAGAAGUAGGAGXingli Ma et al (2015)
wheat-miR-474ACCCACUGGGUGUAGCCCCCGAGAXingli Ma et al (2015)
wheat-miR-475CACUAGUAGAAAAAGGGCCUAAUGXingli Ma et al (2015)
wheat-miR-476AUAUCCAAUCCGCAUGUUUGUGCUXingli Ma et al (2015)
wheat-miR-477AAAAAAUAUUGAGCCGAGUXingli Ma et al (2015)
wheat-miR-478AUACGUCCUACCCAAGGUCACUXingli Ma et al (2015)
wheat-miR-479AAAUAGAUGACUCAACUUUGUACUXingli Ma et al (2015)
wheat-miR-480AGGGCACUGCAUGCUCUGGCCUGCXingli Ma et al (2015)
wheat-miR-481GCCCGAUCCUCUGGUAGAUCAGAXingli Ma et al (2015)
wheat-miR-482UCAUUGUCCUGCUGCUCACUGUXingli Ma et al (2015)
wheat-miR-483AGAGACCACUUAGUAGUAGCGAGGXingli Ma et al (2015)
wheat-miR-484GGGGUUGUAGCUCAGAUGGUAGAAXingli Ma et al (2015)
wheat-miR-485UUACCACGAGUGAUUGGGCGAGXingli Ma et al (2015)
wheat-miR-486AUAUAAGAGCGUUUAGAUCACXingli Ma et al (2015)
wheat-miR-487ACGAGAAGGGAGUAGUUCACCCUCXingli Ma et al (2015)
wheat-miR-488UGGCCCAGAGGUUGUCUGACAGACXingli Ma et al (2015)
wheat-miR-489UGAGGAAGGACUUCAUCAUCAXingli Ma et al (2015)
wheat-miR-490UAGCCGUCGGCAUACCUGCGCXingli Ma et al (2015)
wheat-miR-491UAUGUUACUCCCACUAUGACCXingli Ma et al (2015)
wheat-miR-492AAAAACCACUGAUCGGCGGAUUUGXingli Ma et al (2015)
wheat-miR-493CCAACCGGGACUAAAGGUUAGACCXingli Ma et al (2015)
wheat-miR-494CACAUCUUGCCAAUUUUGGACAGCAXingli Ma et al (2015)
wheat-miR-495CGACCGAGUUUGGUGAAUUGUGUGXingli Ma et al (2015)
wheat-miR-496UUUACUUGUGCAUGGGCAGUCAGXingli Ma et al (2015)
wheat-miR-497AGAUACCUUAAGCUUCUGACCXingli Ma et al (2015)
wheat-miR-498UUGGAGUCGGUGCUGUGCUCGAGCAXingli Ma et al (2015)
wheat-miR-499GGGGCUGUAGCUCCGUGGAXingli Ma et al (2015)
wheat-miR-500ACGGACGCGUCGGGUCUACACGGXingli Ma et al (2015)
wheat-miR-501AUGUGAUAGAUCUUCCAAGCGAUAXingli Ma et al (2015)
wheat-miR-503AUGUCACCUAGAUACUCCAAUGUCXingli Ma et al (2015)
wheat-miR-504UCACUGAAAGGUCGCUGUUUXingli Ma et al (2015)
wheat-miR-505AUUGGACCCGGUUCGUGAGCCXingli Ma et al (2015)
wheat-miR-506AAGUCUGUGUUGGAUGGCAAACCGXingli Ma et al (2015)
wheat-miR-507CGUUCAACUCGAUGACGUCCCXingli Ma et al (2015)
wheat-miR-509CAGCCCGCUGUGGAAGCGCCUXingli Ma et al (2015)
wheat-miR-510AUACGGAUGUAUCUAGACAXingli Ma et al (2015)
wheat-miR-511CAUAGUUACUCUGAUAGGGXingli Ma et al (2015)
wheat-miR-512AUGUGAUCACGGACAUGACGAGGAXingli Ma et al (2015)
wheat-miR-513AAAAAUUGUUAGUAAUGGCGCACCXingli Ma et al (2015)
wheat-miR-514UAUUAGAGCGGAAAGGACCCGCGGAXingli Ma et al (2015)
wheat-miR-515ACACUGUAUAGUGUGGCGCXingli Ma et al (2015)
wheat-miR-516ACACCGCAUUUGUCGAUAGACGGGXingli Ma et al (2015)
wheat-miR-517CCGAACUGUGCGUCUAGGCGGAUGXingli Ma et al (2015)
wheat-miR-518AGGUCCUGUUGAUCGGGAGGGGUGXingli Ma et al (2015)
wheat-miR-519UCGCUUCGGGACCCCAAAACXingli Ma et al (2015)
wheat-miR-520GAAACGGACGCGCGCGGACGGCCAXingli Ma et al (2015)
wheat-miR-521UCCUACGAUCGAAACGGGGGUCCUXingli Ma et al (2015)
wheat-miR-522UCCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-523GUGCAUCAGAAUUGUAACUXingli Ma et al (2015)
wheat-miR-524UUGCCUCCGCCUCGGCAUCGXingli Ma et al (2015)
wheat-miR-525GAUCCGGCCCGACUGCUCAGCAGUXingli Ma et al (2015)
wheat-miR-526CCGCUGAGGAGUCACAAGCGGCAGXingli Ma et al (2015)
wheat-miR-527GCAUAGGAGGUGAGCUAGAGCACCXingli Ma et al (2015)
wheat-miR-528CCCUGGUGGGUUAUGCUCACCXingli Ma et al (2015)
wheat-miR-529AGGUGGGGCUGUGACAUGUUGAUCXingli Ma et al (2015)
wheat-miR-530CGGGAUCCCAAGUCUGAUCGGAUXingli Ma et al (2015)
wheat-miR-531GAAAUGUUGGGCGGCUGUGGCACAXingli Ma et al (2015)
wheat-miR-532AGCAAAACCGUGCCUCUCGAGGAAXingli Ma et al (2015)
wheat-miR-533AAUUUGUCUUUUUUGCUGAGAGCUXingli Ma et al (2015)
wheat-miR-534UCGGGGGGCAUUCCGAUUUCXingli Ma et al (2015)
wheat-miR-535CUUAUAUUAUGGAACGGAGGGAGXingli Ma et al (2015)
wheat-miR-536AUGGCACCAACCGGUACUAAAGCCXingli Ma et al (2015)
wheat-miR-537CAUUCAUGCCCGGCCAGAGCGGACXingli Ma et al (2015)
wheat-miR-538CACGCCUGUUUGGUUGUCACCUGXingli Ma et al (2015)
wheat-miR-539CUAUAUCACUUGACUGAGACUXingli Ma et al (2015)
wheat-miR-540GAGUCCCUGAUCUUGAUCGUACACXingli Ma et al (2015)
wheat-miR-541AGUGAUCGUCCGUGUCUUUGGUCCXingli Ma et al (2015)
wheat-miR-543UUCCAAAUUACUCGUCGUGGUXingli Ma et al (2015)
wheat-miR-544GGAAAAUAAGAAACUACCAGGAAXingli Ma et al (2015)
wheat-miR-545UAUCUCGUUCUCAGGGCACACXingli Ma et al (2015)
wheat-miR-546AGUCACUUGUUGAAAUCUCUAGAXingli Ma et al (2015)
wheat-miR-547GCUCGAUGAUGGCUACUUXingli Ma et al (2015)
wheat-miR-548UCUUCUUGUAGACGUUGUUGGGCCXingli Ma et al (2015)
wheat-miR-549UAGGACUAGGGUUCCUACCGXingli Ma et al (2015)
wheat-miR-550CUCUGGGCGUUAAUGUUACAACAUXingli Ma et al (2015)
wheat-miR-551AAUACUUGUCGGAGAAAUGGXingli Ma et al (2015)
wheat-miR-552UUAUAUUAUGGGACCGAGGGXingli Ma et al (2015)
wheat-miR-554UUAGUACCGGUUCGUGGCACCAACXingli Ma et al (2015)
wheat-miR-555AUCUUAUAUCAUGGGACGGAGXingli Ma et al (2015)
wheat-miR-556AUGUUACUAGUCUAUGUUACUACCXingli Ma et al (2015)
wheat-miR-557AGGACAACGCUAACGCCCACACGUXingli Ma et al (2015)
wheat-miR-558GUGAUUCACUUCGUUCCUGUXingli Ma et al (2015)
wheat-miR-559UGGUUUGGUCAGGGCUGGAAUAUXingli Ma et al (2015)
wheat-miR-560AGAACUAUGUAGACAUGACCGAGAXingli Ma et al (2015)
wheat-miR-561AAAGUUAGUAAUGGCGCACCGUGGXingli Ma et al (2015)
wheat-miR-562AGCCAGUGACUGUAUAAUCAUGACXingli Ma et al (2015)
wheat-miR-563UCGUCCCCGGCAAUGGAGCCAXingli Ma et al (2015)
wheat-miR-564AAGAAUAACUAUUCCUCACCCAGXingli Ma et al (2015)
wheat-miR-565AGUCUCUGCCAAUUCUUCGUGXingli Ma et al (2015)
wheat-miR-566UUGGAUUCCAGUCGGCCUACAGCUXingli Ma et al (2015)
wheat-miR-567AACUGCAGUUGCCAUCCACAACGUXingli Ma et al (2015)
wheat-miR-568AUGCGGGGUCUGCUAGAGAUGCUXingli Ma et al (2015)
wheat-miR-569AUUCCUUCGCUACUGCUGCUAACUXingli Ma et al (2015)
wheat-miR-570AUCUCGUGGUAGAUCAACUCUUGUXingli Ma et al (2015)
wheat-miR-571UCUUAUAUUAUUGGACGGAGAXingli Ma et al (2015)
wheat-miR-572UCUUAUACUGUGGAACGGAGGXingli Ma et al (2015)
wheat-miR-573AAUGGACUCGUAUAAAAGGAUAUUXingli Ma et al (2015)
wheat-miR-574AUCGGAUUGUCUUGGGAGAAGGAAUXingli Ma et al (2015)
wheat-miR-575CCGGUUUUGACACCGACAUUGGUXingli Ma et al (2015)
wheat-miR-576CCGUUCCGAAUUACUUGUCGCXingli Ma et al (2015)
wheat-miR-577UUCGGUUGAGAAUCGGGCACCXingli Ma et al (2015)
wheat-miR-578UUGGGGAACGUUGCAGAAAAUUAXingli Ma et al (2015)
wheat-miR-579AAGGAAGUGAGGAGGCUGGAXingli Ma et al (2015)
wheat-miR-580GCUCCCCCGUCGAGCGUGGCUXingli Ma et al (2015)
wheat-miR-581GCGGGGAUCGGAUUGCAGUXingli Ma et al (2015)
wheat-miR-582AGACGCCCGACUGUGGCAUGCUUXingli Ma et al (2015)
wheat-miR-583ACAAACCGGGACUAAAGAGAGGCCXingli Ma et al (2015)
wheat-miR-584UAUUCCAAUGAUGGGCUUCCUCAAXingli Ma et al (2015)
wheat-miR-585UCAAAACUACUAAUGGCGCACCGUXingli Ma et al (2015)
wheat-miR-586AUUUUGGCCCGGUACUAAUGGUACXingli Ma et al (2015)
wheat-miR-587GUGUCUACGACUGUGGCCGGCGGCXingli Ma et al (2015)
wheat-miR-588AGAUGAUGGUAGCAACUACACGXingli Ma et al (2015)
wheat-miR-589GCGGACCCAGGCCGAACCCGGCGCXingli Ma et al (2015)
wheat-miR-590UACGGCAAAGCCGUCGGCAUAXingli Ma et al (2015)
wheat-miR-591GUUGAAGUGUAUAUGUGGAUUGCCXingli Ma et al (2015)
wheat-miR-592UCGUGGCCGCCUUGGAGACCCCXingli Ma et al (2015)
wheat-miR-593AAGGAGAACUACUGCGAUUGUGACXingli Ma et al (2015)
wheat-miR-594CCAGUCUGGACCGCAUACXingli Ma et al (2015)
wheat-miR-595AAUGGGUAGGGUAUGGGCGGGUACXingli Ma et al (2015)
wheat-miR-596ACUAGGCCCAGUCGGCCUGCAGCGXingli Ma et al (2015)
wheat-miR-597AAUGGAGCAGUUGGUGAAUAGUCCXingli Ma et al (2015)
wheat-miR-598GCCGAAGAAGCCUGUGCUCGAAAUXingli Ma et al (2015)
wheat-miR-599ACUGGAAUCCAAUCGGCCUGCUGUXingli Ma et al (2015)
wheat-miR-600AACAAAUGGGGCUCAAAGAUUXingli Ma et al (2015)
wheat-miR-601CCUACGUCACGCAGGCGCCCGACAXingli Ma et al (2015)
wheat-miR-602AAAUACGAUGUCAACUACAUGAUCXingli Ma et al (2015)
wheat-miR-603ACAGACAAUCUAGCUCGACAACCCXingli Ma et al (2015)
wheat-miR-604AGCGUACGUAGCGUUGUCAUUCUXingli Ma et al (2015)
wheat-miR-605GCCUUUGGUCCCGGUUGGUGGCACXingli Ma et al (2015)
wheat-miR-606UCUUUAGUCAGGGGUGCUUGGAACXingli Ma et al (2015)
wheat-miR-607ACAGACCUCGGUCGUCGUGGCACCXingli Ma et al (2015)
wheat-miR-608AAAGGGACUGGUCACUGGAAGCGGXingli Ma et al (2015)
wheat-miR-609CGUGAUGUAGCUCAGAUGXingli Ma et al (2015)
wheat-miR-611AAAAAAGAUUGAGCCGAAUXingli Ma et al (2015)
wheat-miR-612GAGGACCCCUUAGUCCAGGXingli Ma et al (2015)
wheat-miR-613AUUGUGCAAGAGCUUGGCAACXingli Ma et al (2015)
wheat-miR-614GACAAGUAAUUCCGAACGGAGGGAXingli Ma et al (2015)
wheat-miR-615UCACUGAAAGGUCAUUGUUUXingli Ma et al (2015)
wheat-miR-617AGACCCAUAGGGCAGUGCGCCXingli Ma et al (2015)
wheat-miR-618UCACUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-619UCUUAUAUUGUGGGACGGAGGXingli Ma et al (2015)
wheat-miR-620AAUAGUGGUCCACUGAGGAUAGAUXingli Ma et al (2015)
wheat-miR-621ACGGAACUUGACAGGUGGUCUACCXingli Ma et al (2015)
wheat-miR-622UGGGCUCUAUAUUAUGAGXingli Ma et al (2015)
wheat-miR-623UUUUUGUAGUUUGCAAAAGCACCCXingli Ma et al (2015)
wheat-miR-624UCACUUUAGAUAGGUUGGGAAUGCXingli Ma et al (2015)
wheat-miR-625AGGACUCCGCCGACACCGXingli Ma et al (2015)
wheat-miR-626UUGAAUUUCCUCUAUAAGCGCAUCXingli Ma et al (2015)
wheat-miR-627AUCUUCCCGUGAGUCCUUGAUCUXingli Ma et al (2015)
wheat-miR-628UUCGUCGGACGAGCGUGCCUAXingli Ma et al (2015)
wheat-miR-629UUCAUGAACCGGGACUAAUGGGUCXingli Ma et al (2015)
wheat-miR-630GAGAGUCCUAAAGGGGGAAGGCACXingli Ma et al (2015)
wheat-miR-631UUCGAGCACAGGCUUCUUCGGUAXingli Ma et al (2015)
wheat-miR-632GAACCGUAUGCUGUAUAUUGCACAXingli Ma et al (2015)
wheat-miR-633AAACGAGAGAACUUAAUGUUUAUXingli Ma et al (2015)
wheat-miR-634GACCCCAUUGCCCUACCCAAACGGXingli Ma et al (2015)
wheat-miR-635AAAGGAUACUAAUGGCGCAUCACCXingli Ma et al (2015)
wheat-miR-636CGUUUGGGGGUACGUAGGXingli Ma et al (2015)
wheat-miR-637AAGUGCUCGUGUUGCAUUCCCXingli Ma et al (2015)
wheat-miR-638UCACGAGGAGUUCCGGAAUGGUCCXingli Ma et al (2015)
wheat-miR-639UGUGAAACACUGUGUGAGAGAXingli Ma et al (2015)
wheat-miR-640UGACACAACAUAGAGGAAGUAGUXingli Ma et al (2015)
wheat-miR-641AUGUUGUAGUCCAUUUGAAAUGUCXingli Ma et al (2015)
wheat-miR-642UGGAACUCUCAAUGAAAGCACCAXingli Ma et al (2015)
wheat-miR-643UGCAUUCAAGUUUAACCGGXingli Ma et al (2015)
wheat-miR-644AGCUCUUGUCGCUCAGUGUGUACCXingli Ma et al (2015)
wheat-miR-645ACGAGUUUUGGCUUGAGAGCAAACUXingli Ma et al (2015)
wheat-miR-646GAUGCUUUGUGAUUUGUGAAUGCCXingli Ma et al (2015)
wheat-miR-647GUUUAUACUGGUUCGGCCCCUUXingli Ma et al (2015)
wheat-miR-648AAGACGGCAAAAUGAGCUCUUUGCXingli Ma et al (2015)
wheat-miR-649AUUUCCUCUAUAGGUGCAUCUAUUXingli Ma et al (2015)
wheat-miR-650UCACUGUUUGGAAUGGUAGGACXingli Ma et al (2015)
wheat-miR-651UUGUCGCAACCUGAGAGUUXingli Ma et al (2015)
wheat-miR-652CUGGGUGUAGUCCCCAAGGCUXingli Ma et al (2015)
wheat-miR-653AUUCAAUUGUCUCACUCAUGAXingli Ma et al (2015)
wheat-miR-654UCAUCUAUUUUGGAACGGAGGXingli Ma et al (2015)
wheat-miR-655CCCUGGUGGGUUAUGCCCUCCXingli Ma et al (2015)
wheat-miR-656GAGAGCUUUGUGGUGCUCUAGCUXingli Ma et al (2015)
wheat-miR-657GCGCCACUUGUCGCAACCUGAGAAXingli Ma et al (2015)
wheat-miR-658UAUUCUGGUGUGCUAGGCGCXingli Ma et al (2015)
wheat-miR-659CAUUACCCAUGUACUCUGCGGGUXingli Ma et al (2015)
wheat-miR-660AUUCCACGACAGUUGGCGCCCACCXingli Ma et al (2015)
wheat-miR-661UGGCCGUAGGCAUAGCCCUGXingli Ma et al (2015)
wheat-miR-662AUUGGACCCGGUUCGUGAGCCCCGXingli Ma et al (2015)
wheat-miR-663AGAGAUUCCACUAUGAACCACAUAXingli Ma et al (2015)
wheat-miR-664UGCGUUUGAACUUUGAACXingli Ma et al (2015)
wheat-miR-665GAUUUUGUGUGCCACGUAGGACAXingli Ma et al (2015)
wheat-miR-666AUGUGACUUUACUUAACUGCCXingli Ma et al (2015)
wheat-miR-667AACCUAGAUAUGUGUGAUGUUACUXingli Ma et al (2015)
wheat-miR-668GCUCACCGGGCUUCGAGGUACCUUXingli Ma et al (2015)
wheat-miR-669UAAGGGGAUUGUUGCGUAXingli Ma et al (2015)
wheat-miR-670AAACGCUCGGACUGACCGGCACCCXingli Ma et al (2015)
wheat-miR-671AAGGGCAGCCCGGUGCAUGUAGCUXingli Ma et al (2015)
wheat-miR-672ACUAAAGGGUCGUUACUAAAGCCUXingli Ma et al (2015)
wheat-miR-673UUUAGUCCCGGUUGGUAACACCAAXingli Ma et al (2015)
wheat-miR-674UCUCCCCGGCAACGGCGCCAXingli Ma et al (2015)
wheat-miR-675AGAGGAACUUCCUUGUAGAAGUGXingli Ma et al (2015)
wheat-miR-676AUGAGCACCUUCGAGAGACUGAGCXingli Ma et al (2015)
wheat-miR-677ACAUUUGGACCGUCUAUUGGAGAXingli Ma et al (2015)
wheat-miR-678UUAGCACGACGACUUCCCGACUGUXingli Ma et al (2015)
wheat-miR-679AUAGCCUAGUGGUGGGAAGGGGUUXingli Ma et al (2015)
wheat-miR-680AAGUUAUCUUAUCGGAUUGAGUCUXingli Ma et al (2015)
wheat-miR-681UAAAAAGUCCCUGAACCAAACACCXingli Ma et al (2015)
wheat-miR-682UCACCCUUUAGUCCCGGUUCAUACXingli Ma et al (2015)
wheat-miR-683GCCCCACGGUGGGCGCCAXingli Ma et al (2015)
wheat-miR-684AAAGGCCUGCUAGUGGCGCACCUGXingli Ma et al (2015)
wheat-miR-685AUCCUACUUGGGGAGCCCXingli Ma et al (2015)
wheat-miR-686AUAGCAUCAUCCAUCCUGCCAXingli Ma et al (2015)
wheat-miR-687GUAAAAUCAUCAUUGGCUAGAGGAXingli Ma et al (2015)
wheat-miR-688UAUCAUGACCAAGGGCUUGCCXingli Ma et al (2015)
wheat-miR-689AGUCUAGUUGGCAUGCAUGAUACCXingli Ma et al (2015)
wheat-miR-690UUCAUGUCGGGUUCACCAXingli Ma et al (2015)
wheat-miR-691AUUGUCAUCAAUUACCAAAACCAXingli Ma et al (2015)
wheat-miR-692CCUGUUUGUCAUUAAGUUUCUXingli Ma et al (2015)
wheat-miR-693CAUCAAACUUCACAUCUACCGUCUXingli Ma et al (2015)
wheat-miR-694AUGAACCGGGACUAAUGUGAGCAUXingli Ma et al (2015)
wheat-miR-695UAAUGUCACAGAGCAACACUXingli Ma et al (2015)
wheat-miR-696UCUUAGCAGUAGCGCGGGAGCXingli Ma et al (2015)
wheat-miR-697UACCGAAAUACUUGUAGUUGGGXingli Ma et al (2015)
wheat-miR-698GCGCCAUUAGUAUGUUUGGACAGXingli Ma et al (2015)
wheat-miR-699AUUUUGCUUCGUAUGUAGUCACUXingli Ma et al (2015)
wheat-miR-700UGCAGCAUCAUCAAGAUUCUXingli Ma et al (2015)
wheat-miR-701ACGAUUGUACGAGGGUUUACUXingli Ma et al (2015)
wheat-miR-702UUUUUUCAGUAGUAAUUCXingli Ma et al (2015)
wheat-miR-703AGGGAUGUAGGGCUGCACCAXingli Ma et al (2015)
wheat-miR-704GGGACUGUAGUACUGUGAAGAXingli Ma et al (2015)
wheat-miR-705CGCGGCUCCGUCGAACUCGCCCXingli Ma et al (2015)
wheat-miR-706AAUCGAGCACUGCCUUCAAAXingli Ma et al (2015)
wheat-miR-707AACGAUUUGAAAUUUGAACGCXingli Ma et al (2015)
wheat-miR-708CAUUACGGUCACUGUAUACGCGXingli Ma et al (2015)
wheat-miR-709AUCCUUCUGGCUCUGGUAGCAAUCXingli Ma et al (2015)
wheat-miR-710AACCGUUUUUACGGGCUGGCUCAGXingli Ma et al (2015)
wheat-miR-711AUAGGACUUAGAUGUGCAAUAACUXingli Ma et al (2015)
wheat-miR-712UGGUCGUUGGUAGAGUAGGAGAXingli Ma et al (2015)
wheat-miR-713CAGAGGAUUAAGAGCCAUUAGAUCXingli Ma et al (2015)
wheat-miR-714AUUGGCACCCUGUAUGUUUAAGCAXingli Ma et al (2015)
wheat-miR-715ACCCAUUACCGCCUUAAACGAACGXingli Ma et al (2015)
wheat-miR-716AGUAAUGACGCACCUGUGGACAGUXingli Ma et al (2015)
wheat-miR-717AGUGCAGAACCGGGCUUUAGCGCCXingli Ma et al (2015)
wheat-miR-718AAACUAGUGAACUUGGUCAGACCGXingli Ma et al (2015)
wheat-miR-719UGUUGAGUUGAGAUUACCCCAXingli Ma et al (2015)
wheat-miR-721AAGCAUGCGACGCCUGCGCCAXingli Ma et al (2015)
tae-miR9666c-5pGCCAUCAUACGUCCAACCGUGmiRBase 21
tae-miR9657c-3pCGUGCUUCCUCGUCGAACGGUmiRBase 21
tae-miR118a_nprAAAAAAUAUGGGUUCAAGAUUPNRD
tae-miR2058a_nprAAAAUAAGUGACUCAAUUUUGUACPNRD
tae-miR2074_nprUAGCUCCACUAAAUUUGGAGCUPNRD
tae-miR175a_nprAAAAUAAGUGUCGCAGUUUUPNRD
tae-miR185a_nprAAAAUUAUGGAACGGAGGGAAPNRD
tae-miR164a_nprAAACCACUUCACUUAUUUAUGPNRD
tae-miR141a_nprAAAGAAGUUGAACUAAGGCUAPNRD
tae-miR139a_nprAAAGAUAAAAAGUUUGAGUGGPNRD
tae-miR078a_1_nprAAAUAAGUGUCGUGGUUUUAPNRD
tae-miR9667-5pAAAUAUGGCAAACAAUGAAUGPNRD
tae-miR046a_nprAACAAAUAUAAGAGCGUUUAGPNRD
tae-miR011b_nprAACAUUGACGAAUACUCAACAPNRD
tae-miR158a_nprAAGACAACUAAUUUGGGACGGPNRD
tae-miR2056a_nprAAGACAAGUAAUUCAGAACGGAUGPNRD
tae-miR2039a_nprAAGCGACGAGUAAUAUGGAACGGAPNRD
tae-miR9652-3pAAGCUUAAUGAGAACAUGUGPNRD
tae-miR072b_nprAAGUUUGACCAUAUUUAUAUAPNRD
tae-miR009a_1_nprAAUAAGUGUCGUGGUUUUAGUPNRD
tae-miR051a_nprAAUAAGUGUGUGAUUGCUACUPNRD
tae-miR038a_1_nprAAUACUUGUCGGAGAAAUGGAPNRD
tae-miR048a_nprAAUAGGCACCGGUGCUUCAGAPNRD
tae-miR2054a_nprAAUAUGGAACGGAGGGAGCAAPNRD
tae-miR030a_nprAAUAUGGAUCAGAGGAGGUAAPNRD
tae-miR5049-3pAAUAUGGAUCGGAGGGAGUACPNRD
tae-miR011a_1_nprAAUGAACUUUGCACGCAUGUAGAPNRD
tae-miR024a_nprAAUGGAUAAAAAAAGAUGUAUCUPNRD
tae-miR2071a_nprAAUUAGUUGACACUCAAACGGPNRD
tae-miR179a_nprAAUUAUUGUCGUGGUUUUAGUPNRD
tae-miR163a_nprAAUUCUUGUCUUAGAUUCGUCPNRD
tae-miR085a_nprACAAAUGAUGAUAGCAAGACAGPNRD
tae-miR1127b-3pACAAGUAUUUCUGGACGGAGGPNRD
tae-miR049a_nprACAAGUAUUUGGGAACGGAGGPNRD
tae-miR157a_nprACAAGUUUUUUCGGACAGAGPNRD
tae-miR027a_nprACAAUUAAUUUGGAUCGGAGGPNRD
tae-miR184a_nprACACUCUUACUUAUCGAAAGGACPNRD
tae-miR2020a_2_nprACACUUAUUUUGGACGGAGGGPNRD
tae-miR015a_nprACAGAGUCGAAUUAGAGGGUAPNRD
tae-miR055a_nprACAUUUGAGGAGCUCGUGGCAPNRD
tae-miR116a_nprACCCUUAUUAUGGAUCGGAGGPNRD
tae-miR134a_nprACUGGACGCGUCGGGCGCGUPNRD
tae-miR146a_nprACUUAUAUUUGGGAACAGAGGGPNRD
tae-miR182a_nprACUUAUUUUGGAUCAGAGGGAPNRD
tae-miR104a_1_nprACUUAUUUUGGGAUGGAGGGAPNRD
tae-miR007a_nprAGAAGAUUAGAAGAUUAAGCAPNRD
tae-miR2010a_nprAGACAAAUAUUUAGGAACGGAPNRD
tae-miR2031a_nprAGACAAAUAUUUAGGAACGGAGGPNRD
tae-miR160a_nprAGACAAGAAUUUUGGAACGGAPNRD
tae-miR010a_nprAGACACUUACUUUGGGACGGAPNRD
tae-miR1122b-3pAGACUUAUAUGUAGGAACGGAPNRD
tae-miR013a_nprAGACUUAUAUUUAGAAACGGAPNRD
tae-miR2008a_2_nprAGACUUAUAUUUAGGAACGGAPNRD
tae-miR126a_nprAGAGAGAAGGAAGGAGAGGAGAPNRD
tae-miR161a_nprAGAGAUUUCACUAUGGACUACAPNRD
tae-miR098a_nprAGAUGAUUUUCGAUAUUAUACUPNRD
tae-miR169a_nprAGAUGGAUGGAUGGAUGGAUGGAPNRD
tae-miR2021a_nprAGCAUGAGGCGACAACUGCAUPNRD
tae-miR020a_nprAGGACAAGUAUUUCCGGACGGPNRD
tae-miR043a_nprAGGAGGAAGGAGGAAGAAGAGPNRD
tae-miR035a_nprAGGAGGGGAGGGAAGGGAAGGPNRD
tae-miR2064a_nprAGGAUUGUAAAACAAAUGGGGCPNRD
tae-miR034a_nprAGGGGGCAAUCUCACCUCAACPNRD
tae-miR053a_nprAGGUGGUUAGGAUACUCGGCUPNRD
tae-miR178a_nprAGUAGUUUUAUGCUAUUUACUPNRD
tae-miR083a_nprAGUCUGUUCAGAUCGGAGGGGPNRD
tae-miR095a_nprAGUGUUGGAUGGGACCAAAUCPNRD
tae-miR021a_1_nprAGUUUAUGUCCCCGGCAGACGPNRD
tae-miR003a_1_nprAUAAAAGGGGAUGUAUCUAGAPNRD
tae-miR008a_nprAUACUUGUCGAAGAAAUGGAUPNRD
tae-miR142a_nprAUAGAUAAGUUGGAAUACAGUAPNRD
tae-miR9674b-5pAUAGCAUCAUCCAUCCUACCCPNRD
tae-miR181a_nprAUAUAAGACGUUUUAGAUCAPNRD
tae-miR176a_nprAUAUAAGAGCAUUUUUGACACPNRD
tae-miR188a_nprAUAUAAGUCUUUGUAGAGAUUUCPNRD
tae-miR029a_nprAUAUUAGUUUACGGAGGGAAUPNRD
tae-miR099a_nprAUAUUAUGCAGAUUGAAGAUPNRD
tae-miR9658-3pAUCGUUCUGGGUGAAUAGGCCPNRD
tae-miR100a_nprAUCUGGGACGCCUUCGCGGCCPNRD
tae-miR111a_nprAUCUUCUAUCGUGGGACGAAGPNRD
tae-miR032a_nprAUCUUGCUUAAGGCGUUACUPNRD
tae-miR086a_nprAUGACUCAACUUUAUACUAACPNRD
tae-miR120b_nprAUGUCCUAUUUUUAGCAAAGPNRD
tae-miR064a_nprAUUAAUAUGAAUCGGAGGGAGPNRD
tae-miR136a_nprAUUAAUAUGGAUCGAAGGGAGPNRD
tae-miR070a_nprAUUAAUAUGGAUCUGAGGGAGPNRD
tae-miR2052a_nprAUUAGUUUACAGAGGGAGUAUPNRD
tae-miR2055a_nprAUUAUGGAAAGGAGGGAGUAPNRD
tae-miR077a_nprAUUAUGGGACAGAGGGAGUAAPNRD
tae-miR077b_nprAUUAUGGGACAGAGGGAGUAGPNRD
tae-miR077c_1_nprAUUAUGGGACAGAGGGAGUAUPNRD
tae-miR137a_nprAUUCGAGAAUCAUUGGACGAUPNRD
tae-miR054a_nprAUUUCUGGACAGAGGGAGUAUPNRD
tae-miR147a_nprCAAAUGUUGGCUAGUGAUUGGUUPNRD
tae-miR2028a_2_nprCAAGAAUUUUGGGACGGAGGUPNRD
tae-miR073a_1_nprCAAUAACGUUCCUAUAUUAUGPNRD
tae-miR2068a_nprCACUUAUUAUGGAUCGGAGGUPNRD
tae-miR2067_nprCACUUAUUUUGAGACGGAGGGPNRD
tae-miR9679-5pCAGAACCAGAAUGAGUAGCUCPNRD
tae-miR088b_nprCAGCGUUGAUGAACCGUCCGGPNRD
tae-miR091a_nprCAGGAGGUCGCCGCAGACGCUPNRD
tae-miR069a_nprCAGGGAUGGAGCAGAGCAAGGPNRD
tae-miR037a_nprCAUCAAAAUGGACAAAAAGGPNRD
tae-miR151a_nprCAUCGUUCUGAUGCAGAGACCGGPNRD
tae-miR2038a_nprCAUCUAUUUUAGAACGGAGGGAGUPNRD
tae-miR123a_nprCAUGGCCAAGGCCUCUGAGGUUCPNRD
tae-miR9668-5pCCAAUGACAAGUAUUUUCGGAPNRD
tae-miR9672a-3pCCACGACUGUCAUUAAGCAUCPNRD
tae-miR106a_nprCCAUCCCUCAACUCCGCCGCCPNRD
tae-miR082a_nprCCCCCUCUGGUACUUAUUGGCUPNRD
tae-miR100b_1_nprCCGCGUCGGCGUACCAGGUGGPNRD
tae-miR111b_nprCCGUCCCACAAUAGAAGAUUGPNRD
tae-miR067b_nprCCUGCGGGGUCGAACUGGGAAPNRD
tae-miR9652-5pCCUGUUUGUCAUUAAGUUUCUUPNRD
tae-miR089a_nprCGCAAAACUGUAACCAUAGAGPNRD
tae-miR093a_nprCGGGCGCGGCCGAGGCGGUGGAPNRD
tae-miR081a_nprCGGGCUUGAUGUCGUAGUGCACGPNRD
tae-miR106b_nprCGGUGGAGCUGGUUGAUGGACPNRD
tae-miR180a_nprCGGUGGCGGCAAAGGGGACCAPNRD
tae-miR160b_nprCGUCCCAAAAUUCUUGUCUUAPNRD
tae-miR068b_nprCUCUCUCGGGAGGGCUGAUCPNRD
tae-miR076a_nprCUGCUGAAGUUACUCCCAUUGPNRD
tae-miR007b_nprCUUAAUUUUGUAAUCUUCUGGPNRD
tae-miR142b_nprCUUAUUUUGAUGAAUCUAUGAPNRD
tae-miR101a_nprCUUAUUUUGGGAUGGAGGGAGPNRD
tae-miR9656-3pCUUCGAGACUCUGAACAGCGGPNRD
tae-miR103a_nprCUUGGGACAAGCUUUUUCGGAPNRD
tae-miR073c_nprGAAUAACGUUCCUAUAUUAUGPNRD
tae-miR189b_nprGACACGAGGCGCAGGACCUACAAGPNRD
tae-miR088a_nprGAGCGGUUCACCGGCGCUGCAPNRD
tae-miR006a_nprGAGGCAUCAUUAGGAAUACUPNRD
tae-miR2062a_nprGAGUCAUCUAUUUUGGAACGGAPNRD
tae-miR9674a-5pGCAUCAUCCAUCCUACCAUUCPNRD
tae-miR122a_nprGCCCGGUCAUAGUCAGGUAUCPNRD
tae-miR122b_nprGCCCGGUCAUAGUCAGGUAUCUPNRD
tae-miR135a_nprGCGAGGUGAUGAUGUUAUGUAUGPNRD
tae-miR9665-3pGCUAGCAGUGUAAACUCAAAUCAPNRD
tae-miR170b_nprGGAAUAAUAAAAUAGGACGPNRD
tae-miR154b_nprGGCGAGGGACAUACACUGUACAPNRD
tae-miR145a_nprGGUGUUUCGUCAAUAUGCAACPNRD
tae-miR020b_nprGUCCGGAAAUACUUGUCCUAGPNRD
tae-miR128a_nprGUGGAUGAUGAGAUCACAAGUAAPNRD
tae-miR074a_nprUAAAAACAUUCUUAUAUUUUCPNRD
tae-miR2033a_2_nprUAAACUGAGAGAGAGGGAGUAPNRD
tae-miR102a_nprUAAGCGCGUUGGCGUCGAACGPNRD
tae-miR131a_nprUAAGUUUCUUAGAUACUGGUAPNRD
tae-miR1120c-5pUAAUAUAAGAACGUUUUUGACPNRD
tae-miR074b_nprUAAUAUAAGAACGUUUUUUACPNRD
tae-miR153b_nprUAAUAUAAGAGUGUUUAGAUAPNRD
tae-miR073b_1_nprUAAUAUAGGAACGUUAUUGACPNRD
tae-miR154a_nprUACAGUUUAUGUCCCCGGCAGPNRD
tae-miR148a_nprUACUCCUAAUGGAGCAGUUGGUAPNRD
tae-miR9669-5pUACUGUGGGCACUUAUUUGACPNRD
tae-miR017a_nprUAGCCAAGGAUGAUUUGCCUPNRD
tae-miR132a_nprUAUAAACUUGGUCAAAGUUUGPNRD
tae-miR072a_1_nprUAUAAAUUUGGUCAAACUUUAPNRD
tae-miR164b_nprUAUAUAAGUGACGUGGUUUUAPNRD
tae-miR2049a_nprUAUAUUCUGGGACAGAGGGAGPNRD
tae-miR125a_nprUAUGGAUGAAGAUAUGCACUPNRD
tae-miR041a_nprUAUGGGACAGAGGGAGUAGUAGPNRD
tae-miR2048a_nprUAUUAGUUUACAGAGGGAGUAPNRD
tae-miR155a_1_nprUAUUUCGGUACAGAGGGAGUAPNRD
tae-miR155b_nprUAUUUCGGUACAGAGGGAGUAAPNRD
tae-miR173a_nprUAUUUGAACGACAAGUAGUAUPNRD
tae-miR033a_nprUCAAAGGAUGAGCAAAUACUPNRD
tae-miR031a_nprUCAAUUAAUUUGGAUCGGAGGPNRD
tae-miR004a_1_nprUCACAAAUAUAAGAUGUUCUPNRD
tae-miR2009b_nprUCAGAUGAGAAGGCAGAUCAUAPNRD
tae-miR2012a_nprUCAUCUAUUUUGGAACGGAGGPNRD
tae-miR9659-3pUCCAAUGGUUGUUCACGGCAUCPNRD
tae-miR2017a_nprUCCGUCCGGAAAUACUUGUCAPNRD
tae-miR1137b-5pUCCGUUCCAGAAUAGAUGACCPNRD
tae-miR023a_nprUCGCAAAUAAUGGUGGCCCUPNRD
tae-miR023b_nprUCGCAAAUAAUGGUGGCCCUCGPNRD
tae-miR075a_nprUCGCUGUAGUACGCGCAGUCCPNRD
tae-miR068a_nprUCGGGGCUCCGGAGAGGGGGPNRD
tae-miR1122c-3pUCUAAUAUUAUGGGACGGAGGPNRD
tae-miR079a_1_nprUCUAUCUCAAAAUGUAAGACAPNRD
tae-miR2022a_nprUCUAUUUUAGAACGGAGGGAGPNRD
tae-miR9678-3pUCUGGCGAGGGACAUACACUGUPNRD
tae-miR6197-5pUCUGUAAACAAAUGUAGGACGPNRD
tae-miR109a_nprUCUGUAAACUUGUAUAAGAGCPNRD
tae-miR186a_nprUCUGUACCGAAAUACUUGUAGPNRD
tae-miR1130b-3pUCUUAUAUUAUGGGACGGAGGPNRD
tae-miR5062-5pUGAACCUUAGGGAACAGCCGCAUPNRD
tae-miR045a_nprUGAAGACUAGUUUAUUACAUPNRD
tae-miR167c-5pUGAAGCUGCCAGCAUGAUCUGCPNRD
tae-miR2059a_nprUGACAAGUAUUUCCGGACGGAGGPNRD
tae-miR032b_nprUGACAGUAGGGGUAGCGAGGCPNRD
tae-miR152a_nprUGACCAAGUUUGUAGAGAAAAPNRD
tae-miR9671-5pUGACUUUACACAACUGUCCGGCPNRD
tae-miR2005a_2_nprUGAGAAGGCAGAUCAUAAUAGCPNRD
tae-miR5384-3pUGAGCGCGCCGCCGUCGAAUGPNRD
tae-miR165a_nprUGAUGCCUGAAGAUUGCACUGPNRD
tae-miR001a_1_nprUGCAGCGCCGGUGAACCGCUCPNRD
tae-miR012a_1_nprUGCAGGGUGAGGGUGGGAUUCPNRD
tae-miR444c_1_nprUGCAGUUGCUGUCUCAAGCUUPNRD
tae-miR138a_1_nprUGGACAUGUAUAACAUGGUGGPNRD
tae-miR113a_nprUGGCUACUUCCUUUCCCUUGCCPNRD
tae-miR056a_nprUGGCUGUUGGUAGAGUGGAAGPNRD
tae-miR2035a_nprUGGGCACAACCCACCAGGGCGCGCPNRD
tae-miR190a_nprUGGGGGCGCGGCUGGAGAUGPNRD
tae-miR159a_nprUGUAGAAAUAGGCACCGGUGCPNRD
tae-miR9657a-3pUGUGCUUCCUCGUCGAACGGUPNRD
tae-miR108a_nprUGUGUCUCAACUGCGGGUCGCPNRD
tae-miR044c_nprUGUUAUGAUCUGCUUCUCAUCPNRD
tae-miR044b_nprUGUUAUGAUCUGCUUCUCAUUPNRD
tae-miR042a_nprUGUUGGCUCGACUCACUCAGAPNRD
tae-miR025a_nprUUAAUUGACGCAGCCUCUAUAPNRD
tae-miR187a_nprUUACUUGUUUUAGAUUUGUCUPNRD
tae-miR065a_nprUUAGGAAACAUGUAGUUUAGAPNRD
tae-miR189a_nprUUAGGCACUCGUCAGUGACCAPNRD
tae-miR2046a_nprUUAUAUUAGUUUACAGAGGGAPNRD
tae-miR094a_1_nprUUCAGUUUUCUCCAACAUCUUAPNRD
tae-miR057a_nprUUCCACUCUACCAACAGCCACGPNRD
tae-miR050b_nprUUCGCCGGAGAAGCAUGUUGCPNRD
tae-miR102b_nprUUCGCCGGUAGCGCGUUUUCCPNRD
tae-miR9657b-5pUUCGUCGGAGAAGCAUGUUGCPNRD
tae-miR170a_nprUUCUAUUUUGUUGGUUUCUAPNRD
tae-miR035b_nprUUCUCUUCUCUUCUCUCCUCUPNRD
tae-miR9654a-3pUUCUGAAAGGCUUGAAGCGAAUPNRD
tae-miR1120b-3pUUCUUAUAUUGUGGGACAGAGPNRD
tae-miR2014a_nprUUCUUAUAUUUUGGGACGGAGPNRD
tae-miR133a_nprUUCUUCCAGGAUCGUUCAUUAPNRD
tae-miR127a_nprUUGACGCUCAAACGGAUGUAUPNRD
tae-miR112a_1_nprUUGAGACAUUUAUUUUGGGACPNRD
tae-miR047a_nprUUGAGGUGGAUUUGAAGGGGAUPNRD
tae-miR022a_nprUUGCACUACAGAGGACAUCAAPNRD
tae-miR9660-5pUUGCGAGCAACGGAUGAAUCPNRD
tae-miR120a_nprUUGCUAAAAAUAGGACAUAUPNRD
tae-miR028a_nprUUGCUGGAAGAGUUUUAUUCAAPNRD
tae-miR076b_nprUUGGGACAUGUGAUGUUACAGUAPNRD
tae-miR058a_nprUUGUACAAUGGGAGAUGCUUAPNRD
tae-miR117a_nprUUUAGACUAGAAAUAGAGCAGPNRD
tae-miR9675-3pUUUAUGAUCACUCUCGUUUUGPNRD
tae-miR2034a_nprUUUGACCAAAGCUAAUAUGCGGACPNRD
tae-miR9653a-3pUUUGAGACUUUGGCCAUGGCCPNRD
tae-miR5048-5pUUUGCAGGUUUUAGGUCUAAGUPNRD
tae-miR2275-3pUUUGGUUUCCUCCAAUAUCUCGPNRD
tae-miR129a_nprUUUGUAAACUUUCAUAAGACGPNRD
tae-miR191a_nprUUUUUGUAUCUCGAGCAAUGUPNRD

2330NRriceknownmiRfrommiRBAse+PMRDmiR_sequencedatabase name
osa-miR156aUGACAGAAGAGAGUGAGCACmiRBase.V20
osa-miR156b-3pGCUCACUCUCUAUCUGUCAGCmiRBase.V20
osa-miR156c-3pGCUCACUUCUCUCUCUGUCAGCmiRBase.V20
osa-miR156f-3pGCUCACUUCUCUUUCUGUCAGCmiRBase.V20
osa-miR156j-3pGCUCGCUCCUCUUUCUGUCAGCmiRBase.V20
osa-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase.V20
osa-miR160a-3pGCGUGCAAGGAGCCAAGCAUGmiRBase.V20
osa-miR160c-3pGCGUGCACGGAGCCAAGCAUAmiRBase.V20
osa-miR160d-3pGCGUGCGAGGAGCCAAGCAUGmiRBase.V20
osa-miR162aUCGAUAAACCUCUGCAUCCAGmiRBase.V20
osa-miR164aUGGAGAAGCAGGGCACGUGCAmiRBase.V20
osa-miR166a-5pGGAAUGUUGUCUGGUUCAAGGmiRBase.V20
osa-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase.V20
osa-miR166b-5pGGAAUGUUGUCUGGCUCGGGGmiRBase.V20
osa-miR166c-5pGGAAUGUUGUCUGGUCCGAGmiRBase.V20
osa-miR166d-5pGGAAUGUUGUCUGGCUCGAGGmiRBase.V20
osa-miR166e-3pUCGAACCAGGCUUCAUUCCCCmiRBase.V20
osa-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
osa-miR167a-3pAUCAUGCAUGACAGCCUCAUUUmiRBase.V20
osa-miR167c-3pGGUCAUGCUGCGGCAGCCUCACUmiRBase.V20
osa-miR169aCAGCCAAGGAUGACUUGCCGAmiRBase.V20
osa-miR171aUGAUUGAGCCGCGCCAAUAUCmiRBase.V20
osa-miR393aUCCAAAGGGAUCGCAUUGAUCmiRBase.V20
osa-miR394UUGGCAUUCUGUCCACCUCCmiRBase.V20
osa-miR395bGUGAAGUGUUUGGGGGAACUCmiRBase.V20
osa-miR395tGUGAAGUGUUUGGGGAAACUCmiRBase.V20
osa-miR395cGUGAAGUGUUUGGAGGAACUCmiRBase.V20
osa-miR395aGUGAAGUGCUUGGGGGAACUCmiRBase.V20
osa-miR395fGUGAAUUGUUUGGGGGAACUCmiRBase.V20
osa-miR395uGUGAAGCGUUUGGGGGAAAUCmiRBase.V20
osa-miR396a-5pUUCCACAGCUUUCUUGAACUGmiRBase.V20
osa-miR396a-3pGUUCAAUAAAGCUGUGGGAAmiRBase.V20
osa-miR396c-5pUUCCACAGCUUUCUUGAACUUmiRBase.V20
osa-miR396c-3pGGUCAAGAAAGCUGUGGGAAGmiRBase.V20
osa-miR397aUCAUUGAGUGCAGCGUUGAUGmiRBase.V20
osa-miR397bUUAUUGAGUGCAGCGUUGAUGmiRBase.V20
osa-miR398aUGUGUUCUCAGGUCACCCCUUmiRBase.V20
osa-miR398bUGUGUUCUCAGGUCGCCCCUGmiRBase.V20
osa-miR399aUGCCAAAGGAGAAUUGCCCUGmiRBase.V20
osa-miR399dUGCCAAAGGAGAGUUGCCCUGmiRBase.V20
osa-miR399eUGCCAAAGGAGAUUUGCCCAGmiRBase.V20
osa-miR399hUGCCAAAGGAGACUUGCCCAGmiRBase.V20
osa-miR399iUGCCAAAGGAGAGCUGCCCUGmiRBase.V20
osa-miR399jUGCCAAAGGAGAGUUGCCCUAmiRBase.V20
osa-miR399kUGCCAAAGGAAAUUUGCCCCGmiRBase.V20
osa-miR156kUGACAGAAGAGAGAGAGCACAmiRBase.V20
osa-miR156l-5pCGACAGAAGAGAGUGAGCAUAmiRBase.V20
osa-miR159a.2UUGCAUGCCCCAGGAGCUGCAmiRBase.V20
osa-miR159a.1UUUGGAUUGAAGGGAGCUCUGmiRBase.V20
osa-miR159cAUUGGAUUGAAGGGAGCUCCAmiRBase.V20
osa-miR159dAUUGGAUUGAAGGGAGCUCCGmiRBase.V20
osa-miR159eAUUGGAUUGAAGGGAGCUCCUmiRBase.V20
osa-miR159fCUUGGAUUGAAGGGAGCUCUAmiRBase.V20
osa-miR319a-5pAGCUGCCGAAUCAUCCAUUCAmiRBase.V20
osa-miR319a-3pACUGGAUGACGCGGGAGCUAAmiRBase.V20
osa-miR319a-3p.2-3pUUGGACUGAAGGGUGCUCCCmiRBase.V20
osa-miR160e-5pUGCCUGGCUCCCUGUAUGCCGmiRBase.V20
osa-miR160e-3pGCGUGCGAGGUGCCAAGCAUGmiRBase.V20
osa-miR160f-5pUGCCUGGCUCCCUGAAUGCCAmiRBase.V20
osa-miR160f-3pGCAUUGAGGGAGUCAUGCAGGmiRBase.V20
osa-miR162bUCGAUAAGCCUCUGCAUCCAGmiRBase.V20
osa-miR164cUGGAGAAGCAGGGUACGUGCAmiRBase.V20
osa-miR164dUGGAGAAGCAGGGCACGUGCUmiRBase.V20
osa-miR164eUGGAGAAGCAGGGCACGUGAGmiRBase.V20
osa-miR166k-5pGGUUUGUUGUCUGGCUCGAGGmiRBase.V20
osa-miR166k-3pUCGGACCAGGCUUCAAUCCCUmiRBase.V20
osa-miR166l-5pGGAUUGUUGUCUGGUUCAAGGmiRBase.V20
osa-miR167d-5pUGAAGCUGCCAGCAUGAUCUGmiRBase.V20
osa-miR167d-3pGAUCAUGCUGUGCAGUUUCAUCmiRBase.V20
osa-miR167e-3pAGAUCAUGUUGCAGCUUCACUmiRBase.V20
osa-miR167h-3pAGGUCAUGCUGUAGUUUCAUCmiRBase.V20
osa-miR168a-5pUCGCUUGGUGCAGAUCGGGACmiRBase.V20
osa-miR168a-3pGAUCCCGCCUUGCACCAAGUGAAUmiRBase.V20
osa-miR168bAGGCUUGGUGCAGCUCGGGAAmiRBase.V20
osa-miR169bCAGCCAAGGAUGACUUGCCGGmiRBase.V20
osa-miR169dUAGCCAAGGAUGAAUUGCCGGmiRBase.V20
osa-miR169eUAGCCAAGGAUGACUUGCCGGmiRBase.V20
osa-miR169f.2UGAGGACAAGAGCUGAUUCGGmiRBase.V20
osa-miR169f.1UAGCCAAGGAUGACUUGCCUAmiRBase.V20
osa-miR169hUAGCCAAGGAUGACUUGCCUGmiRBase.V20
osa-miR169i-5p.2UGGUGAUAAGGGUGUAGCUCUGmiRBase.V20
osa-miR169i-3pUGAGUCGCUCUUAUCACUCAUGmiRBase.V20
osa-miR169nUAGCCAAGAAUGACUUGCCUAmiRBase.V20
osa-miR169pUAGCCAAGGACAAACUUGCCGGmiRBase.V20
osa-miR169qUAGCCAAGGAGACUGCCCAUGmiRBase.V20
osa-miR171bUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
osa-miR171c-5pGGAUAUUGGUGCGGUUCAAUCmiRBase.V20
osa-miR171d-5pUGUUGGCCCGGCUCACUCAGAmiRBase.V20
osa-miR171e-5pUGUUGGCUCGGCUCACUCAGAmiRBase.V20
osa-miR171f-5pUGUUGGCAUGGUUCAAUCAAAmiRBase.V20
osa-miR171gGAGGUGAGCCGAGCCAAUAUCmiRBase.V20
osa-miR172aAGAAUCUUGAUGAUGCUGCAUmiRBase.V20
osa-miR172bGGAAUCUUGAUGAUGCUGCAUmiRBase.V20
osa-miR172cUGAAUCUUGAUGAUGCUGCACmiRBase.V20
osa-miR166g-5pAAUGGAGGCUGAUCCAAGAUCmiRBase.V20
osa-miR166g-3pUCGGACCAGGCUUCAUUCCUCmiRBase.V20
osa-miR166h-5pGGAAUGUUGGCUGGCUCGAGGmiRBase.V20
osa-miR166i-5pAAUGCAGUUUGAUCCAAGAUCmiRBase.V20
osa-miR166i-3pUCGGAUCAGGCUUCAUUCCUCmiRBase.V20
osa-miR171hGUGAGCCGAACCAAUAUCACUmiRBase.V20
osa-miR393b-5pUCCAAAGGGAUCGCAUUGAUCUmiRBase.V20
osa-miR393b-3pUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
osa-miR408-5pCAGGGAUGAGGCAGAGCAUGGmiRBase.V20
osa-miR408-3pCUGCACUGCCUCUUCCCUGGCmiRBase.V20
osa-miR172d-5pGCAGCACCAUCAAGAUUCACmiRBase.V20
osa-miR171i-5pAGGUAUUGGCGUGCCUCAAUCmiRBase.V20
osa-miR171i-3pGGAUUGAGCCGCGUCAAUAUCmiRBase.V20
osa-miR166mUCGGACCAGGCUUCAUUCCCUmiRBase.V20
osa-miR166j-5pGAAUGACGUCCGGUCUGAAGAmiRBase.V20
osa-miR413CUAGUUUCACUUGUUCUGCACmiRBase.V20
osa-miR414UCAUCCUCAUCAUCAUCGUCCmiRBase.V20
osa-miR415AACAGAACAGAAGCAGAGCAGmiRBase.V20
osa-miR416UGUUCGUCCGUACACUGUUCAmiRBase.V20
osa-miR417GAAUGUAGUGAAUUUGUUCCAmiRBase.V20
osa-miR418UAAUGUGAUGAUGAAAUGACGmiRBase.V20
osa-miR419UGAUGAAUGCUGACGAUGUUGmiRBase.V20
osa-miR426UUUUGGAAGUUUGUCCUUACGmiRBase.V20
osa-miR435UUAUCCGGUAUUGGAGUUGAmiRBase.V20
osa-miR437AAAGUUAGAGAAGUUUGACUUmiRBase.V20
osa-miR438UUCCCACGCGUUAUAGUGAAAmiRBase.V20
osa-miR390-5pAAGCUCAGGAGGGAUAGCGCCmiRBase.V20
osa-miR390-3pCGCUAUCUAUCCUGAGCUCCmiRBase.V20
osa-miR439aUGUCGAACCGCGGUUGUUCGAmiRBase.V20
osa-miR440AGUGUCUCCUGAUGAUCGGGACAAmiRBase.V20
osa-miR396e-5pUCCACAGGCUUUCUUGAACUGmiRBase.V20
osa-miR396e-3pAUGGUUCAAGAAAGCCCAUGGAAAmiRBase.V20
osa-miR443AUCACAAUACAAUAAAUCUGGAmiRBase.V20
osa-miR444a-5pGCUAGAGGUGGCAACUGCAUAmiRBase.V20
osa-miR444a-3p.2UGCAGUUGCUGCCUCAAGCUUmiRBase.V20
osa-miR444a-3p.1UUGCUGCCUCAAGCUUGCUGCmiRBase.V20
osa-miR528-5pUGGAAGGGGCAUGCAGAGGAGmiRBase.V20
osa-miR528-3pCCUGUGCUUGCCUCUUCCAUUmiRBase.V20
osa-miR529aCUGUACCCUCUCUCUUCUUCmiRBase.V20
osa-miR530-5pUGCAUUUGCACCUGCACCUAmiRBase.V20
osa-miR530-3pAGGUGCAGAGGCAGAUGCAACmiRBase.V20
osa-miR531aCUCGCCGGGGCUGCGUGCCGCCAUmiRBase.V20
osa-miR535-5pUGACAACGAGAGAGAGCACGCmiRBase.V20
osa-miR535-3pGUGCUUUCUCCCGUUGUCACUmiRBase.V20
osa-miR395oAUGAAGUGUUUGGAGGAACUCmiRBase.V20
osa-miR395vGUGAAGUAUUUGGCGGAACUCmiRBase.V20
osa-miR395wGUGAAGUGUUUGGGGGAUUCUCmiRBase.V20
osa-miR810aUCAUAAGCCCACCACAUGUGGmiRBase.V20
osa-miR812aGACGGACGGUUAAACGUUGGACmiRBase.V20
osa-miR814aCACUUCAUAGUACAACGAAUCUmiRBase.V20
osa-miR815aAAGGGGAUUGAGGAGAUUGGGmiRBase.V20
osa-miR816GUGACAUAUUUUACUACAACmiRBase.V20
osa-miR817UCCAACUUGAGGCCCGAUUGAmiRBase.V20
osa-miR818aAAUCCCUUAUAUUAUGGGACGGmiRBase.V20
osa-miR820aUCGGCCUCGUGGAUGGACCAGmiRBase.V20
osa-miR821aAAGUCAUCAACAAAAAAGUUGAAUmiRBase.V20
osa-miR529bAGAAGAGAGAGAGUACAGCUUmiRBase.V20
osa-miR1423-5pAGGCAACUACACGUUGGGCGCUCGmiRBase.V20
osa-miR1423-3pAGCGCCCAAGCGGUAGUUGUCmiRBase.V20
osa-miR1424AUGCACACUGAUGCUGAUUGUmiRBase.V20
osa-miR1425-5pUAGGAUUCAAUCCUUGCUGCUmiRBase.V20
osa-miR1425-3pCAGCAAGAACUGGAUCUUAAUmiRBase.V20
osa-miR1426AGAAUCUUGAUGAUGAUUAAAmiRBase.V20
osa-miR1427UGCGGAACCGUGCGGUGGCGCmiRBase.V20
osa-miR1428a-5pCGUUUUGCAAAUUCGCAGGCCmiRBase.V20
osa-miR1428a-3pUAAGAUAAAGCCGUGAAUUUGmiRBase.V20
osa-miR1429-5pGUAAUAUACUAAUCCGUGCAUmiRBase.V20
osa-miR1429-3pGUUGCACGGGUUUGUAUGUUGmiRBase.V20
osa-miR1430UGGUGAGCCUUCCUGGCUAAGmiRBase.V20
osa-miR1431UUUGCGAGUUGGCCCGCUUGCmiRBase.V20
osa-miR1432-5pAUCAGGAGAGAUGACACCGACmiRBase.V20
osa-miR1432-3pCAGGUGUCAUCUCCCCUGAACmiRBase.V20
osa-miR169r-5pUAGCCAAGGAUGAUUUGCCUGmiRBase.V20
osa-miR169r-3pUGGCAAGUCUCCUCGGCUACCmiRBase.V20
osa-miR444b.2UGCAGUUGUUGUCUCAAGCUUmiRBase.V20
osa-miR444b.1UGUUGUCUCAAGCUUGCUGCCmiRBase.V20
osa-miR444d.3UUGUGGCUUUCUUGCAAGUUGmiRBase.V20
osa-miR444fUGCAGUUGUUGCCUCAAGCUUmiRBase.V20
osa-miR810b.1UGAACACCGAUAUGCGUCAUCmiRBase.V20
osa-miR810b.2AAGUGAUUUAAUUAUGCCGUUmiRBase.V20
osa-miR1435UUUCUUAAGUCAAACUUUUUmiRBase.V20
osa-miR1436ACAUUAUGGGACGGAGGGAGUmiRBase.V20
osa-miR1437UCCGGCGCCGCACUAGGCACUGmiRBase.V20
osa-miR1438AGGGUAAUUUUAUCAUUUUUAAmiRBase.V20
osa-miR1440aUGCUCAAAUACCACUCUCCUmiRBase.V20
osa-miR1441ACCGGAUGUCGGAAAAGGUUUmiRBase.V20
osa-miR1442AUUCAUAGUACUAGAUGUGUmiRBase.V20
osa-miR1439UUUUGGAACGGAGUGAGUAUUmiRBase.V20
osa-miR531bCUCGCCGGGGCUGCGUGCCGmiRBase.V20
osa-miR1846d-5pUCCCACCGAGCAGCCGGAUCUCmiRBase.V20
osa-miR1846d-3pUAUCCGGCGCCGCAGGGAGGmiRBase.V20
osa-miR1847.1UGCAGUUUGCAGUUGUGGCACmiRBase.V20
osa-miR1847.2UGGCCCACAUGUUAGUGCCACAACmiRBase.V20
osa-miR1848CCUCGCCGGCGCGCGCGUGCAmiRBase.V20
osa-miR1849UAUCGUAUCCUAGGUUGGUUUmiRBase.V20
osa-miR1850.1UGGAAAGUUGGGAGAUUGGGGmiRBase.V20
osa-miR1850.2UUGUGUGUGAACUAAACGUGGmiRBase.V20
osa-miR1850.3CUGUUUAGUUCACAUCAAUCUUmiRBase.V20
osa-miR1851CGUCUGGGAUGGCAUUUUGGCmiRBase.V20
osa-miR1852AUAUGGAUUCAGAAUGCAGGUmiRBase.V20
osa-miR1853-5pAGCAUUCAAACAUUCCCAAUUACCmiRBase.V20
osa-miR1853-3pUAAUUGGGGAUGUUCGGUUGCUmiRBase.V20
osa-miR1854-5pUGGUGAAAUUUGUAGAUUGGAmiRBase.V20
osa-miR1854-3pUCCAAUUUGGGGAUUUGCUGAUmiRBase.V20
osa-miR1855AGCACUGGAGUAGCCAAGAGAmiRBase.V20
osa-miR1856UAUGCGUAAGACGGAUUCGUAmiRBase.V20
osa-miR1857-5pUGGUUUUUUUGGAGCAUGAGGmiRBase.V20
osa-miR1857-3pUCAUGCUCCAAGAAAACCAGGmiRBase.V20
osa-miR1428bUAAGAUAAUGCCAUGAAUUCGmiRBase.V20
osa-miR1428e-5pAAUUCACAGGCCCUAUCUUGUGmiRBase.V20
osa-miR1428e-3pUAAGAUAAUGCCAUGAAUUUGmiRBase.V20
osa-miR1858aGAGAGGAGGACGGAGUGGGGCmiRBase.V20
osa-miR1846a-5pAGUGAGGAGGCCGGGGCCGCUmiRBase.V20
osa-miR1846a-3pUGACCCCGUUCUCCUCGCCGGmiRBase.V20
osa-miR1859UUUCCUAUGACGUCCAUUCCAAmiRBase.V20
osa-miR1860-5pAGAAAACCAGCUUCCAGAUCUmiRBase.V20
osa-miR1860-3pAUCUGGAAGCUAGGUUUUCUCUmiRBase.V20
osa-miR1861aUGAUCUUGAGGCAGAAACUGAGmiRBase.V20
osa-miR1861bCGAUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861cCGAUCUUGUAGCAAGAACUGAGmiRBase.V20
osa-miR1861dUGGUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861eCGGUCUUGUGGCAAGAACUGAGmiRBase.V20
osa-miR1861gCAGUCUUGUGGCAAGAACUGAGmiRBase.V20
osa-miR1861hCGGUCUUGAGGCAGGAACUGAGmiRBase.V20
osa-miR1861nCGAUCUUGUGGCAGGAGCUGAGmiRBase.V20
osa-miR1862aACGAGGUUGGUUUAUUUUGGGACGmiRBase.V20
osa-miR1863aAGCUCUGAUACCAUGUUAGAUUAGmiRBase.V20
osa-miR1864UUGUAGUAACGUGAUGGUCAAUGUmiRBase.V20
osa-miR1865-5pUGCUAGUGAUGGUGAUUCUUCGACmiRBase.V20
osa-miR1865-3pCGAAGAAUCGCAGUCACUAGUUGUmiRBase.V20
osa-miR1866-5pGAGGGAUUUUGCGGGAAUUUCACGmiRBase.V20
osa-miR1866-3pUGAAAUUCCUGUAAAAUUCUUGmiRBase.V20
osa-miR1868UCACGGAAAACGAGGGAGCAGCCAmiRBase.V20
osa-miR812fACGGAUGAUUAAAGUUGGACACGGmiRBase.V20
osa-miR1869UGAGAACAAUAGGCAUGGGAGGUAmiRBase.V20
osa-miR1870-5pUGCUGAAUUAGACCUAGUGGGCAUmiRBase.V20
osa-miR1870-3pUUUAGGGCUAAUUCAGCAUGAACAmiRBase.V20
osa-miR1871AUGGCUCUGAUAUCAUGUUGGUUUmiRBase.V20
osa-miR1872GAACUGUAAGUCUGUGACGGGUAAmiRBase.V20
osa-miR1873UCAACAUGGUAUCAGAGCUGGAAGmiRBase.V20
osa-miR1874-5pUAGGGCUACUACACCAUCCAUAAGmiRBase.V20
osa-miR1874-3pUAUGGAUGGAGGUGUAACCCGAUGmiRBase.V20
osa-miR1875ACAAUGGAGUGAAGUGCAACAGAAmiRBase.V20
osa-miR1862dACUAGGUUUGUUUAUUUUGGGACGmiRBase.V20
osa-miR1876AUAAGUGGGUUUGUGGGCUGGCCCmiRBase.V20
osa-miR1862eCUAGAUUUGUUUAUUUUGGGACGGmiRBase.V20
osa-miR1877AGAUGACAUGUGAAUGAUGAGGGGmiRBase.V20
osa-miR1878ACUUAAUCUGGACACUAUAAAAGAmiRBase.V20
osa-miR1879GUGUUUGGUUUAGGGAUGAGGUGGmiRBase.V20
osa-miR1880UUCCAAGCGGGCCACUUAAGCAUUmiRBase.V20
osa-miR1881AAUGUUAUUGUAGCGUGGUGGUGUmiRBase.V20
osa-miR1882aAGAUUGCUUUCAAGGUCAUUUCUUmiRBase.V20
osa-miR1882e-3pGAAAUGAUCUUGGACGUAAUCUAGmiRBase.V20
osa-miR812gAAGACGGAUGAUUAAAGUUGGACAmiRBase.V20
osa-miR1883aACCUGUGACGGGCCGAGAAUGGAAmiRBase.V20
osa-miR1319aAACCGGCAUCUGUAAUAUAUUAUAmiRBase.V20
osa-miR1320-5pUGGAACGGAGGAAUUUUAUAGmiRBase.V20
osa-miR1320-3pUGUAAAAUUCAUUCGUUCCAAmiRBase.V20
osa-miR1846c-3pUGACCCCGGUCUGCUCGCUGGmiRBase.V20
osa-miR2055UUUCCUUGGGAAGGUGGUUUCmiRBase.V20
osa-miR827UUAGAUGACCAUCAGCAAACAmiRBase.V20
osa-miR1846eCAACGAGGAGGCCGGGACCAmiRBase.V20
osa-miR2090AACUCUGAUUCUAGAAUUUUUGmiRBase.V20
osa-miR2091-5pUCAACCGAGCCGAGGAGGAGGmiRBase.V20
osa-miR2091-3pCAUACAUUGCCUCCUAGGCUUGmiRBase.V20
osa-miR2092-5pCAACUGAAGUCGGUGUUUACUmiRBase.V20
osa-miR2092-3pACCAGCAUUCCAUUGGCAGAGGmiRBase.V20
osa-miR2093-5pGUGCAUUAAUUGGAAGAACAmiRBase.V20
osa-miR2093-3pACAUCUUCCAAUUAAUGCAUmiRBase.V20
osa-miR2094-5pUGGCUGCUAGGCUCCUGGGUGmiRBase.V20
osa-miR2094-3pCAGAGCUGUGGCAUCCACGUCGmiRBase.V20
osa-miR2095-5pCUGAUAAUUUUACGAUGAAUAGmiRBase.V20
osa-miR2095-3pCUUCCAUUUAUGAUAAGUAUmiRBase.V20
osa-miR2096-5pUGCCGAUUUCCCCCUCGGGCGmiRBase.V20
osa-miR2096-3pCCUGAGGGGAAAUCGGCGGGAmiRBase.V20
osa-miR2097-5pAGAGAUGGGACGGGCAGGGAAGmiRBase.V20
osa-miR2097-3pUUCUCUUCUUCGUGUCGCAUUUmiRBase.V20
osa-miR2098-5pUCCCGUGGAGGCAGCCGAUGmiRBase.V20
osa-miR2098-3pCGGUUUGUCAAGCGGAGUGCmiRBase.V20
osa-miR2099-5pUGAAUAUGUUUGUACAAGCUUUmiRBase.V20
osa-miR2099-3pACAAAGCUGUAGCGUUAUUCmiRBase.V20
osa-miR2100-5pUUCUCUCAAGUUGCCAAACAAGmiRBase.V20
osa-miR2100-3pAACCGCUGUUUAGGCGGAGUGGmiRBase.V20
osa-miR2101-5pACAUGUUUACAAGUUAAAAUGUmiRBase.V20
osa-miR2101-3pAUUUAACUCAAGUGAGCAUUGUmiRBase.V20
osa-miR2102-5pGGGCAAGCCGCCGCCGCCACmiRBase.V20
osa-miR2102-3pCAUGGUGCCGGUUCCGGUGGCGmiRBase.V20
osa-miR396f-5pUCUCCACAGGCUUUCUUGAACUmiRBase.V20
osa-miR396f-3pAUAGUUCAAGAAAGUCCUUGGAAAmiRBase.V20
osa-miR2103UUUCCCUCUCCGUGCGCGCUCGmiRBase.V20
osa-miR2104GCGGCGAGGGGAUGCGAGCGUGmiRBase.V20
osa-miR2105UUGUGAUGUGAAUGAUUCAUmiRBase.V20
osa-miR2106CCGAGGUUUUCUGGAUACAUUmiRBase.V20
osa-miR2120AAAGAUCUUUAGUCCCGGUUGUUCmiRBase.V20
osa-miR2121aAAAACGGAGCGGUCCAUUAGCGCGmiRBase.V20
osa-miR2122UUUCAAAAAUAACCUUUUGUUCmiRBase.V20
osa-miR2118aUUCUCGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118bUUCCCGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118cUUCCCGAUGCCUCCUAUUCCUAmiRBase.V20
osa-miR2118dUUCCUGAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2118eUUCCCAAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2118fUUCCUGAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118gUUCCUAAUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118hUUCCUGAUGCCUCUCAUUCCUAmiRBase.V20
osa-miR2118iUUCCUAGUGCCUCCCAUUCCUAmiRBase.V20
osa-miR2118lUUCCUAAUGCUUCCCAUUCCUAmiRBase.V20
osa-miR2118oCUCCUGAUGCCUCCCAAGCCUAmiRBase.V20
osa-miR2118pUUCCCGAUGCCUCCCAUGCCUAmiRBase.V20
osa-miR2275aUUUGGUUUCCUCCAAUAUCUCAmiRBase.V20
osa-miR2863aUUGUCCCAUUCUAGUUUAGCUmiRBase.V20
osa-miR2864.1UUUUGCUGCCCUUGUUUUGCAmiRBase.V20
osa-miR2864.2UUGUUUUGCAUUGUAUAGGUAmiRBase.V20
osa-miR2865CUCAGCAGUCGACUGUACCGUGmiRBase.V20
osa-miR2866UCUAGUUUGUGUUCAGCAUCmiRBase.V20
osa-miR2867-5pUGUGCCAUCCCACACAUCCCGAmiRBase.V20
osa-miR2867-3pCCAGGACGUGUGGGAUGGCAmiRBase.V20
osa-miR2868UUGGUUUUGUGUAGUAGAAAmiRBase.V20
osa-miR2869UCCCGACAUUAAAUUCUGGGCmiRBase.V20
osa-miR2870UAAUCAGUUUGGGGAGACAAAmiRBase.V20
osa-miR2863bUUCGUUUAUUUGGACUAGAGUmiRBase.V20
osa-miR2905UACAUGUCAGUGACAAAGGCAmiRBase.V20
osa-miR2871a-5pGACCGUAGAAACUAGCAUAGAAAAmiRBase.V20
osa-miR2871a-3pUAUUUUAGUUUCUAUGGUCACmiRBase.V20
osa-miR2872UGGGGUUCUACAAACCGAACUmiRBase.V20
osa-miR2873aAAGUUUGGACUUAAAUUUGGUAACmiRBase.V20
osa-miR2874AUGUGAACAGUGUCAAACAGUGUCmiRBase.V20
osa-miR2875AUUUACAGUCAUAUACAGUUUAUAmiRBase.V20
osa-miR2876-5pAAUUGCUGGCAGCACUGUUUAmiRBase.V20
osa-miR2876-3pUUCCUAUAUGAACACUGUUGCmiRBase.V20
osa-miR2877UUGCAUCCUCUGCACUUUGGGCCUmiRBase.V20
osa-miR2878-5pUACAUGUAUAAAAUUCUGAGGAUGmiRBase.V20
osa-miR2878-3pCAGGAUUUUAUACAUGUAAAGAAUmiRBase.V20
osa-miR1863cUAGAAACUUGGCUGAUGCAUUACUmiRBase.V20
osa-miR2879GCCAGAUGUGUUAAAAUAAUGACCmiRBase.V20
osa-miR2880ACGGUAUCCCGUUCGGACAGGAUGmiRBase.V20
osa-miR396gUCCACAGGCUUUCUUGAACGGmiRBase.V20
osa-miR1863bAGCUCUGAUACCAUGUUAACUGUUmiRBase.V20
osa-miR1863b.2AGAGACUUGGCUGAUGCAUUACUmiRBase.V20
osa-miR2907aGGCAGCCGAGCGAGGGCCUCGGmiRBase.V20
osa-miR2918AUCCGUGUUGUCUGCGCUUUAmiRBase.V20
osa-miR2919AAGGGGGGGGGGGGAAAGAmiRBase.V20
osa-miR2920AAACAACAAUAUAACAUUUCAAAmiRBase.V20
osa-miR2921AAGAACUUAAUAUAACUUUAAAGCmiRBase.V20
osa-miR2922AAUAAGUGAUUACCGAAAUUmiRBase.V20
osa-miR2923AGACAAAAAUAUAAAUAACAAAmiRBase.V20
osa-miR2924CUCGCUUGCUCCGGCCGCCACmiRBase.V20
osa-miR2925UGGCGGCCGCGGGCUUCGUmiRBase.V20
osa-miR2926AGGUCGUCGACGUUGGUGCUmiRBase.V20
osa-miR2927UGUCGUCGUCGAUGGAGCCCAUGmiRBase.V20
osa-miR2928AAGAAGACGACAUUUUGUUGmiRBase.V20
osa-miR2929CUCAAGGGUGUUUGUGAAAUAmiRBase.V20
osa-miR2930UUCUCUUCUCUCGCGCGUGGCCmiRBase.V20
osa-miR2931CUUUAUUGUUGAUGUCAAAAmiRBase.V20
osa-miR2932AGUAUGCCCACUACCUAUCmiRBase.V20
osa-miR395xGUGAAGUGUUUGGAGUAGCUCmiRBase.V20
osa-miR812kACGAACGGUUAAAGUUGGACGCGGmiRBase.V20
osa-miR1862fAUGAGGUUGGUUUAUUUUGGmiRBase.V20
osa-miR3979-5pUCUCUCUCUCCCUUGAAGGCmiRBase.V20
osa-miR3979-3pCUUCGGGGGAGGAGAGAAGCmiRBase.V20
osa-miR3980a-5pAAUCGACGGCCUCAGUCAGGGmiRBase.V20
osa-miR3980a-3pCUGGCCGAGGCCGUCGAUUCUmiRBase.V20
osa-miR812n-5pAAGUGCAGCCAUGAGUUUCCGUGCmiRBase.V20
osa-miR812n-3pACGGAAAAUCAUGGCUGCACUUAAmiRBase.V20
osa-miR812o-5pCGUGUUCAACGUUUGACUGUCmiRBase.V20
osa-miR812o-3pGAACGGUCAAAUGUUAGACACGGAmiRBase.V20
osa-miR3981-5pUGGGACGUAUCCUAUUACUAUmiRBase.V20
osa-miR3981-3pAGUAUUAGGAUACGUCUCAUCmiRBase.V20
osa-miR2873bUUGGACUUGAGAUUUGGUAUGmiRBase.V20
osa-miR3982-5pGCGCUCCACGUAGGCAACAAUmiRBase.V20
osa-miR3982-3pAGUUGCCUACAUGGAGCGCCAmiRBase.V20
osa-miR5071UCAAGCAUCAUAUCGUGGACAmiRBase.V20
osa-miR5072CGAUUCCCCAGCGGAGUCGCCAmiRBase.V20
osa-miR5073GUUUGGUGAAUCGGAAACUAUUUmiRBase.V20
osa-miR5074GAAGGCCACCGUCGGGAUCGCmiRBase.V20
osa-miR5075UUCUCCGUCGCCGCCGUCCGCmiRBase.V20
osa-miR5076GAAAUGGGAGCAGAGCAGGUUUmiRBase.V20
osa-miR5077GUUCGCGUCGGGUUCACCAmiRBase.V20
osa-miR5078CCUCGUUCGACCGUGGCAUUUmiRBase.V20
osa-miR5079aUUUGGAUCUGUUAUUUUGGUAUmiRBase.V20
osa-miR5080AAAAGGAUCAUACCGUGACAGmiRBase.V20
osa-miR5081UAAUUUGUAGCAAAUUGAUAGUmiRBase.V20
osa-miR5082UGCGAUGAUGGCCGCGCGGGUUCAmiRBase.V20
osa-miR5083AGACUACAAUUAUCUGAUCAmiRBase.V20
osa-miR5143aUGUGGUAUGUUGGCAAUGUAGGAAmiRBase.V20
osa-miR5144-5pUUCUUGUGCUGCUGAAGAGACmiRBase.V20
osa-miR5144-3pUCUCCUCAGCAGCACAAGAAGmiRBase.V20
osa-miR5145ACCUGUUUGGAUUCUUGAGGGCUAmiRBase.V20
osa-miR5146UUUAACUAAUGAACCGGCACCUAUmiRBase.V20
osa-miR5147ACAACUCUUGUGGAUGGAGGGmiRBase.V20
osa-miR2863cUUAGUAGGACUAGAAUGGGCCAAAmiRBase.V20
osa-miR5148aUGAGGGGUAGAAAUGUCAUAUCAUmiRBase.V20
osa-miR5149GAGGAGCUGUGACGAUUUGGGAmiRBase.V20
osa-miR5150-5pAGCUUCUGACAGCUGCAGUUUCUCmiRBase.V20
osa-miR5150-3pAGAAGCUGCAGCUGUCAGAAGCUCmiRBase.V20
osa-miR5151UAAUGAUGUGGGUACGAAUGAAmiRBase.V20
osa-miR5152-5pGUAGGGAUAGGCAUGAUCUCUmiRBase.V20
osa-miR5152-3pAGACCAUGCCUAUACCUACCAmiRBase.V20
osa-miR5153UGGAUUCCACUGACACGUAGACGUmiRBase.V20
osa-miR5154AGCACCAGUUGACGUGACGCUGAGmiRBase.V20
osa-miR5155ACUUUAAUACCAUUGGAAGAUUGCmiRBase.V20
osa-miR5156AGCCUGUAAAACUGCAAAAAGGAAmiRBase.V20
osa-miR5157a-5pAACUUUUUAAUAGCUACAACUUCUmiRBase.V20
osa-miR5157a-3pAGAAGUUGUGGCUAUCAAAAAGUUmiRBase.V20
osa-miR5158UGAGCCACUGGGAUGAGGAUGAAUmiRBase.V20
osa-miR5159AACUAGAGUGGGUCAACGGGUACCmiRBase.V20
osa-miR5160CGAGAUCGAUGGUAUAUUUCUGmiRBase.V20
osa-miR5161UCUGGAUCAGAGGGAGUAUAmiRBase.V20
osa-miR5162AAAUGACCAAAAUACCCCUAGAACmiRBase.V20
osa-miR5337aAAAUUACUUGUCGUUCUAGCUmiRBase.V20
osa-miR5338UGAAGCUUCAGUUGGUUGUAUmiRBase.V20
osa-miR5339CAGAUAGAGAAUCUUCUCAGAmiRBase.V20
osa-miR5340UGAUGACGUGGAUGAAUUUCAAAmiRBase.V20
osa-miR5484AACCGAGCGCGCUGUUGAUUAmiRBase.V20
osa-miR5485UGACAACUGGUAGCAGAGCAAmiRBase.V20
osa-miR5486AGGGGCUUGCAUAUUCUACCAmiRBase.V20
osa-miR5487AAAGAUGUGCAUGUAGUUCCGmiRBase.V20
osa-miR5488UGAAGGCGACUGAUGAUUUCAmiRBase.V20
osa-miR5489CAGGUGUUCUCGAUGGCUUCCmiRBase.V20
osa-miR5490UUGGAUUUUUAUUUAGGACGGmiRBase.V20
osa-miR5491UGAAAUGGAGGCUCGUUGUACmiRBase.V20
osa-miR5492AGAAGGAGAAUAGAUAUGGUUmiRBase.V20
osa-miR5493AGCCGGGCUCGGUCGCGCGUGmiRBase.V20
osa-miR5494UUAUAGGAGGUAUAGACGGUAmiRBase.V20
osa-miR5495AGAGGUCCGGAUCGAACGUAGmiRBase.V20
osa-miR5496CCAGCCGGUGGCAUAGUUCUCmiRBase.V20
osa-miR5497CAGAAUAUCUGGGACGAGCAUmiRBase.V20
osa-miR5498UGAGCUGUAACACUUGAAGACmiRBase.V20
osa-miR5499GAAGGAAGAAUCGUUAUGGAAmiRBase.V20
osa-miR5500AUCACUGAUGAAAUCUUGCGGCmiRBase.V20
osa-miR5501UCUUGUGGCUAGAAGGGUGAGmiRBase.V20
osa-miR5502UACGGAUACGGAUACGCGAUACmiRBase.V20
osa-miR5503UUCGGAUCUUUCUAGAGGCAUUmiRBase.V20
osa-miR5504AGUGACGGGAGGACUGCAAGGmiRBase.V20
osa-miR5505GAGGAUUCGGUAUUGAUCGCUAmiRBase.V20
osa-miR5506UGGAUCGCUUCGUCUGAUGGUmiRBase.V20
osa-miR5507AAUGAGAAUGAUGACCCGGUGmiRBase.V20
osa-miR5508UAGAUGGCUGAUCUGGUGUGGmiRBase.V20
osa-miR5509UAGGCAUUUUCUCUUGGCAUGmiRBase.V20
osa-miR5510AGGCUGAUCCACUCCAGAGGAmiRBase.V20
osa-miR5511CAUAUCCCAGCUGUUUCGGCCmiRBase.V20
osa-miR5512aUAGGAUAUGGUAAUGCUAAAAmiRBase.V20
osa-miR5513UAACAAAGGACAACAGACUGAmiRBase.V20
osa-miR2275cAGAAUUGGAGGAAAACAAACUGAmiRBase.V20
osa-miR5514UCCCAGAGCUUUGGCCGUCGCmiRBase.V20
osa-miR5515CCGAUGGUUGUUCUACAGGUGmiRBase.V20
osa-miR5516aCUCAUUGCUUCGGUAGGCUGGmiRBase.V20
osa-miR5517UGCAUCACGGCGCAUAUGUAGmiRBase.V20
osa-miR5518AUACUCAAACAGGGCAUUGCAmiRBase.V20
osa-miR5519UGGCAGAAGUACUGGACUUAGmiRBase.V20
osa-miR5521AGUGGCUGCAUAUCUGAUGAGmiRBase.V20
osa-miR5522AACAAUAGGAAUGGGAGGCAUmiRBase.V20
osa-miR5523UGAGGAGGAACAUAUUUACUAGmiRBase.V20
osa-miR2275dCUUGUUUUUCUCCAAUAUCUCAmiRBase.V20
osa-miR5524UGGAAAAUGUGUUCAUGACGGmiRBase.V20
osa-miR5525UGAACCUUGGGAGCGAUCUGAAmiRBase.V20
osa-miR5526AAAGGUAGAGUCAGGUAUGAGmiRBase.V20
osa-miR5527UCUCAGCCAGGGCAGUAACAGmiRBase.V20
osa-miR5528AAGACGGUUUUAGAUGUUGCCmiRBase.V20
osa-miR5529GUUUCAUCCAUGGACACCGCAmiRBase.V20
osa-miR5530AGUGGUGUCGUAUUACCUGCCmiRBase.V20
osa-miR5531ACUGACUGCCUUGAGCUCCGGGmiRBase.V20
osa-miR5532AUGGAAUAUAUGACAAAGGUGGmiRBase.V20
osa-miR5533CUUUGCCAGAAGCCCUCAUGGmiRBase.V20
osa-miR5534aUGACGACAACAGCUAGAAUGGmiRBase.V20
osa-miR5534bCGAUGACAACAGCUAGAAUGGmiRBase.V20
osa-miR5535UCUGCGUGAUUGAAGUCUGCAUmiRBase.V20
osa-miR5536AAUGGUAGUGACAUUAUGGUAGmiRBase.V20
osa-miR5537AAUGUUUGUAUGGAUCGUUUGUmiRBase.V20
osa-miR5538ACUGAACUCAAUCACUUGCUGCmiRBase.V20
osa-miR5539aAAGAAAACGGAUGCGCGUGCUAmiRBase.V20
osa-miR5540UUGUGCGAGAUCGACGGUAUAmiRBase.V20
osa-miR5541UCAAGUGGUGUACUCUAAAGAmiRBase.V20
osa-miR5542UUUGAGAAGGUAUCAUGAGAUmiRBase.V20
osa-miR5543UAUGAAUGGUAUAUUUUCUUGmiRBase.V20
osa-miR5544AGAACACGGAGUAGAAGUUGGUmiRBase.V20
osa-miR5788UGGAUGUGACAUACUCUAGUAmiRBase.V20
osa-miR812pGACGGACGAUUAAAGUUGGGCAUGmiRBase.V20
osa-miR812qACGUUGGGUACGAAUAUCUACGGCmiRBase.V20
osa-miR5789UGACUGAGCUUCGUUCGGUAUmiRBase.V20
osa-miR5790AAGACGAUCCUAGCAGAGCUUCAUmiRBase.V20
osa-miR5791UUGCAGGAGACUAGAGACCAGmiRBase.V20
osa-miR5792GAUGACAGCGGUGGUUCGGACAUCmiRBase.V20
osa-miR5793CGAGGACGAGAUACAGUGCAGmiRBase.V20
osa-miR5794UGAGGAAUCACUAGUAGUCGUmiRBase.V20
osa-miR812rACGUUAGACACGAAUUUCUACGGCmiRBase.V20
osa-miR5795AUGUCGAGGUCGAGUUCCCGGCmiRBase.V20
osa-miR5796UCAUUCAGGAUUGAAGCCGCCmiRBase.V20
osa-miR5797UCGUGGGAUUUAUGCAGUUAAmiRBase.V20
osa-miR5798CUGGACUACAAGAUCCCGGAUmiRBase.V20
osa-miR812sAAGACGGACAAUCAAACGUUGGACmiRBase.V20
osa-miR5799AAGACGAAUAAUCAAACGUUGGACmiRBase.V20
osa-miR5800CCCGGCUAUCGGAACGGCUGCmiRBase.V20
osa-miR5801ACCAAAUCGUUUUCGAUCGUUGGAmiRBase.V20
osa-miR5802AUGGACUGUACUUUGUAAAGCGGAmiRBase.V20
osa-miR5803ACCACUGUAGACGCUACGUGUGAGmiRBase.V20
osa-miR5804UGCGAAGUAGAGAUGCCGACUmiRBase.V20
osa-miR5805ACGAGUGAUGGCGGCGUAUACCUGmiRBase.V20
osa-miR5806ACAGGCAAAGACAAUGACGGCmiRBase.V20
osa-miR812vAUGGCUGCACUUAAAAUGGGACGGmiRBase.V20
osa-miR5807AGGAGGUCUGGAGAGUUAUGUGGCmiRBase.V20
osa-miR5808ACUAAAUCGUUUCUGAUCGUUGGAmiRBase.V20
osa-miR5809UCGUCGCCGGCGACCACAGCmiRBase.V20
osa-miR5810ACGGAACCCUAAUGGCGAUGGCAUmiRBase.V20
osa-miR5811CCUAACCUAGGAGUUCGAUGGGACmiRBase.V20
osa-miR5812AGCAACGAUUUUAAGAUUGUGGCAmiRBase.V20
osa-miR5813AAGCAGCGACUCUGGUCAUGGAmiRBase.V20
osa-miR5814AAUCAAGUUAGGAACCAUGCAAGUmiRBase.V20
osa-miR5815AAUGUUAUGGACACUAGAUGACAUmiRBase.V20
osa-miR5816UAGGAGUGUUUGUAGGAGCGCCACmiRBase.V20
osa-miR5817AUCGAAUUUGAAAGAAAAAGGUAUmiRBase.V20
osa-miR5818UCGAACUAGAAGGGCCAGGUUmiRBase.V20
osa-miR5819AGGACGAGGGGAACGGCGGCGmiRBase.V20
osa-miR5820UGGCAGAGAUUGAUCGAGGAAmiRBase.V20
osa-miR5821UGGACGGAGCGAUGGUGGGCGmiRBase.V20
osa-miR5822UGUCUGCUCGAUGUCAGGUUGmiRBase.V20
osa-miR5823AAGGAAUUGGGUCUAAUCUCUUCCmiRBase.V20
osa-miR5824AGUCUGAUAAGAAGUCAAUGGCGUmiRBase.V20
osa-miR1319bCCUUUAAUAUAUUAUAGGUGUCGGmiRBase.V20
osa-miR5825AAAACAUCUGAUAACCUGAAACGGmiRBase.V20
osa-miR5826UAGCCCAAAGUGAGAAGAGUGGGUmiRBase.V20
osa-miR5827UUUGUUGCAAUUUGGACUACCmiRBase.V20
osa-miR5828UUACGGCAUUAAAAGUAAAUCmiRBase.V20
osa-miR5829AUCAGGACCAGUAGGCGAUGGUAAmiRBase.V20
osa-miR5830AUGUAGAUGAGGUGAUGUUACACAmiRBase.V20
osa-miR5831UAGUCAAACUUAGAAUAGUUGGACmiRBase.V20
osa-miR5179UUUUGCUCAAGACCGCGCAACmiRBase.V20
osa-miR5832UUGGCGGAGCGGUUGCUGUCAmiRBase.V20
osa-miR5833UCCUCCUCGGGCUCAUCGGGCmiRBase.V20
osa-miR5834ACGGAUGUAGAAAUUGGUGAUmiRBase.V20
osa-miR5835ACGAAACCAUAGGGAUUUUGGCAUmiRBase.V20
osa-miR2873cCAAAUGAAGUUGAGUUUGGACmiRBase.V20
osa-miR5836UGAGCAGCCGGACCAUGGGAUmiRBase.V20
osa-miR5837.2GGUGAUGUGGAGCGUUCGGCAmiRBase.V20
osa-miR5837.1AUGUUGGAAUGACAUGCAGCUmiRBase.V20
osa-miR6245AGUAUAGGUGUCGGCUCUAUUmiRBase.V20
osa-miR1440bUUUAGGAGAGUGGUAUUUGAGmiRBase.V20
osa-miR6246UUGGGGAUUUCCUGCCGGAGGAAmiRBase.V20
osa-miR6247UGGCUGAUUGACCUAAUGGCAmiRBase.V20
osa-miR6248UAUUUGAGGAUGGAGGUAGUAmiRBase.V20
osa-miR5337bCUAGAACGGCAAGCAAUUUGAmiRBase.V20
osa-miR6249aCGUGAAGAGCUCGCCGGCGGCmiRBase.V20
osa-miR6250GGGGAUAGAUCGACGCGUCAAGmiRBase.V20
osa-miR6251UGUGUAGCCACAUUGUAAGGGmiRBase.V20
osa-miR6252AUUCGUUGUAUUAAGAGAGGGUUmiRBase.V20
osa-miR6253GAGGAAAGUGGGCAGUUGGGUUmiRBase.V20
osa-miR6254UGCUCCGGAUAUUAUGGCAUGmiRBase.V20
osa-miR6255UGGGAAAAAUGGGCAGUUGAGUmiRBase.V20
osa-miR6256GUAGUACUCGGUUGUAGGUGUAmiRBase.V20
osa-miR818fGGGAGCAUGUAGGAUGGCCAUmiRBase.V20
osa-miR1437b-5pGGGAGGAAACAGUGCCUAGUGmiRBase.V20
osa-miR1437b-3pGUGCUGGCGAGCUCCGGUGCCGCAmiRBase.V20
osa-miR7692-5pGAUCCAAAAAAGUGCCACGUGAGCmiRBase.V20
osa-miR7692-3pUGACUUGGCAUGCUUACGUGGCACmiRBase.V20
osa-miR7693-5pGUUUCCGCUCUUCAUCGAUGGCUGmiRBase.V20
osa-miR7693-3pGACGUCCAUCGAUGAAGAGCGAmiRBase.V20
osa-miR7694-5pAACCUAGUACUGGAUUAGUCACCAmiRBase.V20
osa-miR7694-3pCCAUAUUCGUAGUGCUAGGUGGmiRBase.V20
osa-miR7695-5pUGCCUAUGUGGCACGCCACGUGAAmiRBase.V20
osa-miR7695-3pACGUGAUGUGCCACGUAGGCAmiRBase.V20
osa-miR1317UAGGGAACCCCAUUCCCAUAAAPMRD
osa-miR1318UCAGGAGAGAUGACACCGACPMRD
osa-miR1423-3p.2AGCGCCCAAGCGGUAGUUGUCUCCPMRD
osa-miR1423bCAACUACACGUUGGGCGCUCGAPMRD
osa-miR1429-3p.2GUUGCACGGGUUUGUAUGUUGCAGPMRD
osa-miR1429-5p.2GUAAUAUACUAAUCCGUGCAUCCAPMRD
osa-miR156oUGACAGAAGAGAGUGAGCAUPMRD
osa-miR156pUGACAGAAGAGAGUGAGCUCPMRD
osa-miR156qUGACAGAACAGAGUGAGCACPMRD
osa-miR156rUGACAGAAGAGAGAGAGCACPMRD
osa-miR163mUGAAGAGGACUUGGAACGUUCPMRD
osa-miR168aQCCCGCCUUGCACCAAGUGAAUPMRD
osa-miR172mAGAAUCCUGAUGAUGCUGCAGPMRD
osa-miR1849.2AAUGCCCUAUCGUAUCCUAGGUUGPMRD
osa-miR1857-5p.2UGGAGCAUGAGGUUAUCUCUCPMRD
osa-miR1867UUUUUUUUCUAGGACAGAGGGAGUPMRD
osa-miR1868.2AAGCGUGCUCACGGAAAACGAGGGPMRD
osa-miR1873.2ACCUCAACAUGGUAUCAGAGCUGGPMRD
osa-miR1873QUCUAGCUCUGAUACCAUGUUGAGUPMRD
osa-miR1884aUGUGACGCCGUUGACUUUUCAUPMRD
osa-miR1884bAAUGUAUGACGCUGUUGACUUUUAPMRD
osa-miR2123aUAAAAAGUCAACGGUGUCAAACPMRD
osa-miR2124aACUUUAAAUGUGUGUCCGUAUAUUPMRD
osa-miR2125UUUUUCUCUAUAGACUAUCUCCAGPMRD
osa-miR2862UCCAACAGCUUAGAUUCGUCCPMRD
osa-miR2876.2UCCUAUAUGAACACUGUUGCCAGCPMRD
osa-miR2906aAACGGGCCGCCGCACUGCUGGPMRD
osa-miR395a.2UGAAGUGCUUGGGGGAACUCPMRD
osa-miR396eQGUUCAAGAAAGCCCAUGGAAAPMRD
osa-miR396fQGUUCAAGAAAGUCCUUGGAAAPMRD
osa-miR397a.2UUGAGUGCAGCGUUGAUGAACPMRD
osa-miR420UAAAUUAAUCACGGAAAUGAUPMRD
osa-miR437-3p.2AAAGUUAGAGAAGUUUGACUUAGGPMRD
osa-miR437-3p.3AGAAGUUUGACUUAGGACAAAACUPMRD
osa-miR441aUACCAUCAAUAUAAAUGUGGGAAAPMRD
osa-miR442UGACGUGUAAAUUGCGAGACGAAUPMRD
osa-miR445aUAAAUUAGUGUAUAAACAUCCGAUPMRD
osa-miR446CAUCAAUAUGAAUAUGGGAAAUGGPMRD
osa-miR5520GGCUAGUACAUUGGGUAGGCAPMRD
osa-miR806aAUGUGCUAAAAAGUCAACGGUGPMRD
osa-miR807aCGUCAUCUCACAGGUGAAUCCPMRD
osa-miR808AUGAAUGUGGGAAAUGUAAGAAPMRD
osa-miR809aUGAAUGUGAGAAAUGUUAGAAUPMRD
osa-miR811aACCGUUAGAUCGAGAAAUGGACGUPMRD
osa-miR813GGGUUAUGGAAUGGGUUUUACCPMRD
osa-miR819aUCAGGUUAUAAGACUUUCUAGCPMRD
osa-miR820a-5p.2UCGGCCUCGUGGAUGGACCAGGAGPMRD
osa-miRf10000-akrAGAGGAUAUCCCCUCGAGGGAUGAPMRD
osa-miRf10001-akrGAGGGGAUAUUCCCUCAAGGPMRD
osa-miRf10002-akrAGGAUGCCACAUUCUCAUCCPMRD
osa-miRf10003-akrGAUCUUUAGUCCCGGUUGGUAAPMRD
osa-miRf10004-akrAACUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf10005-akrUCCCGGUUGGACAACCGGGACUAAAPMRD
osa-miRf10006-akrAGUCCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf10007-akrCAUCUUUAGUCCCGGUUCGAPMRD
osa-miRf10008-akrGAUAUCUUUACUCCUGGUUGPMRD
osa-miRf10009-akrCUCUUAAGACGCUGCUUGCAPMRD
osa-miRf10010-akrUCCCGGUUGUUGAGAACAACCGGGAPMRD
osa-miRf10012-akrACGGGCUCACCAUUGCAGGAGGAAUGPMRD
osa-miRf10013-akrGGAGUUGGCCGUUUGCCUGCPMRD
osa-miRf10014-akrAGUCCCGAUUGGUAACACCAACCGGPMRD
osa-miRf10015-akrCCGGUUGGUGUUACCAAUCGGGACUPMRD
osa-miRf10016-akrGGCUCACCAUUGCAGGAGGAAPMRD
osa-miRf10017-akrAGUCAUCUGUGACGGGUUAGPMRD
osa-miRf10018-akrUAGGAUGUGUCAUAUCCCACPMRD
osa-miRf10019-akrAAGAGAGGGGUUUCCUCGGAGPMRD
osa-miRf10020-akrCAGCGCCAGUUGACAUGGCGCUGAPMRD
osa-miRf10021-akrUCAGCGCCAUGCUAUUUGGCGCPMRD
osa-miRf10022-akrAUAAGGGAUCUUGGGUGGAUGUPMRD
osa-miRf10023-akrUCCCGGUUUUUUAUACCAACCGGGAPMRD
osa-miRf10024-akrUUGUACUAGGAUGUGUCCCAUCCPMRD
osa-miRf10025-akrGUACUAGGAUGUGUCCUAUCPMRD
osa-miRf10026-akrGUACUAGGAAAUGUCACAUCCPMRD
osa-miRf10027-akrAUGGCCAAAUGCUUUGGCUGPMRD
osa-miRf10029-akrUGCUUUGGCUGAUCAGCCAUPMRD
osa-miRf10030-akrAACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10031-akrCGCAGGCGGACCAGUUGUCCPMRD
osa-miRf10032-akrGCUGGAGCUCAGUCAAACAGPMRD
osa-miRf10033-akrGUGUUCGGCUGCAGCAGUGCPMRD
osa-miRf10034-akrUCGGUUGGUGUUACGAACCGGPMRD
osa-miRf10035-akrCCUGUGAAGAUGGAUCUUCGCAGGPMRD
osa-miRf10036-akrUUUGCAGGCGGACAGCUGGUCCPMRD
osa-miRf10037-akrUGGACCAGUUGUCCGCCUGUPMRD
osa-miRf10038-akrCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10039-akrAUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10040-akrCUGCAGCUACAGACAAGUUGCPMRD
osa-miRf10041-akrGACCUCUUAAGUGGUCUGCGPMRD
osa-miRf10043-akrUCAGCGCCACGCUAUUUGGCGCUGPMRD
osa-miRf10044-akrUGUCGAACUGCGUCAGUUCGACAGGPMRD
osa-miRf10045-akrGUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf10046-akrUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10047-akrAGUCCCGGUUGGUAACACAAACUGGPMRD
osa-miRf10048-akrCGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf10049-akrUCAUCAUCGCCGCCGAGUCCUCPMRD
osa-miRf10050-akrUAGUCCCGGUUGAAAAACCGGPMRD
osa-miRf10053-akrAAAACACGCUUUCGGGUAUGCPMRD
osa-miRf10054-akrGGUGUUACUAACCGGGACUAPMRD
osa-miRf10055-akrCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10056-akrUGGUAACUCCAACCGGGACUAAAGUUPMRD
osa-miRf10058-akrAUAGUCCCGGUUGGACAACCGGGAPMRD
osa-miRf10059-akrAACUUUAGUCCCGGUUGGUGPMRD
osa-miRf10060-akrGAAGACGAGGUUGGCGAUGCCGAPMRD
osa-miRf10061-akrUAUCGCUCCGUUUUCCGUGCPMRD
osa-miRf10062-akrCUCGAUCUUCGCUUGAAUGGCCPMRD
osa-miRf10063-akrUUGCCGCUGCUACCGCCUUCGPMRD
osa-miRf10065-akrCUGGUGCAGGAUGGCGCCGAUGCPMRD
osa-miRf10066-akrUCCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf10067-akrCAAUGGUCGUAUCCAUAGUAGCCAUGPMRD
osa-miRf10068-akrCCGUAGUAGCCAUGGUCACAUCAGUUCPMRD
osa-miRf10069-akrAGUAGCCAUGGUCACAUCAGUPMRD
osa-miRf10070-akrUGAUGUGAUCAUGGCUACUAPMRD
osa-miRf10071-akrACUCACAUGUUACGUGUGAGGPMRD
osa-miRf10072-akrACUCACACGUUACGUGUGAGGPMRD
osa-miRf10073-akrGAUGAGUCAUCUGUGACGGGCPMRD
osa-miRf10074-akrCCUGUCGAACUGCGGUAGUUCGACAGGPMRD
osa-miRf10075-akrUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf10076-akrUCCAGGAGUUGGGUUUGAAGUPMRD
osa-miRf10077-akrCCCGGUUGUUUAUACCAACCPMRD
osa-miRf10079-akrCUUCUUCCCGGUCAUGGGGUPMRD
osa-miRf10080-akrGAUCUUUAGUCCCGGUUGGUAAUPMRD
osa-miRf10082-akrCCCACGUGGGUUCUACGCUGAGUCAPMRD
osa-miRf10083-akrUAGGACCCACGUAGGCCCCACAUGUPMRD
osa-miRf10084-akrUUAGGGUUCCGUCCAUUCCAPMRD
osa-miRf10085-akrGGAUCUCUUAAGUGGUCCGCCUGPMRD
osa-miRf10086-akrCACGGCUGGCCUAUUAUGCCGCCGPMRD
osa-miRf10089-akrUCCGUCCCAUAAUGUUGCAACPMRD
osa-miRf10090-akrGAUGAUCUUUAGUCCCGGUUGPMRD
osa-miRf10091-akrUAGUCCCGGGUGGUAACACCAACPMRD
osa-miRf10092-akrCAUGGUACCUUCUCAAGGACPMRD
osa-miRf10093-akrCUCGGGUCCACAUGUCAGCCPMRD
osa-miRf10094-akrACAUGUGGACCCGAGUGCCAPMRD
osa-miRf10095-akrUGACGUGGCGCUGAGGUGUCUAAPMRD
osa-miRf10096-akrCUUAGACACCUCAGCGCCAAAPMRD
osa-miRf10097-akrCACAGUUGCCAGAAGCUUUUPMRD
osa-miRf10098-akrAGGUGGGCCCCACGGGUCAGUGAPMRD
osa-miRf10099-akrUAGUACUCCCUCCGUCCCAAAAUPMRD
osa-miRf10100-akrAGGUAUCAGGACCUGAUAUCUPMRD
osa-miRf10101-akrGGUCUACAUGUCAGCCUCACPMRD
osa-miRf10103-akrACCUGGGUCCACAUGUCAGCCUCPMRD
osa-miRf10104-akrCAGCCGCAUGCGAAAAUAGGPMRD
osa-miRf10105-akrUUGGCCUCGUCGAAGAAGGAGAPMRD
osa-miRf10106-akrCCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10107-akrCCGCAUGCGAAGAUCGAUUUUCGCPMRD
osa-miRf10108-akrCUAAUGCCCGUCACUGAUGAGPMRD
osa-miRf10109-akrUCAUCUUUAGUCCCGGUUCGPMRD
osa-miRf10110-akrAACUUUAGUCCCGGUUGGUAPMRD
osa-miRf10111-akrGGUGACAGAAGAGAGUGAGCAPMRD
osa-miRf10112-akrCCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10113-akrUUGGUGUUACUAACCGGGACUAAAPMRD
osa-miRf10114-akrGAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10115-akrUAACACCAACCGGGACUAAAGPMRD
osa-miRf10116-akrGAAGGUCCCUCAACUUGUCAUCGPMRD
osa-miRf10117-akrUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf10118-akrUACAUUCCUUGAGGAGGUACCAUGPMRD
osa-miRf10119-akrACAGUCCUUGAGGAGGUACCAUGAGPMRD
osa-miRf10120-akrUGGUACCUCCUCAAGGACUGPMRD
osa-miRf10121-akrUCCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10122-akrACCACGUGGGCCCCACAAGUCPMRD
osa-miRf10123-akrCGGUGAUCCCUGUCAGAGGUAAPMRD
osa-miRf10124-akrGGCGCCGUUUAAGUGGUCCACCCGPMRD
osa-miRf10126-akrAACCUGAUCUUGCGUUAGCCGAUUCPMRD
osa-miRf10127-akrUGUUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf10128-akrGAGUGGCACGGUUCCAAUUUCCPMRD
osa-miRf10129-akrGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10130-akrGUGGCAAUGCCACAUGGACAUGPMRD
osa-miRf10131-akrUUAGUCCCGGUUGGUAACACCAACCPMRD
osa-miRf10132-akrGCGAGCUUCUCGAAGAUGUCGUUGAPMRD
osa-miRf10133-akrGGUGUUACCAACCGGGACUAPMRD
osa-miRf10134-akrCCGUUUGGUGUUACCAACCAGGAPMRD
osa-miRf10135-akrUCUCCCUCUGAAUGCAGUGUPMRD
osa-miRf10136-akrCAGCAAGUGCAGCUACUGCAPMRD
osa-miRf10137-akrGUAGCUGCACUUGCUGCAUAGPMRD
osa-miRf10138-akrAGUCCCGGUUAGUAACACCAACCGGPMRD
osa-miRf10139-akrAGAGAGGCUGGCACUGUCCUPMRD
osa-miRf10140-akrUAUGGUGGUGUUCAGCAGCAGCAUPMRD
osa-miRf10141-akrAUGCCCCUGUCCAGAUUCGUPMRD
osa-miRf10142-akrGGACAUGCCCCUGUCCAGAUPMRD
osa-miRf10143-akrCAUGCGGUUGCCCCAACCGCAUPMRD
osa-miRf10144-akrGGCGAGCUUCUCGAAGAUGUCGUPMRD
osa-miRf10145-akrCGUGAUACUCACGAGGUAUCAUGPMRD
osa-miRf10146-akrAUGUGGGCAAUGCUAGAAAGUPMRD
osa-miRf10147-akrCAUGGUACCUGUAGGUACCAGPMRD
osa-miRf10148-akrUGAUACCUGAUAGGUAUCACAPMRD
osa-miRf10149-akrUCUGAUACCUAACAGGUAUCACPMRD
osa-miRf10150-akrUCGUUGCCACUUGCCAGUUCPMRD
osa-miRf10151-akrUGGCUAUAUUUUGGGACGGAGPMRD
osa-miRf10152-akrCUUGUCCGCCUGCGAAAAUAUGPMRD
osa-miRf10153-akrUGCUGCUGCUGCAUGACGAGPMRD
osa-miRf10154-akrAAUGACUUACGUUGUGAAACGGAGGPMRD
osa-miRf10155-akrAUACUCCCUUCGUCCCAAAAAAPMRD
osa-miRf10156-akrGGUGUUACAAACCGGGACUAPMRD
osa-miRf10157-akrUAGUCCCGGUUUGUAACACCPMRD
osa-miRf10158-akrGCUGCCAAAGGAGAUUUGCCPMRD
osa-miRf10159-akrUCUGAUACCUCGCGGGUAUCACGUGAUPMRD
osa-miRf10160-akrGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10161-akrUCUCGGACGUCUAUUUCUCGAUCCAACPMRD
osa-miRf10162-akrCACAUGUCAGUGACCACGUCPMRD
osa-miRf10163-akrGUCAUGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf10164-akrUCUUCUCUUCUUCAGUGAGGGAGGCPMRD
osa-miRf10165-akrUGCUAGAAGCUCACCCAAACAGPMRD
osa-miRf10166-akrCUGCUAGAAGCUCCCCCAAAUAGPMRD
osa-miRf10167-akrGCUGUUUGGGUGAGCUUCUAGCPMRD
osa-miRf10168-akrAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf10169-akrAUCGAUCUUCGCAUGCGGCUGGGPMRD
osa-miRf10170-akrAGUCCCGGUUGAUAACACCAACCGGPMRD
osa-miRf10171-akrAGAAGAAGAUGUGACCCCUCPMRD
osa-miRf10172-akrUGUCCAGAUUCGUAGUGCUAPMRD
osa-miRf10173-akrCUUACAUUGUGAAACGGAGGGAGUAGPMRD
osa-miRf10174-akrUCUCGCGCAAUGGUUAUGCGAPMRD
osa-miRf10175-akrAAAAAACUUAACCUAGGAGGGGPMRD
osa-miRf10176-akrUAGGUAUCAGGUAUCAGGUACCAGPMRD
osa-miRf10177-akrUAACGAGCCAGCUCGGGUCGPMRD
osa-miRf10178-akrAGCACUGCAGCAGCUAUAGGPMRD
osa-miRf10179-akrUACUACUUCCUCCGUCCCAAAAUAUPMRD
osa-miRf10180-akrACUACUUCCUCCGUCCCAAGAUAUPMRD
osa-miRf10181-akrGAAGAUGUAGUUGCUGCUCCCUPMRD
osa-miRf10182-akrAUGUAGUUGCUGCUCCCUAAPMRD
osa-miRf10183-akrUCCCGGUUGAAAAACCGGGACUAPMRD
osa-miRf10184-akrGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf10185-akrCGUUGGUGUUGAGCACGGCGAPMRD
osa-miRf10186-akrUGGCCCACAUGUCAAUGGCAAAAPMRD
osa-miRf10187-akrCCGGUUGGUGUUACCAAUCGGGAPMRD
osa-miRf10188-akrUAGUCCCGAUUGGUAACACCAACCGGGAPMRD
osa-miRf10189-akrUUACUCCCGGUUGGUGUUACCPMRD
osa-miRf10190-akrUUUUUCCCGGUUGGUGUUACCPMRD
osa-miRf10191-akrGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10193-akrGCAUGUGUCCAAAGAUUCGAUGUPMRD
osa-miRf10194-akrCAUGUGUCCAAACAUUCGAUGUGAAAPMRD
osa-miRf10195-akrGCGUGUCACAUCAGGUAUACPMRD
osa-miRf10197-akrUUAGUUCCGGUUGGUGUUACCPMRD
osa-miRf10198-akrUAACUUUAGUCCCGGUUGGUGPMRD
osa-miRf10199-akrCACAGGUGAGUCAUCUGUGAPMRD
osa-miRf10200-akrGGUGAUACCUGUAAGGUAUCAPMRD
osa-miRf10201-akrAUGAAUGUGGGCAAUGCUAGAAPMRD
osa-miRf10202-akrGUACCUCGAGGUACCGGUACCPMRD
osa-miRf10203-akrCGUGAGGUACCGAUACCUCGAGPMRD
osa-miRf10204-akrGGGUAUGACAUGUGAGUCCCACCGAUPMRD
osa-miRf10205-akrGUAUGACAUGUGAGUCCCACPMRD
osa-miRf10206-akrCUACGCUGCCGGUCGAAGACCAGUCPMRD
osa-miRf10207-akrGACGAGUGGUCAAACAGCGCPMRD
osa-miRf10208-akrACGAUGGCUUGGGAGAUUUGCPMRD
osa-miRf10209-akrUGGGAACAGCUCUUGCGAACAPMRD
osa-miRf10210-akrCAAUAGCAGGCUAUAAGCCAGCUPMRD
osa-miRf10211-akrCUGUUUGGCACAGCUCCAGCUCPMRD
osa-miRf10212-akrAAAUCCCUUGUAUUAGGGGACGGAGPMRD
osa-miRf10213-akrGUAGUUGCUAGAAGCUCCUUPMRD
osa-miRf10214-akrGCAGCUGGCUACAUAUCUGUAGCCPMRD
osa-miRf10215-akrCUUGAGGAGGUAUCAUGAGGUACPMRD
osa-miRf10216-akrCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10218-akrUAUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf10219-akrUGAGGGACCUUCGGUGUACUPMRD
osa-miRf10220-akrUAGGAUGUGUCUCAUCCACCCAPMRD
osa-miRf10221-akrACAGCUGGCCUAUUAUGCCGCUGUUPMRD
osa-miRf10222-akrGCCGCCUCGACUCCUCUCUAPMRD
osa-miRf10223-akrCGACGUCGACGAUGAUGUCGUCGPMRD
osa-miRf10224-akrGGCUUCUUCAAGAAGGCCAGPMRD
osa-miRf10226-akrCCGGCGACCACCUCUUCUUCUCPMRD
osa-miRf10227-akrAUAGAGAGUGAGCACGCACAPMRD
osa-miRf10228-akrGCAUCUCUCAACUGCAAAACCGGGUPMRD
osa-miRf10229-akrGGCUGCACUUAUUUUGGGACGGAGPMRD
osa-miRf10230-akrGCGGGUCGUACGAAUCCGUCGUPMRD
osa-miRf10231-akrGAGAAACCAUCUUUCGUCGGUCGPMRD
osa-miRf10232-akrGAGAAACCAUCUUUGGUCGGUCGPMRD
osa-miRf10235-akrGUAGUGCUACGAUGUGUCACAUCPMRD
osa-miRf10236-akrGGCGUCAGCUAGGUUUGGGGPMRD
osa-miRf10237-akrUGCGGUCGCUUAAGUGGACCGCAPMRD
osa-miRf10238-akrAAGGUCCCUCAACUUGGCAUCGAGPMRD
osa-miRf10239-akrGUACGCUGAAGGUCCCUCAACUUGPMRD
osa-miRf10240-akrCUCAAAAGAUUCGUCUCGCGGUUUPMRD
osa-miRf10241-akrCCGGUUGGAGUUACCAACCGGGAPMRD
osa-miRf10242-akrGACCGUGCCAUUGAUGCCGGUPMRD
osa-miRf10243-akrGGUUCGUGGCUAACCCACUUACACCPMRD
osa-miRf10245-akrUCCUUGAGGUACCAUGAGGUAPMRD
osa-miRf10246-akrUAAGACUUUCUAGCAUUGUCCPMRD
osa-miRf10247-akrCGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10248-akrUCCGGUUGGUGUUAUCAACCPMRD
osa-miRf10249-akrCUUGCAUGCAUGCAGGCUAUPMRD
osa-miRf10250-akrCUGUCGAACUGGGGCAGUUCGACAGGPMRD
osa-miRf10251-akrGGAUUUUGGAGGGAUGUGACPMRD
osa-miRf10252-akrCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10253-akrAGUCCCGGUUAGUAACACCAACCGGGAPMRD
osa-miRf10254-akrCUCGUUAUCCUAACGAGCUUPMRD
osa-miRf10255-akrGGUGUUCUACACCUGGAGGUUCPMRD
osa-miRf10256-akrUAGCCCGCAGCUCUCCUCUCPMRD
osa-miRf10257-akrGGUAUCGGGUACCUGGUACCUPMRD
osa-miRf10259-akrGGAUAUACGGACACACAUUUPMRD
osa-miRf10260-akrCUUGAGGAGGUAACAUGAGGUACPMRD
osa-miRf10261-akrUUACCUCUGUCGUCACCUCCPMRD
osa-miRf10262-akrUGCAAUCGCCACAUCACGUCPMRD
osa-miRf10263-akrGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10264-akrCCUCACCUUUGACGGGUUCCPMRD
osa-miRf10265-akrCCGGUUAGUGUUACCAACCGGGAPMRD
osa-miRf10266-akrCCCGGUUGGUGUUAACAACCGPMRD
osa-miRf10267-akrGGCUGCUCUACAAGCUGCCUPMRD
osa-miRf10268-akrCUUGCAUGGAGUGCCAAACAPMRD
osa-miRf10269-akrCGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10270-akrGGGUCUAGAACCGGCACCUUPMRD
osa-miRf10271-akrUGACCUCAAAACCGGCACCUPMRD
osa-miRf10272-akrUCGACGAUGACGACGUCGUCGUCGPMRD
osa-miRf10273-akrUCGACGAUGACGACGUCGUCPMRD
osa-miRf10274-akrUUAUGGCCCGUCACAGAUGAGPMRD
osa-miRf10275-akrCCGGUGUUCUAGGACAGGAACUUPMRD
osa-miRf10277-akrCUGACGGUGGACACGAUGGUGPMRD
osa-miRf10278-akrAGGUAUCAUCCCGUCUGAACGPMRD
osa-miRf10279-akrGAUCUUUAGUCCCGGUUGUUPMRD
osa-miRf10280-akrGGUUAAGCGUGCUUGGCCUGPMRD
osa-miRf10281-akrGCACGCGUGGUUAGAUGACCPMRD
osa-miRf10282-akrCCCUGUCACAUCGAAUGUUUGGPMRD
osa-miRf10283-akrAAAGUGCACCGAAGGUCCCUCAAPMRD
osa-miRf10284-akrAAGGUCCCUUAACUUGUCAUCGAGPMRD
osa-miRf10285-akrCCGGUUGGUAACACUAACCGGGAPMRD
osa-miRf10286-akrCGUGUCCAGGUUCAUAGCCAGGAUUPMRD
osa-miRf10287-akrACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10288-akrCCGACAUAUGGAGCCCACAUGUCPMRD
osa-miRf10289-akrGCCCACAUGUCAUCCCCUCUCUPMRD
osa-miRf10290-akrUGCUGAUGCUGCUGCACAGCGPMRD
osa-miRf10291-akrCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10292-akrGCCUGCUAUUGUACCUGCUCPMRD
osa-miRf10293-akrGGUGUUUGGGAACAGGGACUAAAPMRD
osa-miRf10294-akrUUACCAACCGGGACUAAAGAPMRD
osa-miRf10295-akrGGUUGGUAACAUCAACCGGGAPMRD
osa-miRf10296-akrUCCCGGUUGGUAGUAACAACCGGGAPMRD
osa-miRf10297-akrCAAUGUCGUUGGCGCCGAGGAPMRD
osa-miRf10298-akrGAUGAUACCUAGAGGUAUCGCPMRD
osa-miRf10300-akrUGGUCCAUCAACAUCUCCUPMRD
osa-miRf10301-akrAUGCUGCAUCAGCAAACGCUPMRD
osa-miRf10302-akrGAAUACUCCCUCCGUCCCAAAAPMRD
osa-miRf10303-akrCGAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10304-akrGUCGCGAACUUGACGUCGUGCGPMRD
osa-miRf10305-akrUGGUACCUCCUCAAGGACAGUPMRD
osa-miRf10306-akrCUGUCCUUGAGGAGGUACCAUPMRD
osa-miRf10307-akrUGUCCAGCUUACAGUCUUCCUPMRD
osa-miRf10308-akrAGCGCCAAUAGCAUUGGCGCUGAGPMRD
osa-miRf10309-akrCUUGAGGAGGUACCAUGAGGUAPMRD
osa-miRf10310-akrUCUCGCAAAAUAGCCUCGAGGPMRD
osa-miRf10311-akrAAGCUCCUCUAAACAGGCCCPMRD
osa-miRf10312-akrUCAUGGUACCUCCUCAAGGACCPMRD
osa-miRf10313-akrCUUGAGAAGGUACCAUGAGAPMRD
osa-miRf10315-akrCGAGUAGUCCUUCGUAUUCUGCPMRD
osa-miRf10317-akrAAAUAAACGGGUGGACGUCCACUCGAPMRD
osa-miRf10318-akrAGCUCGAGUGGACGUCCACCPMRD
osa-miRf10319-akrGGUCGACGGCGUCGACGAUCCCPMRD
osa-miRf10320-akrGGCUUGUCCGCCUGCGAAAAUAPMRD
osa-miRf10321-akrUUAUACUCCCUCCGUCCCAAAAUAUPMRD
osa-miRf10322-akrGUAGUUAUACUCCCUCCGUCCCAAAPMRD
osa-miRf10323-akrCUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10324-akrCACGGCUGGCCUAUUAUGCCACCGUPMRD
osa-miRf10325-akrAAAACCGGGUAUAACACCUCCCCPMRD
osa-miRf10326-akrAAACCGGGAAUAACACCUCCCCPMRD
osa-miRf10327-akrGGGUAUAACACCUCCCCUAUCPMRD
osa-miRf10328-akrUUAGCCCCGGUUGGUGCUACCPMRD
osa-miRf10329-akrAGCUCCAACUCUAGCUCCACPMRD
osa-miRf10330-akrGAAUAAGUUCACCGGAGGUCCCUPMRD
osa-miRf10331-akrCUGCUGGUCAGACCGGCCUUAUPMRD
osa-miRf10332-akrUUGUCGCGUCCCAAAACGACUCUAPMRD
osa-miRf10333-akrUUGUCGCGUCCCAAAACGACPMRD
osa-miRf10334-akrCCAACGUUUGACUGUCCGUCUUAPMRD
osa-miRf10335-akrGAAGACUUGAUCAAGUCCCCCUAPMRD
osa-miRf10336-akrUUCUAGCAUUUCCCACAUUCPMRD
osa-miRf10337-akrUAGGUAUCAGGCCUGGUACCUPMRD
osa-miRf10338-akrCCUGCAGUAGGUGUCACUGAPMRD
osa-miRf10339-akrCCCUCUAAUUUGGGACGGAGGGAPMRD
osa-miRf10340-akrUCAAUCCUGCGAUUCAAAGGGGPMRD
osa-miRf10341-akrCCUGCGAUUCAAAGGGGGCCUUAGPMRD
osa-miRf10342-akrUUGGUGUUACCAACCAGGACUAPMRD
osa-miRf10343-akrCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10344-akrCAUCUAGGACGAGGAUGUGGPMRD
osa-miRf10345-akrAGGAUGAGGACGUGGCAUCCUPMRD
osa-miRf10346-akrAGUCCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf10347-akrUCCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10348-akrAGCGCCAAAUGGAUUGGCGCUGPMRD
osa-miRf10349-akrCAUCCGACUGGUUUCCAGUCGGGGGCUCPMRD
osa-miRf10350-akrUGCUCACCACGGCUUGCUUCPMRD
osa-miRf10351-akrGCCCAUCACAGGUAUCCCCUCAPMRD
osa-miRf10352-akrUGAGGGGAUACCUGUGAUGGGCCPMRD
osa-miRf10353-akrAGUCCCAGUUGGUAACACCAACCGGGAPMRD
osa-miRf10354-akrCACCAACCGGGACUAAAGAUCPMRD
osa-miRf10356-akrCGGUCCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10357-akrGUUCUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10358-akrUUCUUGAGGAGGUACCAUGAPMRD
osa-miRf10360-akrGGCUUAAGACGGCCACCAGCPMRD
osa-miRf10361-akrACAUCGUCGGCGUCAUCGUCGGCACPMRD
osa-miRf10362-akrGCUGGAGGAUGCGACGGUGCUPMRD
osa-miRf10363-akrUGGCACGGUGCCAGUUUCCCUPMRD
osa-miRf10364-akrUUGUUAGGGUUCCGUCCAUUPMRD
osa-miRf10365-akrAGCGCCAAUUUAUUUGGCGCUGAPMRD
osa-miRf10367-akrUUUCGGUCCCUCAAGUUGUCPMRD
osa-miRf10368-akrUUAGUCCCGGUUGGUAACACCAACPMRD
osa-miRf10369-akrCGGUUGGUGUUACCAACCGGGPMRD
osa-miRf10370-akrGAUUGGUAACACCAACCGGGACUAAAPMRD
osa-miRf10372-akrUCCCGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10373-akrGCGUGUCGCAUCGGAUAUACGGAPMRD
osa-miRf10374-akrUCUCCUUAUCGGCACCACUUPMRD
osa-miRf10376-akrAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10377-akrUGCUAGAAGCUCCCCCAAACAGUCPMRD
osa-miRf10378-akrGAGGUGUCUAAGUUCAGCGCPMRD
osa-miRf10379-akrAGAGCAGGUACAAUAGCAGGCUAUPMRD
osa-miRf10380-akrGGUCUGACCGGUGUCCGGUCUGACCGPMRD
osa-miRf10381-akrCCUCCGUCCCAAAAUAAGUGCAGPMRD
osa-miRf10382-akrGGUUGGUAAGAUCAACCGGGAPMRD
osa-miRf10383-akrUCCCUGUUGGUACUACCAACCGGPMRD
osa-miRf10384-akrCUGACCACAGUGUAGUGGCCAGPMRD
osa-miRf10385-akrAUGGUUUCGGCAGGUCCGGCCGAAAGGPMRD
osa-miRf10386-akrCCGGUGUUGUAGGACAGGAACUUPMRD
osa-miRf10387-akrUUCGCCGCGCGAGUCAUGAAPMRD
osa-miRf10388-akrGGGUGUAAGUGGCUAACCCGCGAAACCPMRD
osa-miRf10389-akrUACCGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf10391-akrCUAUUUUUGCAUGCGGGUGGCPMRD
osa-miRf10393-akrGGAAGUUCCGGUACAAGAACACCGGPMRD
osa-miRf10394-akrUCCAGGUUCGUAGCUAGAAGUUGPMRD
osa-miRf10395-akrUAAUGCCCGAUUGAGAUGACPMRD
osa-miRf10396-akrCGCGCUUUGAGUGAGCGAGAPMRD
osa-miRf10399-akrCAGCUGCUAGAAGCUCCCCCAAACAPMRD
osa-miRf10400-akrUAGUACUAGGAUGUGUCCCAUCPMRD
osa-miRf10401-akrUUACUCCCUCCGUCCCAAUAPMRD
osa-miRf10402-akrCUGCACCAUCCGCUUGUGGCUGUGPMRD
osa-miRf10403-akrUAGUCCCGGUUGGUAACACCPMRD
osa-miRf10404-akrCCCUAUCUUUAGUCCCGGUUGGPMRD
osa-miRf10405-akrUACCAACCGGGACUAAAGAUCUPMRD
osa-miRf10406-akrUAUGGGACGGAGGGAGUACAAPMRD
osa-miRf10407-akrCCGGUUGGUGUUACCAACCGGGACAAPMRD
osa-miRf10408-akrUUCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10409-akrUCCCGGUUGGUAACACCAAUCGGPMRD
osa-miRf10410-akrCCGAUUGGUGUUACCAACCGGGAPMRD
osa-miRf10411-akrAAUCCCGGUUGGUAACACCAAPMRD
osa-miRf10412-akrUGGGAUGGGUUGGUUCCAUCCPMRD
osa-miRf10413-akrGUGGUCCGUCUGCGAAAAUCPMRD
osa-miRf10414-akrAAGUACCGGUACCUCGAGAUAPMRD
osa-miRf10415-akrUCCCGGUUGGAAAACCGGGACUAPMRD
osa-miRf10416-akrCCUCCGUCCCAAUAUGUAGCAACPMRD
osa-miRf10417-akrAUCUUUAGUCCCGGUUGGUAUPMRD
osa-miRf10418-akrGGAUCUUUAGUCCCGGUUGAUAPMRD
osa-miRf10419-akrAUCCACUCGUCACAGGUGUCAAPMRD
osa-miRf10420-akrGUGGGGAUGUGACACCACCUPMRD
osa-miRf10421-akrUGUAUACUCCCUCCGUCCAAPMRD
osa-miRf10422-akrUAUAUGUAUACUCCCUCCGUPMRD
osa-miRf10423-akrGCCAGCCAGAUGGCUUGGCCAUPMRD
osa-miRf10424-akrUUUGGCCAGCCAGAUGGCUUGGPMRD
osa-miRf10425-akrGCUCCUUAAGUGGUCCACAUGPMRD
osa-miRf10426-akrGUUGGUAACACCAACCGGGACUPMRD
osa-miRf10427-akrGCAUGCGGUUGUGUUGCCCGCPMRD
osa-miRf10428-akrGGUUGGUAACAUCAAUCGGGAPMRD
osa-miRf10429-akrUACUUCCUCCGUUUCAUAGUGUAAGPMRD
osa-miRf10430-akrUGGUGACGUCACCGCUGACGUCAUCGUPMRD
osa-miRf10431-akrAGAUUCGUUGUACUAGGAUGUGUCPMRD
osa-miRf10433-akrCCGGUUGAUAACACCAACCGGPMRD
osa-miRf10434-akrCCCGGUUGGUAACACCAACCGPMRD
osa-miRf10435-akrUCCCGGUUGGUAACACUAACCGGPMRD
osa-miRf10436-akrCGGUUGGUAACACCAACCAGGAPMRD
osa-miRf10437-akrGCUCAAAAGAUUCGUCUCGCGGUUUPMRD
osa-miRf10438-akrUCCCGGUUGUUUAUACCAACCAPMRD
osa-miRf10439-akrCCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf10441-akrGAGCUGGAGCUGUGCCAAACGPMRD
osa-miRf10442-akrAUGAGCCGAGCUCGAGUAGCPMRD
osa-miRf10443-akrAGUCUACUCCCUCCGUCCCAAAPMRD
osa-miRf10445-akrUUGAGUCACUGACAUGUGGGACCCACPMRD
osa-miRf10446-akrGUAGCUAGCUAGCAAGCUCAUGGPMRD
osa-miRf10447-akrGCGUAGCUAGCUAGCAAGCUCPMRD
osa-miRf10448-akrUGGCGCUGAACUUAGAUACCUCAPMRD
osa-miRf10449-akrAGCUGCUCGAGCUUGGCUCGPMRD
osa-miRf10450-akrGUGUGUGUAUGACAGGUUGAPMRD
osa-miRf10451-akrUACUGCAUGUGCACUACUGCAPMRD
osa-miRf10452-akrCUGUCGAACUGCCCCUGUUCGACAGGPMRD
osa-miRf10453-akrCCUGGCCUCCAUGUAGCCGGUPMRD
osa-miRf10454-akrUGAUACCUCAGAGGUAUCGUCPMRD
osa-miRf10455-akrUGUUUGGUUGGAGGGACUAAPMRD
osa-miRf10456-akrUGAGGGGAUGUGACUCCUCCUPMRD
osa-miRf10457-akrUGUCCCAUCCUUGUCUAGGUUUUPMRD
osa-miRf10458-akrUCGUCGUCAUCGCCAUUGCCGCUGPMRD
osa-miRf10459-akrUCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10461-akrUUGAGCCGUGCCAAUAUCACPMRD
osa-miRf10462-akrGAUGAUGACGUUGUCGGUGAUGPMRD
osa-miRf10463-akrAGGAUGUGUCACAUCUAGUCPMRD
osa-miRf10464-akrGCCACGUCAGGGUCCAUGGCPMRD
osa-miRf10465-akrGAUGUCGAGGUUGAGCUCUGCCUCPMRD
osa-miRf10466-akrGGUUGGUGUUACUAACCGGGAPMRD
osa-miRf10467-akrAACACCAACCGGGAGUAAAGUUPMRD
osa-miRf10468-akrAGUCCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf10469-akrUCCCAUGUCAUCGUCCACGUCGUPMRD
osa-miRf10471-akrUGAGUAGCAAGGAACAGGUCPMRD
osa-miRf10472-akrUUGAGGAGGUACCAUGAGGUACPMRD
osa-miRf10473-akrGUAGUACUAGGAUGUGUCCCAUCCPMRD
osa-miRf10474-akrCGGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf10475-akrCAGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf10476-akrGACGAAUCUCAGACAUCCAUPMRD
osa-miRf10477-akrGCAGCUUCAUCUUCUCAUGGCAGPMRD
osa-miRf10478-akrGCCAUGAGAAGAUGAAGCUGCPMRD
osa-miRf10479-akrAGUGUCACAUCCCGUACUGAGPMRD
osa-miRf10480-akrCCGGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10481-akrUCGAUGGUGGCGUCGUAGUCCUUGPMRD
osa-miRf10482-akrUCCCGGUUGGUAACUCCAACCGGGACPMRD
osa-miRf10483-akrACGUGGGUCCCACUGGUCAGCGPMRD
osa-miRf10485-akrCCGGCCUGUACUUAUUGGGCPMRD
osa-miRf10487-akrUUUAGUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10488-akrCCGGUUGGUGUUACCAACCGPMRD
osa-miRf10490-akrGGAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf10491-akrGAGAGCGAGACGGUGCCGCAPMRD
osa-miRf10492-akrGUGAUACUUGCGAGGUAUCAUPMRD
osa-miRf10493-akrGCGUGAUACUUGCGAGGUAUCAGGUPMRD
osa-miRf10494-akrAGUACUAGCUAGUACUACCAPMRD
osa-miRf10495-akrAGCUCUAGCUCCAGCUUCACPMRD
osa-miRf10496-akrCGAUGAGCGCGAACAUGGUGGAPMRD
osa-miRf10497-akrCUCCGUCCCUAAAUAUAAGGGAUUPMRD
osa-miRf10498-akrCACGGUUACCACGGUUACCGCGPMRD
osa-miRf10500-akrAUCCUUUGAAUCAAAGGGCCPMRD
osa-miRf10502-akrGCUCGUUAUCCUAACGAGCUAGAPMRD
osa-miRf10503-akrAACUCGUCGGCGAUGAUGUGAUCPMRD
osa-miRf10504-akrGAUACCUCGUUGGUGUCAUGPMRD
osa-miRf10505-akrUUUGGCCAGCCGGAUGGCUUGGCPMRD
osa-miRf10506-akrGAACUGCCCCUGUUCGACAGGGPMRD
osa-miRf10507-akrUUGGUGUUCCCAACCGGGACPMRD
osa-miRf10508-akrACGAUGACGUAGCUGCCGUUPMRD
osa-miRf10509-akrCCGGUUGGUGUUACUAACCGGGACUAPMRD
osa-miRf10510-akrCAUGCGGUUGCCCCAACCGCAUGPMRD
osa-miRf10511-akrAUUAGGGCACCCACAAUGGUUAUCUGUAPMRD
osa-miRf10512-akrGAUAACCAUUGCAGGUGCCCUUAPMRD
osa-miRf10513-akrAUUAGGGCACCCACAAUGGUUAUPMRD
osa-miRf10514-akrCCAACGUUUGACUGUCCGUCUUAUPMRD
osa-miRf10515-akrCUGCUAGAAGCUCCCCAAAACAGPMRD
osa-miRf10516-akrGGACUGUUUGGGGGAGCUUCUGGCAPMRD
osa-miRf10517-akrCUCAAUGCCAACGUUAUUGGCGCPMRD
osa-miRf10518-akrCGCGAGACGAAUCUUUUGAGPMRD
osa-miRf10519-akrCUGCUAUUGCAGCAGCAGUAPMRD
osa-miRf10520-akrGUGCGCACAAUUUUGUCGGCGPMRD
osa-miRf10521-akrGUCAUCGAUGACAGGCUCAAPMRD
osa-miRf10522-akrUCUUUAGUCCCGGUUGGUGAPMRD
osa-miRf10523-akrGGUUGGUGAUACCAACCGGGAPMRD
osa-miRf10524-akrUUGACCCGUCUCAGGUGACUPMRD
osa-miRf10525-akrUCACAGGUGGGUCACCUGUGPMRD
osa-miRf10526-akrAACCGGGACUAAAGAUCAUCPMRD
osa-miRf10528-akrCCAGUCAGGGGCUCGUUGCUGGPMRD
osa-miRf10529-akrAGGCGAUGACCCAUGUAUACAPMRD
osa-miRf10530-akrGAAUCGACGAUGACCCAUGUAUACPMRD
osa-miRf10531-akrGAAUCGACGAUGACCCAUGUPMRD
osa-miRf10532-akrGACUGGUUCGAGAACCAGCGAGPMRD
osa-miRf10533-akrACCGGCCGUGCAAUGCCGGUPMRD
osa-miRf10534-akrUCUUUAGUCCCGGUUGGUGCPMRD
osa-miRf10535-akrAGCCGGUCUGACCGGUCGCCGGUCUGAPMRD
osa-miRf10536-akrGGUCUGACCGGUCGCCGGUCUGACCAPMRD
osa-miRf10537-akrUUCCGACUGGUUUCCAGUCGGUGGCUPMRD
osa-miRf10539-akrGAGACCUCUUCCUAGGCCUUPMRD
osa-miRf10541-akrUCAGCGCCAAAUACAUUGGCGCUGAPMRD
osa-miRf10543-akrUCCCGGUUGGUAACAACAACCGGAAPMRD
osa-miRf10544-akrGGCACCGUGGUAUAAACCGGGAAPMRD
osa-miRf10545-akrGGUUGGUGAUACCAACCGGGAGUPMRD
osa-miRf10546-akrUUUCAACCGGGGCUAAAGAUCPMRD
osa-miRf10547-akrAAGGCAACCUAGGAGGGGAUGUGAPMRD
osa-miRf10549-akrGUCAUCUCAAUCGGGCCUAAAPMRD
osa-miRf10551-akrCGCCUGCGAAAAUCGAUCUUCGCAPMRD
osa-miRf10552-akrUUUAGUCCCGGUUGGUGAGAPMRD
osa-miRf10553-akrAAAGAUGGUUUCUCCACCAGUGUPMRD
osa-miRf10554-akrAUGGUUUCUCCACCAGUGUACPMRD
osa-miRf10555-akrUCCGGUUGGUAUCACCAACCPMRD
osa-miRf10556-akrCGGCUCGUUAUCUAAACGAGCPMRD
osa-miRf10557-akrACUCAUCUGUGACGGGCAUUPMRD
osa-miRf10558-akrGAGCCUCAUAGUUGCCGGCUPMRD
osa-miRf10559-akrCGGUCAGACCAGCCUGAUGGCPMRD
osa-miRf10560-akrACUUUAGUCCCGGUUGGUGUUAUPMRD
osa-miRf10562-akrAGCGCGGCAAGCUCUAGCUUPMRD
osa-miRf10563-akrCGAAGCCACGAAGGUUGAGCUPMRD
osa-miRf10564-akrUGCCGACUGGUUUCCAGUCGGGGGCUGPMRD
osa-miRf10565-akrGUUCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10566-akrGAUGAGUCAUCAGUGACGGGCUPMRD
osa-miRf10568-akrACUUACUCCCUCCGUCCCAAAAUAAAUPMRD
osa-miRf10569-akrGAACUUACUCCCUCCGUCCCAAAAUPMRD
osa-miRf10570-akrAAGCGUGUUUACGGAAAACGAGPMRD
osa-miRf10571-akrAUAUUUACUCCCUCCGUCCCAUAAPMRD
osa-miRf10572-akrUUACUCCCUCCGUCCCAUAAPMRD
osa-miRf10573-akrCCAAGGUCCCUCAACUUGUCAUCAPMRD
osa-miRf10574-akrAAGGUCCCUCAUCUUGUCAUCPMRD
osa-miRf10575-akrGUUGAGGGACCUUGGUGUACUUPMRD
osa-miRf10576-akrCUUGUCCUGCGGGAGCUGCUGGUUPMRD
osa-miRf10577-akrCAUCUCUACUUCGCAGCCGCPMRD
osa-miRf10578-akrCAUCUCUACUCUGCAGCCGCPMRD
osa-miRf10580-akrUCCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf10581-akrAGAUCAUCUUUAGUCCCGGUUCGAPMRD
osa-miRf10583-akrAUCUUUAGUCUCGGUUGGUGUUACCPMRD
osa-miRf10584-akrCCGGUUGGUAACACCAACCGAGAPMRD
osa-miRf10585-akrUUAGUCUCGGUUGGUGUUACCPMRD
osa-miRf10586-akrGUCCCAUCCGAUCCUAGGUUGPMRD
osa-miRf10587-akrCAGCAUAGCUGGCGCCUCCUCCUPMRD
osa-miRf10589-akrAACGAGGGGAUAUCCCAUCGAGPMRD
osa-miRf10590-akrCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf10591-akrUGAUACGUGAUAGGAAUCGCCUPMRD
osa-miRf10592-akrGGGUGAUACUUGCGAGGUAUCAUPMRD
osa-miRf10593-akrUCCUUGAGGAGAUACUAUGAGGUAUPMRD
osa-miRf10595-akrAUCCUGGCGACGUUGCUGAAPMRD
osa-miRf10596-akrCUGGCGGACCAGUUAAGAGGUPMRD
osa-miRf10597-akrAUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10598-akrUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10599-akrUUACCAACCGGGACUAAAGAUCPMRD
osa-miRf10600-akrAGAUCGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10602-akrGGAUGCCACGUCCACAUCCUAGPMRD
osa-miRf10603-akrGGUACUCUCUCCGUCCCAAAAPMRD
osa-miRf10604-akrUGGCCUUCUACAUCUUCGUCPMRD
osa-miRf10605-akrGCGAGCUGCUUGAGCUCGGCUPMRD
osa-miRf10606-akrGGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10607-akrUUAGACACCUCAGCGCCAAAPMRD
osa-miRf10608-akrGUUGGUGUUAUCAACCGGGAPMRD
osa-miRf10609-akrAGUCCCGGUUGAUAACACCAACPMRD
osa-miRf10611-akrUACCGGUUGGUAACACCAACCGGPMRD
osa-miRf10612-akrUCCCGGUUGGUGUUACCAACCGGPMRD
osa-miRf10614-akrAUGAUGCAUGCAUCCUCUCUUPMRD
osa-miRf10615-akrAAGAGAGGAUGCAUGCAUCAPMRD
osa-miRf10616-akrCAUGAUACCUGAUAGGUAUCACPMRD
osa-miRf10617-akrUUGCAUCAAAGUGAACAGGCCCCPMRD
osa-miRf10618-akrGCAUCAAAGUGAACAGGACCPMRD
osa-miRf10619-akrGCCGUUCCGCUGUUGCAUGCPMRD
osa-miRf10620-akrCGAUGCCGUAGUCCAUGAGCPMRD
osa-miRf10621-akrUUGCACUUUGGACCACCCCAPMRD
osa-miRf10622-akrGUAUCAUCCCGUCCGAACGGPMRD
osa-miRf10623-akrCGUGGCGCUGAGGUGUCUAAGUPMRD
osa-miRf10625-akrUAGACACCUCAGCGCCACGUPMRD
osa-miRf10626-akrGGUUGGUAAUACCAACCGGAAPMRD
osa-miRf10627-akrACUUUAGUCCCGGUUGGUGGPMRD
osa-miRf10628-akrUGGCGCUGAACUUAGACAUCUCAPMRD
osa-miRf10629-akrUGUCAGUGAGCUGUACUGCAPMRD
osa-miRf10630-akrGUAGCCAAGGACAGACUUGCCGPMRD
osa-miRf10632-akrCCGGCGAACUCCUCUUCUUCUPMRD
osa-miRf10633-akrAUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10636-akrUCGAACUGCCUCCGUUCGACAGGPMRD
osa-miRf10637-akrGACAUCGUCUUCCCCGUCAGPMRD
osa-miRf10638-akrUCCCGGUUGUUUAUACCAACCGGGAPMRD
osa-miRf10640-akrCCGGACCCACAUGUCAGCCUCACPMRD
osa-miRf10641-akrUGAGGCUGACAUGUGGGUCCGPMRD
osa-miRf10642-akrCCGGGCCCACAUGUCAGUCUCACPMRD
osa-miRf10643-akrACGGCUGGCCUAUUAUGCCACCGUUPMRD
osa-miRf10644-akrGAGCUCCACCCAACUCCACUPMRD
osa-miRf10645-akrAUGGCGCCCAUCACGGAUGAPMRD
osa-miRf10646-akrCUGGUUGGUGUUACCAACCGPMRD
osa-miRf10648-akrGGUUUUGGUCUACGUGGUGUACACGPMRD
osa-miRf10649-akrGUGAGACCCUUCUACCAGACPMRD
osa-miRf10650-akrGUGGUAUGUCAUGAAACCCUPMRD
osa-miRf10651-akrAAGUUGGUGCCCGUCACAGAUGAPMRD
osa-miRf10652-akrCGUCACGGAUGAGUCAUCUGUPMRD
osa-miRf10653-akrCUGGACCCACAUGUCAGCCUCAPMRD
osa-miRf10654-akrUGAGUGAGGCUGACAUGUGGGUCCPMRD
osa-miRf10655-akrCCCACGUGUCAGCCUCACUUUCPMRD
osa-miRf10656-akrGUCAUCUCAAUCGGGCCUAAPMRD
osa-miRf10658-akrCUUUAGUCCCGGUUGGUAACACCAAPMRD
osa-miRf10660-akrUGGGUUUCCGUGUCCAACGUUUGACPMRD
osa-miRf10661-akrCCGGUUGGUAACACCAACCGGPMRD
osa-miRf10662-akrCGAUGGAGUGGCACUGUUCCPMRD
osa-miRf10663-akrUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf10664-akrACCGCCGGUUCAUCUGCGGUUUGACPMRD
osa-miRf10666-akrCAACCGGGACUAAAGAUCGAPMRD
osa-miRf10667-akrAGUUGGGGCCCGUCACAGAUGACPMRD
osa-miRf10668-akrAGGACAGCGCCAAUAUCGUUGPMRD
osa-miRf10669-akrCCUGUCCCAAGACCGAGUCUPMRD
osa-miRf10671-akrUCCCGGUUGUUUAUACCAACCGGPMRD
osa-miRf10672-akrAACUCGUGGUGAUGUGGACUAAUPMRD
osa-miRf10673-akrCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf10674-akrUUUCGGCAGGUCCGGCCGAAGPMRD
osa-miRf10675-akrUUGGGGCCAGUUUUGGUUCGGCCPMRD
osa-miRf10676-akrCCAUGUCCUCGUCCUAGUUGPMRD
osa-miRf10677-akrCUAGGUGCAGAGGCAGAUGCPMRD
osa-miRf10678-akrACCACUUUGAUGAGGAGUUGGPMRD
osa-miRf10679-akrAGGGUGUCGAGAAGGGUGAUCGPMRD
osa-miRf10680-akrUAUCAGCUAGCUAGCUGGCUUAUPMRD
osa-miRf10681-akrCCUGUCGAACAGGGGCAGUUCGACPMRD
osa-miRf10682-akrUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf10683-akrUGCCGACUGGUCUCCAGUUGGPMRD
osa-miRf10684-akrUUUGGUACUGUGAGGUACCAGUPMRD
osa-miRf10685-akrAGCAGCGACUCUGGUCAUGGAAPMRD
osa-miRf10686-akrUGACCAGGUCACUGCUUGCCPMRD
osa-miRf10687-akrGGUCACUGCUUGCCUUUGCAGPMRD
osa-miRf10688-akrGGAUGCCAUGUCCUCAUCCUAPMRD
osa-miRf10689-akrUGCCAUUUCCUCGUCCUAGGPMRD
osa-miRf10690-akrUCUCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10691-akrAACUUUAGUCCCGGUUGGUAAPMRD
osa-miRf10692-akrUUCUUGCAUUGCCCACAUUCPMRD
osa-miRf10693-akrCCCGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10694-akrCUUUGCAUGCAGUUGCGCCAPMRD
osa-miRf10695-akrAGUCCCGGUUGGUAACACGAACCGPMRD
osa-miRf10696-akrGCCAACGUUUGACCGUCCGUCPMRD
osa-miRf10698-akrGGAUGCCAUGUCCUCAUCCUAGPMRD
osa-miRf10699-akrGGAUGAGGAUGUGGCAUCCUPMRD
osa-miRf10700-akrCCGGUUGGUAACACCAACCGGGAPMRD
osa-miRf10701-akrGCCCGUCACAGAUGAGUCAUCCGUPMRD
osa-miRf10702-akrUGUAGGGACCCAAAGUGAACUUAPMRD
osa-miRf10703-akrUUACCAACCGGGACUAAAGUUPMRD
osa-miRf10705-akrCACGGCUGGCCUAUUAUGCCACCGUUPMRD
osa-miRf10707-akrGGAUCUUUAGUCCCGGUUGGUGPMRD
osa-miRf10708-akrUUGAUGCCCGUCACAGAUGACUCPMRD
osa-miRf10709-akrAUGGUGCGCUGCAGUGGAUUPMRD
osa-miRf10710-akrUUACUCCCUCCGUCCUAGAAUAUPMRD
osa-miRf10711-akrUUAUCCGGGCCCACAUGUCAGCCPMRD
osa-miRf10713-akrCAGGGAGGGGAGAGUCGUGUUUPMRD
osa-miRf10714-akrAGCUCGAGCAGCUCACGAGCPMRD
osa-miRf10715-akrCGAGCUCGAAUAGUUCGUCGAGPMRD
osa-miRf10717-akrUCUUUAGUCCCGGUUGGUGUPMRD
osa-miRf10718-akrCUUAGACACCUUAGCGCCACPMRD
osa-miRf10719-akrGGCAUGAGGAUGUCAAAAGGPMRD
osa-miRf10720-akrCGGUUGGUGUUACCAAUCGGGAPMRD
osa-miRf10721-akrUCCCGAUUGGUAACACCAACCGPMRD
osa-miRf10723-akrACCCACAUGUCAGUGGCUCAAPMRD
osa-miRf10724-akrCCCCACAUGUCAGUGGCUCAPMRD
osa-miRf10726-akrCCCAGUUGGAAACACCAAUCGGPMRD
osa-miRf10727-akrUAGUCCUGGUUGGUGUAACCAACUPMRD
osa-miRf10728-akrGGGUGAUACUUGCGAGGUAUCAGPMRD
osa-miRf10729-akrAGUCCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf10730-akrGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf10734-akrUAGGUGUUCGACGAAAUGCCUPMRD
osa-miRf10735-akrUAGUACUCCCUCCGUCCCUAAAUAUAAPMRD
osa-miRf10736-akrGUGCCGAGAGGCUGGAGUAUGACPMRD
osa-miRf10737-akrGAGGGACCUUCGGUGCACUUUUUCCPMRD
osa-miRf10738-akrGAAAAAGUGCACCGAAGGUCCPMRD
osa-miRf10739-akrUGAGGUGCCUGAGCUCAGCGPMRD
osa-miRf10741-akrGAGGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf10742-akrAAUGACUACUCCCUCCGUCCCAAAPMRD
osa-miRf10743-akrUGCAUACUCCCUCCGUCCCAAAPMRD
osa-miRf10745-akrCCUACAUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf10747-akrCUUGAGGAGGUACAAUGAGGUACPMRD
osa-miRf10748-akrGUACUAGGAUACAUCACAUCPMRD
osa-miRf10749-akrCUGCCGACUGGUUUCCAGUCGGCGGUUPMRD
osa-miRf10750-akrCUGCUGCCGACUGGUUUCCAGUCGGPMRD
osa-miRf10751-akrCCCGGUCCCACAUGUCAGCCUCACPMRD
osa-miRf10752-akrGUCCCACAUGUCAGCCUCACPMRD
osa-miRf10753-akrUCAUGGUAACGUGGACGAAUPMRD
osa-miRf10755-akrGGUACCUCCUGAAAGACCGUPMRD
osa-miRf10756-akrCGGUCUUUCAGGAGGUACCAPMRD
osa-miRf10757-akrAUUUCGGGAUGGGUGACCGAPMRD
osa-miRf10758-akrGGAUUUUCGCAUGCGGUUGCCCPMRD
osa-miRf10760-akrAAGCUGCUGUUGUGCGACGCCGAPMRD
osa-miRf10761-akrAAUGUGGGCAAUGCUAGAAAGUCUUAUPMRD
osa-miRf10762-akrAUGUGGGCAAUGCUAGCAAGUPMRD
osa-miRf10763-akrCGUGGACGAAUCUCGGACGUCCPMRD
osa-miRf10764-akrUCCCGGUUGGUAACACCAACCGAPMRD
osa-miRf10765-akrAGAGAUUUGCUCUGGUCCAAPMRD
osa-miRf10766-akrAGGUAUCAGCUGAUACCUGAUAPMRD
osa-miRf10767-akrUAGGUAUCAGGACCUGAUACCUCGPMRD
osa-miRf10768-akrAGUUGAGCUCUGGGUGCCAUCPMRD
osa-miRf10769-akrCGUGCGCACGCUUCCCAAACUACUAPMRD
osa-miRf10770-akrCCGGAGUACGAUGAUGAUGAPMRD
osa-miRf10771-akrAUGAGCCCAUCACGGAUAAUPMRD
osa-miRf10772-akrGCUCGAGCUUCUAACGAGCCPMRD
osa-miRf10773-akrCGGUGAACUCCUCUUCUUCUCCPMRD
osa-miRf10774-akrCCGUCACGGAUGACACUUAUPMRD
osa-miRf10775-akrAAGUGUCAUCCGUGACGGGCPMRD
osa-miRf10776-akrCGUAGGGCCUGUCACAGAUGAPMRD
osa-miRf10777-akrAGCAGGCUACAGAUCUGUAGCCPMRD
osa-miRf10778-akrUUGGAGCUAGUAGUGGGCUAUACUAPMRD
osa-miRf10779-akrUCCAUGUCACAUCGGAUGUUUGPMRD
osa-miRf10780-akrAUGGUGUCCCAUCCCCAUCUPMRD
osa-miRf10781-akrGUUUUCCGGCUUCAAGUCACGPMRD
osa-miRf10782-akrUUCAAUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf10783-akrGUUUAGUCCCUCUCUCCCAAAPMRD
osa-miRf10784-akrGAUUCGUCCACGUCAUCACGAGPMRD
osa-miRf10786-akrCGCCGUUAGGGUUCCGUCCAPMRD
osa-miRf10787-akrUAAGACUUUCUAGCAUUGCCCACAUPMRD
osa-miRf10789-akrGCUCGUUAUCCUAGCGAGCUAPMRD
osa-miRf10790-akrGAUCUUUAGUCCCGGUUGGUAACACPMRD
osa-miRf10791-akrUAUGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10792-akrAGGUGGUGUCCCAUCCCCACCPMRD
osa-miRf10793-akrCUAUCUGAUCAAUCUCUGCCAPMRD
osa-miRf10794-akrGAGGAGACCGGCGCUGAGUGAPMRD
osa-miRf10795-akrGGUUUCGCGGGUUAGCCACUUACAPMRD
osa-miRf10797-akrUCAUGGUACCUCCUUAAGGACCGUAPMRD
osa-miRf10798-akrUGACCUGGCACUGAGGUGGCPMRD
osa-miRf10799-akrGGUUGGUAACACCAACCGAGAPMRD
osa-miRf10800-akrACGUCAGAGGAUCCCUUUCCUPMRD
osa-miRf10801-akrCAUGUGGGUCCGGGUGGCAAAUPMRD
osa-miRf10803-akrAUAGCAUCAAAGUGAACAGGUCCPMRD
osa-miRf10804-akrGCAUCAAAGUGAACAGGUCCUUAAPMRD
osa-miRf10805-akrAUGACUUACAUUGUGAAACGGAGGAAPMRD
osa-miRf10806-akrUUAGGCUUAAAAGAUUCGUCUCGCPMRD
osa-miRf10807-akrAAUAUAUUGGGACGGAGGGAGUAGUAPMRD
osa-miRf10808-akrCUGCUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf10809-akrUACUGCUCCCUCCGUCCCAAPMRD
osa-miRf10810-akrUACUACUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf10811-akrAUAUAUUGGGACGGAGGGAGCAGUAPMRD
osa-miRf10812-akrCGAGCUCGAAUAGCUCGUCGAPMRD
osa-miRf10813-akrUCGCGAGCUGCUUGAGCUCGGCUPMRD
osa-miRf10814-akrCUACUCCUUCCGUCCCAAUAUAPMRD
osa-miRf10815-akrUUUCCGUGUCCAACUUUGACUGUCPMRD
osa-miRf10817-akrUGAGGGGCCUAAAGUGAACUUUUUPMRD
osa-miRf10818-akrAAGUUCACUUUAGGCCCCUCPMRD
osa-miRf10819-akrUCUUCCUCUCGUCGCCGGAGGPMRD
osa-miRf10820-akrAUUGGACCGGAGCAAAUCUCUUGCPMRD
osa-miRf10821-akrCGCCGGGUUGUAGAACGACGCGAPMRD
osa-miRf10822-akrGGUGUGGAAUUAAUCCCCUCCAAPMRD
osa-miRf10823-akrGGGGCUAAACUUUAGUCCCUPMRD
osa-miRf10824-akrAUAGGUAUCAGACCUGAUACCPMRD
osa-miRf10826-akrGCCCGUCACAGAUGAGUCAUCCPMRD
osa-miRf10827-akrUGGAACCCUAACGGCGAUGGCPMRD
osa-miRf10828-akrUUUGCAGGCGGCCUCCUCCUGGPMRD
osa-miRf10829-akrAGAUUUACUCCCUCCGUCCCAUAPMRD
osa-miRf10830-akrUUACUCCCUCCGUCCCAUAGAAAPMRD
osa-miRf10831-akrAGGCUCGGGUUCGGCUCGUUUPMRD
osa-miRf10832-akrAUACCCGGUUUUGUAGUUCGGGGGPMRD
osa-miRf10833-akrCCCCUGAACUACAAAACCGGPMRD
osa-miRf10834-akrUGCCCACCAUGGUGACCGUAGAPMRD
osa-miRf10836-akrGUCCUUGAGGACGUACCAUGPMRD
osa-miRf10838-akrUCCUUGAGGACGUACCAUGAGGUACPMRD
osa-miRf10839-akrCCUGUGACGUUGGUGAAGGUGPMRD
osa-miRf10840-akrCUGUUUGGGAAGCUUCUGGCAPMRD
osa-miRf10842-akrUGUUUGGGACGGAUGGAGUACGUAPMRD
osa-miRf10843-akrGUCAGCGCCAGAACAAUUGGCGCUGPMRD
osa-miRf10844-akrUGGGCGGCAAGCUGACGUGGCAPMRD
osa-miRf10846-akrUCCCGGUUGGUGGUACCAACCGAGAPMRD
osa-miRf10847-akrGUUGGUGAGACCAACCGGGAPMRD
osa-miRf10848-akrCCUGGUUGGCAUGGCCAAAAPMRD
osa-miRf10849-akrUGGACUGUUUGGGGGAGCUUCUPMRD
osa-miRf10850-akrUGCUGGUUCGAGAACCAGCGAGPMRD
osa-miRf10851-akrAGUCCCGGUUGGUAAAACCAACCGGPMRD
osa-miRf10853-akrGUCAUCUCAAUCGGGUCUAAPMRD
osa-miRf10855-akrUUACAUUGUGAAACGGAGGGAGUPMRD
osa-miRf10856-akrUCCCGGUUGGUAUUACUAACCGGGAPMRD
osa-miRf10857-akrGUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf10858-akrUCCCGGUUGAUGUUACCAACCGGPMRD
osa-miRf10860-akrCCAAUGAUAUUGGCGUCGUCPMRD
osa-miRf10861-akrUCCCGGUUGAAUAACCGGGACUAPMRD
osa-miRf10862-akrUCCCGGUUUGUAACACCAACCGGPMRD
osa-miRf10863-akrGCGGCUGCGGCUGCAGUUGUGCPMRD
osa-miRf10864-akrAGGAUGGGGACGUGGCAUCCUGPMRD
osa-miRf10865-akrGGUGGAUGUGACACAUCCUAPMRD
osa-miRf10867-akrUGGAUGAAUCUCGGACGUCUPMRD
osa-miRf10868-akrUUGGUGUUACUAACCGGGAUUAAAPMRD
osa-miRf10870-akrUGUCUAAGUUUAGCGCCACAPMRD
osa-miRf10871-akrUGAGGUACCGGUACCUCGAGPMRD
osa-miRf10872-akrUUUGGUACCAUGAGGUACCGGUAPMRD
osa-miRf10873-akrCGGUACCUCACGGUACCAAAUPMRD
osa-miRf10874-akrGAUUUGGUACCAUGAGGUACCPMRD
osa-miRf10875-akrGUCACGUAGGCGCCACCUCAGUPMRD
osa-miRf10876-akrAGUUGGAGCUGUGCCAAACAGPMRD
osa-miRf10877-akrCCCAACCGGGACUAAAGAUCGAUPMRD
osa-miRf10878-akrCGGCCGUCCGUCUGCGAAGAUAGPMRD
osa-miRf10879-akrUCAGCGCCAUGCUAUUUGGCGCUGPMRD
osa-miRf10881-akrCCUAAGAGCCCUCCAGUGAAPMRD
osa-miRf10882-akrGGCCUCCUAAGAGCUCGCCAGCGAPMRD
osa-miRf10883-akrCUGGUUGGUGUUACCAACCGAGAPMRD
osa-miRf10885-akrCCGCCGACUGGUUUUCAGUCGGAGGAUPMRD
osa-miRf10886-akrUGCCGCCGACUGGUUUUCAGUCGGPMRD
osa-miRf10888-akrAAAGCUGCCAGGAAGUUCCGGACPMRD
osa-miRf10889-akrCUUCCGGAGUUCUUCCUAGGPMRD
osa-miRf10890-akrAGCACUUUGCUCUUGACGAGPMRD
osa-miRf10891-akrCCGGUUUGUGUUACCAACCGGGAPMRD
osa-miRf10892-akrGUUCGAUAGGACCUGUCGAACPMRD
osa-miRf10894-akrAUCUUUAGUCCCGGUUGUUGPMRD
osa-miRf10895-akrUGUCGAAUUGCGUCAGUUCGACAGPMRD
osa-miRf10896-akrUAUCUUUAGUCCCGGUUGUUPMRD
osa-miRf10897-akrGCCGUUCGACAGGACCUGUCGAACPMRD
osa-miRf10898-akrGGGAAAUUGGAACCAUGCCACUUCPMRD
osa-miRf10899-akrACAAGUUGAAGGACCUUGGGPMRD
osa-miRf10900-akrGGACCUUGGGUGUACUUUUUCCUUCPMRD
osa-miRf10901-akrAGUCAUCUGUGACGGGCAUUAAPMRD
osa-miRf10902-akrUGUGACCCCACAUGUCAGUUACAUGAPMRD
osa-miRf10903-akrAGCUCGAGUAGCUCACGAGUPMRD
osa-miRf10905-akrUGCGCCAUAGAAUAAUGGCUUGGCUPMRD
osa-miRf10906-akrUGCCGCCCAAGUAGAGGGCGGCAAPMRD
osa-miRf10907-akrUCCCGGUUGGUGUUAUCAACCPMRD
osa-miRf10909-akrGGGUGAUACUUGUGAGGUAUCAGGUPMRD
osa-miRf10911-akrGUGGUGGCGAUGUGCCAAGUGAPMRD
osa-miRf10912-akrUCUUUAGUCCCGGUUUGUAACACCPMRD
osa-miRf10914-akrCCCGCCAGAUCUAGCUGAGGPMRD
osa-miRf10915-akrCAGCGGCAAAACUGUUCUUGPMRD
osa-miRf10916-akrGUUCCUCACGUUGUCGUCGAGPMRD
osa-miRf10917-akrGGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf10919-akrCCCGGUUGGUAAAACCAACUGGGPMRD
osa-miRf10921-akrCCCGGUUAGUAACACCAACCGPMRD
osa-miRf10923-akrUGCGCCAUAGUAUAAUGGCAUGGCPMRD
osa-miRf10924-akrUAGCUACAUUUGGGGACAGAGPMRD
osa-miRf10926-akrGGGGAUCUUUAGUCCCGGUUAPMRD
osa-miRf10927-akrUCUUUAGUCCCGGUUGGUGGGPMRD
osa-miRf10928-akrAGGUAUCAGGCCUGGUACCCGPMRD
osa-miRf10929-akrCUCUUAAGUGACUGCUAGCGPMRD
osa-miRf10930-akrAAUGCCCGAUUGAGAUGACAPMRD
osa-miRf10931-akrAGGUUAAGCAUGCUUGGCCUPMRD
osa-miRf10932-akrUCCGGUGGGACCCACAUGUCAUUPMRD
osa-miRf10933-akrGAUGACUCAUAUGUGACGGGCPMRD
osa-miRf10934-akrCAUCUUGCGAUUUCCUGGCAPMRD
osa-miRf10935-akrAUCUUUAGUCUCGGUUGGUAPMRD
osa-miRf10937-akrUUGGUGUUACCAACCGGGACUAAAPMRD
osa-miRf10938-akrCUGAUGGACGGUCCUCCACUUPMRD
osa-miRf10939-akrAGUGGAGGACCGUCCAUCAGAPMRD
osa-miRf10940-akrAUUAGGCUCAGAAGAUUCGUCUUCUPMRD
osa-miRf10941-akrGACAUGGAGUUGAGUUGGUUPMRD
osa-miRf10943-akrGCCACAUCAGCGAAACCGUCCPMRD
osa-miRf10944-akrGCGGUUUUGCUGACGUGGCGCCPMRD
osa-miRf10945-akrUUUUGCUGACGUGGCGCCUACGUPMRD
osa-miRf10946-akrUUUCGCUGAUGUGGCGCCUACGUPMRD
osa-miRf10947-akrGACGAUGGCGACAACGGCGAUGAPMRD
osa-miRf10951-akrUCCCGGUUGGCAUUACCAACCGGPMRD
osa-miRf10953-akrAUAAGUCAUCUGUGACGGGCUCUAPMRD
osa-miRf10954-akrUAGGCUCGAUUUGAGCUCGGCPMRD
osa-miRf10957-akrUUGGUGCCCGUCACAGAUGACPMRD
osa-miRf10960-akrGGUGUUACCAACCGGGAUUAPMRD
osa-miRf10961-akrUGCCAUGUUCUCGUCCUAGGPMRD
osa-miRf10962-akrUACCAACCGGGACUAAAGUUACGPMRD
osa-miRf10963-akrUUACCAACCGGGACUAAAGUPMRD
osa-miRf10964-akrCUUUAGUCCCGGUUGGUGGGAPMRD
osa-miRf10968-akrUCGAGCUGAGAUCGAGCUUCPMRD
osa-miRf10970-akrCGAGCCGAGCUCGAGCUUCUPMRD
osa-miRf10971-akrUGAACCCAUGACCUCUUGGGUAAPMRD
osa-miRf10972-akrGGAGACUUGAACCCAUGACCPMRD
osa-miRf10974-akrCCACGAGGUCAUGGGUUCAAPMRD
osa-miRf10975-akrGACUUGAACCCAUGACCUCGUPMRD
osa-miRf10976-akrUCCCGGUUGGUGUUACCAACUGGPMRD
osa-miRf10977-akrGGUGAUCUUUAGUCCCGGUUAUUPMRD
osa-miRf10978-akrCUGCCAAAGGAGAAUUGCCCPMRD
osa-miRf10979-akrUGCCCUUUAGGGCUAAUUCAPMRD
osa-miRf10981-akrUGGGUUCGCGGCUGACCCACUUAPMRD
osa-miRf10982-akrCGUGCGGUCCUCUUAAGUCGACCPMRD
osa-miRf10983-akrUCUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf10984-akrCAGUAGCGGCAAUCUCAUCUPMRD
osa-miRf10985-akrUGUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf10987-akrUAAUGCCCGUCACAGAUGAGUPMRD
osa-miRf10988-akrCCCCGGGAUCUUUAGUCCCGGUUPMRD
osa-miRf10989-akrUUUCCAGUCGGAGGUUGGUCACUPMRD
osa-miRf10990-akrUGCUGCCGACUAGUUUCCAGUCGGAGGPMRD
osa-miRf10991-akrAGUCUCGGUUGGUAACACCAACCGGPMRD
osa-miRf10992-akrGCCGGUUGGUAUUACCAACCGGGAPMRD
osa-miRf10993-akrUCCCGCACUUCCAUUCUGCGCGAPMRD
osa-miRf10994-akrUGGCCCACAUAUCAGUGGCACAPMRD
osa-miRf10995-akrGUCUUGCCCAAGUCGCCGCUGGPMRD
osa-miRf10997-akrGUCCCGGUUGGUAACACCAAPMRD
osa-miRf10998-akrGCUCUUUAGUCUCGGUUGGUPMRD
osa-miRf10999-akrGUCCGGUUGGUGUUACCAACCPMRD
osa-miRf11000-akrCGUCCCAAAAUGUAGCUACCUPMRD
osa-miRf11001-akrAGCUACAUUUUGGGACGGAGGAAPMRD
osa-miRf11002-akrCCUCCGUCCCAAAAUGUAGCUACPMRD
osa-miRf11003-akrGAGCUGGAGCUCAGCCAAACAGPMRD
osa-miRf11005-akrCCAUGAGGUAGCAGUACCUCGPMRD
osa-miRf11006-akrUCCCGGUUGGUAGUACCAACCGGPMRD
osa-miRf11007-akrCCCAGUUGGUAGCACCAACCGGGPMRD
osa-miRf11008-akrUUGGUAGCACCAACCGGGGCUAPMRD
osa-miRf11009-akrAUUUGGUACCGUGAGGUACCPMRD
osa-miRf11010-akrCCCGGAGGUUCUGGCCAGAACPMRD
osa-miRf11011-akrAAGUUCUGGCCAGAACCUCCGGGUAPMRD
osa-miRf11012-akrGGAAGUUCUGGCCAGAACCUCCPMRD
osa-miRf11013-akrGGUUUGCCGGAGUUGGAGGAGAPMRD
osa-miRf11014-akrCUGGAUGAUGCGGUCGAGGAUGCCPMRD
osa-miRf11015-akrUUCUGGAUGAUGCGGUCGAGGAPMRD
osa-miRf11016-akrCGAGUCGAGCUCGAGCAGCUCGCGPMRD
osa-miRf11017-akrAGGACGAGUCGAGCUCGAGCAGCUPMRD
osa-miRf11018-akrUUAGUCCCGGUUGGUAUUACCPMRD
osa-miRf11019-akrAGUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf11020-akrUUAUUCCCGGUUGGUGUUACCPMRD
osa-miRf11021-akrAGUCCCGGUUGGUGACACCAACPMRD
osa-miRf11023-akrGUUGGUGUCACCAACCGGGACUAPMRD
osa-miRf11024-akrAGAGCUUCUGAUUCUGGGAGAPMRD
osa-miRf11025-akrGUCGUCGUCGGUGGUCAGCUPMRD
osa-miRf11026-akrAGUGGCAGUGGCAGUUGCAGUUPMRD
osa-miRf11028-akrUCGAGCUAGCUCGCGAGCCAAAPMRD
osa-miRf11029-akrAAUGCCAUGUCCUCGUCCUAGGUGPMRD
osa-miRf11032-akrUUCUUGAGGAGGUAUCAUGAGGUACPMRD
osa-miRf11033-akrCUUGAGAAGGUACCAUGAGGUACPMRD
osa-miRf11034-akrUGUUACCAACCGGGACUAAAAAPMRD
osa-miRf11035-akrUCGUGAGGUACCGGUACCUCGAGPMRD
osa-miRf11036-akrCGUGCCAACGUUUGACUGUCPMRD
osa-miRf11037-akrCCAACGUUUGACUGUCCGUCUUAUAUPMRD
osa-miRf11038-akrCCAACGUUUGACUGUCCGUCPMRD
osa-miRf11040-akrCCUCCUCUUCGCGAACGUCACCUGCCGPMRD
osa-miRf11041-akrAGAGGGAUAUGGGUCGCUGAPMRD
osa-miRf11042-akrGUAUGUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf11043-akrGUAUGUGGGCAAUGCUAGAAAGUPMRD
osa-miRf11044-akrGUUGCUAUAUUGUGGGACGGAGUPMRD
osa-miRf11045-akrGCGCUCCUCCAUCUUCUUCGAPMRD
osa-miRf11047-akrCUGCUGUUGCAUCAGCAGUAUPMRD
osa-miRf11048-akrGCAGUACUGCUGAUGCAAUAGPMRD
osa-miRf11049-akrAGUCAUCUGUGACGGGCAUUAPMRD
osa-miRf11050-akrCUUACAUUGUGAAACGGAGGAAPMRD
osa-miRf11051-akrGGCCCACAUGUCAGUGACACAAAAPMRD
osa-miRf11052-akrUUGUGUCACUGACAUGUGGGCCPMRD
osa-miRf11053-akrGCGUGCACUUUGAGCGCCAUGPMRD
osa-miRf11054-akrCCGGUUGAUAACACCAAUCGGPMRD
osa-miRf11055-akrCGGUUGGUGUUACAAACCGGGAPMRD
osa-miRf11056-akrGGUGUUACGAACCGGGAUUAAAPMRD
osa-miRf11057-akrCUGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11058-akrUUAGUCCUGGUUGGUGUUACCPMRD
osa-miRf11059-akrCUUAUAUCAUGGGACGGAGGGAGUAPMRD
osa-miRf11060-akrUAUCAUGGGACGGAGGGAGUACUAGPMRD
osa-miRf11062-akrUUCUUGAGGAGGUAACAUGAGGUACPMRD
osa-miRf11064-akrUGAGGUACCAUGAGGUACCAAAUPMRD
osa-miRf11065-akrUACUACUGCUGGUGGUGGCGGCGPMRD
osa-miRf11066-akrAGUCCCGGUUGGUAACACUAACCGGGAPMRD
osa-miRf11067-akrCUAGGUCCGCCUGCGAAAAUAGPMRD
osa-miRf11069-akrCUGCCGACUGGUUUCCAGUCGGCGGCUPMRD
osa-miRf11072-akrUCCCGGUUAGUAUUACCAACCGPMRD
osa-miRf11073-akrGAUGAUGACGUCGUCGGUGAPMRD
osa-miRf11074-akrUCAAGCUCGAACGAGCUCGAPMRD
osa-miRf11076-akrAUCAAGCUCGAGCAGCUUGCPMRD
osa-miRf11077-akrCCGGUUGGUGUUACCAACCGAGAPMRD
osa-miRf11078-akrUUUCGCGCAACGGUUGUGCGAGAPMRD
osa-miRf11079-akrAGAUGGCUGAUGCUCGAACUCPMRD
osa-miRf11082-akrCGAUUUGGUACCAUGAGGUACCPMRD
osa-miRf11083-akrUACUGUCCUUGAGGAGGUAUCAUPMRD
osa-miRf11085-akrGCAGGCCCAGCUGUCAGUCAPMRD
osa-miRf11086-akrGAGCUGGUACAGGCCGGUGUAPMRD
osa-miRf11087-akrACCUCGGAGUGCUUCUACGGCUPMRD
osa-miRf11089-akrUUACUCCCGGUUGUUACUACCAACCPMRD
osa-miRf11090-akrUUUUGGGACAGAGGGAGUAUGUPMRD
osa-miRf11091-akrCACCGGUCAGACCGGUCAUGCAAUGCPMRD
osa-miRf11093-akrAGGCGGUUUUGCCCUUCUUUPMRD
osa-miRf11095-akrUCGUCGAGGUCGACAUCGACGGCPMRD
osa-miRf11096-akrUGACGCUGCACCCGCAACAAPMRD
osa-miRf11097-akrGGGAUAAUCGAUUAUCCCGUGCPMRD
osa-miRf11098-akrCAGCUGCUGCAGCUUUUCCCPMRD
osa-miRf11100-akrUAGUUUGUGUUGUAGCUGGCUAPMRD
osa-miRf11101-akrAUCUUUAGUCCCGGUUGGUGPMRD
osa-miRf11105-akrCCUCUUAAGGGUCCGCAUGCPMRD
osa-miRf11107-akrUUUCCGUGCGGUCCUCUUAAPMRD
osa-miRf11110-akrGGUGUUACCAAUCGGGACUAAAGAUPMRD
osa-miRf11112-akrUUGGUGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf11114-akrAGGGUUCGGCUGAACCCUUGGUUUPMRD
osa-miRf11115-akrAACCAAGGGUUCAGCCGAACCCUPMRD
osa-miRf11116-akrAGUCGGUCUAGAUGAGCCGAPMRD
osa-miRf11117-akrUCAGCGCCAACCUCUUUGGCGCUGAPMRD
osa-miRf11118-akrUCAGCGCCAAGUGCAUUGGCGCUGAPMRD
osa-miRf11119-akrGUAGUACUAGGAUAUGUCACAUCCAPMRD
osa-miRf11120-akrCCCAGUUGGUAGUAACAACCGGGAPMRD
osa-miRf11121-akrGUGUCCGGUCUGACCGAGGCACAGUPMRD
osa-miRf11122-akrUAGGUCUGGAGUAGAGUUGUGGAGCPMRD
osa-miRf11123-akrCCGGUGUUUUAGGACAGGAACUUPMRD
osa-miRf11125-akrGGCUCACCAUUGCAGGAGGAPMRD
osa-miRf11126-akrCAUACAGGCCACUUAAGAAGPMRD
osa-miRf11128-akrCGUACCGUGAGGUACCGGUACAUCPMRD
osa-miRf11129-akrGGUACCGUGAGGUACCGAUAPMRD
osa-miRf11131-akrUCCCGGUUGAUGAUACCAACPMRD
osa-miRf11132-akrACUUACAUUGUGAAACGGAGGGPMRD
osa-miRf11133-akrCUUACAUUGUGAAAUGGAGGPMRD
osa-miRf11135-akrCGUCCGACUGGUUUCCAGUCGGGGGCUCPMRD
osa-miRf11136-akrCUACGUCCGACUGGUUUCCAGUCGGGGPMRD
osa-miRf11138-akrGUCCGGUUGUUGAGAACAACPMRD
osa-miRf11140-akrUUUUGGCCCAUCACAGGUAAPMRD
osa-miRf11141-akrGAUGACCCUCAUCUGUGACGGGPMRD
osa-miRf11143-akrGAGCUCAGCUCGGGCUUGGUPMRD
osa-miRf11144-akrCCCACAUGUCAGUGACUCAAPMRD
osa-miRf11145-akrCAGCCCUUGCUUGCCGAACAGGPMRD
osa-miRf11147-akrCAGAUUCGUUGUACUAGGAGGPMRD
osa-miRf11148-akrAUGGUACCUCCUGAAGGACCPMRD
osa-miRf11152-akrUCAGCACCAUGCUAUUUGGCGCUGPMRD
osa-miRf11153-akrUGACAUGGGUGGCCCAUGGUUGPMRD
osa-miRf11154-akrAGAUUUUGGGUGGAUGUGACPMRD
osa-miRf11155-akrUGGACCCACACGUCAUCCUCGAPMRD
osa-miRf11156-akrAGGUAUCGCAUGAUACCUCGUPMRD
osa-miRf11157-akrUUGAGGAGGUACCAUGAGGUAPMRD
osa-miRf11158-akrGCACCACCAACAUUGGUGUCPMRD
osa-miRf11159-akrGCCAAUGUAGUUGGUGCCGUPMRD
osa-miRf11160-akrGCAGCAUCAGCAUCCAAGCUPMRD
osa-miRf11163-akrACGGUCCUUAAGGAGGUACCAUGAPMRD
osa-miRf11164-akrGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11166-akrUUAGUCCCGGUUGGUGUUACPMRD
osa-miRf11167-akrGAGCUCGACACGAGCUCGAGPMRD
osa-miRf11168-akrGGAUGCCAUGACCUCGUCCUAGPMRD
osa-miRf11169-akrACCAACCGGGACUAAAGAUCPMRD
osa-miRf11170-akrUGCAUGCAUCUGCAUGUGCCPMRD
osa-miRf11171-akrCGAUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf11172-akrAAAAGUGCACCAAAGGUCCCUCAAPMRD
osa-miRf11173-akrUCCCACCCAGAGGUUUCGCCCGGUPMRD
osa-miRf11174-akrGUUGGUGUUACUAACCGGGACUAAAPMRD
osa-miRf11175-akrAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11176-akrUAACGCCCGUCACAGAUGAGUPMRD
osa-miRf11177-akrUCCCUCAACUUGUCAUCGGGAPMRD
osa-miRf11178-akrCCGUUGACAAGUUGAGGGACCUUPMRD
osa-miRf11179-akrUGACAAGUUGAGGGACCUUCGPMRD
osa-miRf11180-akrCACCGAAGGUCCCUCAACUUGUPMRD
osa-miRf11181-akrUCUGCUCCAGUGGAGAAGCAPMRD
osa-miRf11182-akrGUACUCCCUCCGUCCCAUGAAAAAPMRD
osa-miRf11183-akrACGUCGGAGGAUCCUCUUCCPMRD
osa-miRf11184-akrUUGCAUCUAGGUCCCUUGCCPMRD
osa-miRf11185-akrGUGGAUGGAUGCGGAGACAAPMRD
osa-miRf11186-akrCUUGGGUGGACGUCCACCCAUUUPMRD
osa-miRf11187-akrAACGGGUGGACGUCCACCCGAGPMRD
osa-miRf11188-akrCAGCUGCUAGAAGCUCCCCAAAPMRD
osa-miRf11189-akrUGCCAGAAGCUCCCCCAAACAPMRD
osa-miRf11191-akrUGCCGACUGGUUUCCAGUCGGCGGPMRD
osa-miRf11192-akrCGGGACUGAAGAUCAUCUUUAGUCPMRD
osa-miRf11193-akrAGAUGAUCUUCAGUCCCGGUUGGUGPMRD
osa-miRf11194-akrGAGUUGCUCGAGCUCGGCUCGUCUCPMRD
osa-miRf11195-akrGGUUCGCGGGUCAACCCACUUGPMRD
osa-miRf11199-akrACUGCACGUGGUCUCCUUCUCCAUCPMRD
osa-miRf11200-akrGAUGUGUCCUAACCAGUCAAPMRD
osa-miRf11201-akrCCGGUUGGUGUUACUAACCGGPMRD
osa-miRf11202-akrUCCCUCUGUCCCAGAAUAAGPMRD
osa-miRf11203-akrUAGGGCCUGUUCACUUUGAUGCCAPMRD
osa-miRf11204-akrAGAGAUCCCUGACUUUGUGCPMRD
osa-miRf11205-akrUGCCGACUGAUUUCUAGUCGGCGGPMRD
osa-miRf11207-akrACCAUGAGGUAUCGGUACCCCGAPMRD
osa-miRf11208-akrUGUCCAACGUUUGACUGUCCGUCPMRD
osa-miRf11209-akrUGCAGUUUCAUCUGCUUGUGGPMRD
osa-miRf11210-akrAUCAUGCUGUGCAGUUUCAUPMRD
osa-miRf11211-akrGGUAAUGUCCCAUCCCCAACUPMRD
osa-miRf11212-akrAUACUCCCUCCGUCCCUAAAPMRD
osa-miRf11213-akrGUACUCCUUUCGUCCCAAAAPMRD
osa-miRf11215-akrUAGAUACUCCCUCCGUCCCAPMRD
osa-miRf11216-akrAUUGUACUCCCUCCGUCCCAUUAAAAAPMRD
osa-miRf11217-akrAGAGCUGGAGCUGUGCCAAACGGPMRD
osa-miRf11218-akrACUACUCUCUCCGUCCCAAAAAAACPMRD
osa-miRf11219-akrUUACUCCCUCCGUCCCAAAAAAPMRD
osa-miRf11220-akrCCGGUUGGUAACACCAACCGGGAAPMRD
osa-miRf11221-akrGUUGCAGCAGCAGGGACAGUPMRD
osa-miRf11223-akrCGUCCGCCUGCGAAGAUAAUPMRD
osa-miRf11224-akrUUACCAACCGGGACUAAAGAUCAPMRD
osa-miRf11226-akrAUCUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf11227-akrUAGUCCUGGUUGGUAACACCAACCGGGAPMRD
osa-miRf11229-akrAGUCCCGGUUGGUAACACGAACCGGPMRD
osa-miRf11230-akrCCGGUUGGUAACACGAACCGGPMRD
osa-miRf11231-akrGUCCGCUUGCGAAAAUCGAUUUUCGCPMRD
osa-miRf11234-akrGGUUGGUGUUACCAACUGGGAPMRD
osa-miRf11235-akrGGUGUUACCAACUGGGACUAPMRD
osa-miRf11236-akrAGUCCCAGUUGGUAACACCAACCPMRD
osa-miRf11237-akrGGUAUUACGAACCGGGACUAPMRD
osa-miRf11238-akrCAUGUGCAGCACAGCAGAGGAUUPMRD
osa-miRf11239-akrUCUGCUGUGCUGCACAUGCAPMRD
osa-miRf11240-akrGAUGGUGUACUUGGGCAGCGAPMRD
osa-miRf11241-akrGCCGAUUUUCGCUGGCGGACPMRD
osa-miRf11242-akrCGUCUUCCUGUUCCUGCAGCUGGPMRD
osa-miRf11243-akrCCCACAUGUCAGUGACUCUAAPMRD
osa-miRf11244-akrUCCCGGUUGAUGUUACCAACCGGGAPMRD
osa-miRf11245-akrAGUCCCGGUUGGUAACAUCAACCGGGAPMRD
osa-miRf11246-akrCCGGUUGGUGUUACCUACCGGGAPMRD
osa-miRf11247-akrGGUGUUACCUACCGGGACUAAAGAUPMRD
osa-miRf11248-akrCGCCGUUAGGGUUCCAUCCUPMRD
osa-miRf11251-akrCCGUCACUGAUGACUCAUCUPMRD
osa-miRf11252-akrUUCCGGUGUUCUUCACCAGGAGGPMRD
osa-miRf11253-akrUGUCCAACGUUUGACUGUCCGUPMRD
osa-miRf11254-akrAAGCUUAGCUGCGACGUUGCCPMRD
osa-miRf11256-akrGAUCUUUAGUCCCGGUUGGUAACPMRD
osa-miRf11258-akrUUAUCCUAACGAGCCGAGCUGPMRD
osa-miRf11259-akrGUGUCAGUGGGGACUCACAUGPMRD
osa-miRf11260-akrAUAUCAUCCCCUCCUAGGUUGUPMRD
osa-miRf11263-akrCCGGUUGGUAACACCAACCGGGAGUPMRD
osa-miRf11267-akrGACGACGACGAACUUGCCCUUPMRD
osa-miRf11268-akrACUGUUUGGCACAGCUCCAGCUCPMRD
osa-miRf11269-akrGGGAUAUCUUCACGAUCACUPMRD
osa-miRf11270-akrGUACUCCUUUCGUCCCAAAAAAAAPMRD
osa-miRf11271-akrGCCACCAACCGGGACUAAAGAUCAPMRD
osa-miRf11272-akrUUGGUGUUACCAACCAGGACPMRD
osa-miRf11273-akrUGCCAUCGCCAUUAGGGUUCPMRD
osa-miRf11274-akrGUUGGCAUGCCACGUGGACAPMRD
osa-miRf11275-akrCUACGUGGCAUGCCAAGGUGGCPMRD
osa-miRf11276-akrCCACGUGGCAUGCCAACGUGGPMRD
osa-miRf11277-akrGGCCCGUCACAGGUGACUUGAUACCPMRD
osa-miRf11278-akrGGAUCCUGCCGGUCAGACCGPMRD
osa-miRf11279-akrUAACUUUAGUCCCGGUUGGUAPMRD
osa-miRf11281-akrUCGGCAGAUUUGGUCGAAGGPMRD
osa-miRf11282-akrAAAAUGAUCUUCGUAGGCGGACPMRD
osa-miRf11283-akrGUGGUGUUGACUCGGUCUUCPMRD
osa-miRf11285-akrCAUGUCCUCGUCCUAGGUGAAACPMRD
osa-miRf11287-akrCUGUCGAACUGGGGCAGUUCGACAPMRD
osa-miRf11288-akrUGUCCAACGUUUGACUGUCCGUUUUAUPMRD
osa-miRf11289-akrAGAAGGGGUCAUAUUCCCUUPMRD
osa-miRf11290-akrGUGACACCAACCGGGAGUAAAPMRD
osa-miRf11292-akrUUAAGUGGUCCGCCUGCGAAPMRD
osa-miRf11293-akrGGCUCGUACUCCUGCUUGUCGACGUPMRD
osa-miRf11294-akrGGUUGGUACUACCAACCGGGAPMRD
osa-miRf11295-akrUGACGGGCCCUAGUUGUGGCUCPMRD
osa-miRf11297-akrUCCCGGUUGGUAACACGAACCGGGAPMRD
osa-miRf11298-akrAUCUUUAGUCCCGGUUGGUAGCPMRD
osa-miRf11299-akrGUGUAUUCCAUGUCGACGGCPMRD
osa-miRf11300-akrCAGGGAGCUCUUGAUGUUUGUGAPMRD
osa-miRf11301-akrGGUUACUGUAGCACUUAUGGPMRD
osa-miRf11302-akrGCGUCGCUUAUAUGGUCCGCPMRD
osa-miRf11303-akrGGCAUGUGGGUCCCACAUGUUUPMRD
osa-miRf11305-akrGACCUCUUAAGUGGUCCACCUGPMRD
osa-miRf11306-akrUUUCAACCGGGACUAAAGAUPMRD
osa-miRf11307-akrGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf11308-akrUGGGCAAUGCUAGAAAGUCUUAPMRD
osa-miRf11309-akrGAUCUUUAGCCCUGGUUGGUPMRD
osa-miRf11310-akrUAGCAAGUUCGAGUGGGAUAPMRD
osa-miRf11312-akrCGGUUGGUGUUACCAAUCAGPMRD
osa-miRf11314-akrGAAGAGGUGCUCCACAUCUUCPMRD
osa-miRf11315-akrUUGGUACUGUGGGGUACCGGUPMRD
osa-miRf11316-akrGGUACUCCCUCCGUUCCUAAAUAPMRD
osa-miRf11318-akrUAUCAACCGGGACUAAAGAUCCCPMRD
osa-miRf11319-akrGGAGCUAGAGCUGUGCCAAACGGGPMRD
osa-miRf11320-akrGAGCUCGAGCUCGAGCCAAGCPMRD
osa-miRf11321-akrAUAGGCUUGGCUCGAGCUCGAPMRD
osa-miRf11322-akrCCCGGUUGGUGCUACCAACCGAGAPMRD
osa-miRf11323-akrAUCAAGCUCGAGCAGCUUGCGAPMRD
osa-miRf11325-akrCUCCAACCGGGACUAAAGUUPMRD
osa-miRf11326-akrCGGUUGGUAACUCCAACCGGPMRD
osa-miRf11327-akrAAUCCAACAGCUAUCUUGGCAPMRD
osa-miRf11329-akrAACUUUAGUCCCGGUUGGUAUUPMRD
osa-miRf11330-akrCCGGUUAGUGUUACUAACCAGGAPMRD
osa-miRf11333-akrACGUGAUACUCGCGAGGUAUCPMRD
osa-miRf11336-akrUGAUACCGGUAAGGUAUCAGGACPMRD
osa-miRf11337-akrCGCGAUACCAGAUAGGUAUCACPMRD
osa-miRf11338-akrUUAGUCCCGGUUGGUGACACCPMRD
osa-miRf11339-akrUCCCGAUUGGUAACACCAACCPMRD
osa-miRf11341-akrCGCGCCGACGAUGACGGUGGAGUPMRD
osa-miRf11343-akrCUCGUCGCUGACGAGUGGGGCCAPMRD
osa-miRf11344-akrAUCUUUUGGCCACGCCAGCCPMRD
osa-miRf11345-akrCCUGGUUGGCAUUGAGGGAGPMRD
osa-miRf11346-akrCUGGUGUGGCAAAACAACGCPMRD
osa-miRf11347-akrCGGCGUCGUCUUCCCUCCCCAUGAPMRD
osa-miRf11348-akrAAGAACCUAGGACUGGAUGGGAUAUPMRD
osa-miRf11349-akrUCAGCGCCGUGCUAUUUGGCPMRD
osa-miRf11352-akrAGGGAUUUUGGAAGGAGGUGACAPMRD
osa-miRf11353-akrGUGGAUGCCUUAACACGAAGPMRD
osa-miRf11354-akrGUAGCUGUCCUUCCACGCCAPMRD
osa-miRf11355-akrGGUGGAGGUGGAGCUGUGCCAAAPMRD
osa-miRf11356-akrAGGGUCUGCUUGGCACAGCUPMRD
osa-miRf11357-akrUGGAGCUGUGCCAAAUAGGCCCUGPMRD
osa-miRf11358-akrAAGGCACCUACCUUUGACGGPMRD
osa-miRf11359-akrCCGUGAGGUACCGGUAUUUCGAGAUAPMRD
osa-miRf11360-akrCCGUGAGGUAUCGGUAUCUCGAGPMRD
osa-miRf11363-akrCGCCAAGUGCAUUGGCGCUGPMRD
osa-miRf11364-akrAUGUGUCAUCCGUGACGGACCUGPMRD
osa-miRf11366-akrAUGAGGUACCAUGAGGUACCAPMRD
osa-miRf11368-akrCCGGUUGGUAACACAAACCGGPMRD
osa-miRf11370-akrAAGUUGGUUCCCAGCCCGGAPMRD
osa-miRf11371-akrAUCCAUGGCCGCUCCCAUGGCUGPMRD
osa-miRf11372-akrUGUUACUCCCUCCGUCCCAUAAUAPMRD
osa-miRf11373-akrGGGUGUAAGUGGCUAACCCGCGAAACPMRD
osa-miRf11374-akrAUUCUGGCCCGUCACAGGUGAPMRD
osa-miRf11375-akrCCGGUUGAUGUUACCAACCGGPMRD
osa-miRf11376-akrAUCGCGCGGUAACCGCGGUAAPMRD
osa-miRf11377-akrCUGUCGAACUGCGGUAGUUCPMRD
osa-miRf11378-akrUUGCUCGAGGUUGCGCAGCAUGPMRD
osa-miRf11379-akrUUAGUCCAGGUUGGUGUUACCPMRD
osa-miRf11381-akrGAUGACCCUCAUCAGUGACGGPMRD
osa-miRf11382-akrGUGUCCAACGUUCGACUGUCCGUPMRD
osa-miRf11383-akrAUCUUUAGUCCCGGUUGGUAGAPMRD
osa-miRf11385-akrUGUUGCCGAUUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11386-akrGCCGAUUGGUUUCCAGUCGGCGGCAPMRD
osa-miRf11387-akrGCCAGCGAAGAUCCAUUUUCGCUGGPMRD
osa-miRf11388-akrCCGGUUGAUAACAUCAACCGGPMRD
osa-miRf11389-akrGCGAAAAUCGGAUUUUCGCGUGCGGPMRD
osa-miRf11390-akrCACCGUCGUCGCUGCCACACPMRD
osa-miRf11392-akrCUCAGCGCCAAGUUAUUUGGCGCUGPMRD
osa-miRf11393-akrCUCAGCGCCAUUGACCUUGGCGCUPMRD
osa-miRf11395-akrCCGGUCUGACCGGUCCACAUPMRD
osa-miRf11396-akrCUGGUUGGUGACACCAACCGPMRD
osa-miRf11398-akrCCGGUUGGUAACACCAACCGPMRD
osa-miRf11399-akrUCGGCUGGUGUUACCAACCGPMRD
osa-miRf11400-akrCCCACAAGUGGAGCUAUAGGPMRD
osa-miRf11401-akrAUGGCCCGUCAGAGGUGAGGUPMRD
osa-miRf11402-akrGUAGGACUUGGAGAUAUCGGACPMRD
osa-miRf11403-akrAUCUUUAGUCCCGGUUGGUGCUPMRD
osa-miRf11405-akrACUGGGAUCUUUAGUCCCGGUPMRD
osa-miRf11406-akrUCCCGGUUGGUGCUACCAACCAGGPMRD
osa-miRf11407-akrGCUGAGCUUGAGCCAAGUUCAPMRD
osa-miRf11408-akrAGGGUCAUCGGUGACGGGCUAPMRD
osa-miRf11409-akrUGUCCAACGUUUGACUGUCCAUCUUAUPMRD
osa-miRf11410-akrUCCCGGUUGGUGCUACCAACCPMRD
osa-miRf11411-akrAUCUUUAGUCCCGGUUGGUGCPMRD
osa-miRf11412-akrUACUUUAGUCCCGGUUGGUAPMRD
osa-miRf11413-akrACUCCCAGGUGUAUGUACUAPMRD
osa-miRf11414-akrUCGUGAUGACGUGGACGAAUPMRD
osa-miRf11415-akrGAGAGCAGGAUGCAGCCAAGGPMRD
osa-miRf11416-akrCAUCCUUGGCUGCAUCCUGCUPMRD
osa-miRf11418-akrUACCUCAUGGUACCUCCUCAAGGAPMRD
osa-miRf11419-akrAGGGUUAAGCGUGCUUGGCCPMRD
osa-miRf11420-akrUGUUACCAACCGGGACUAAAGAPMRD
osa-miRf11428-akrUGAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11434-akrAGCUGGAGCUCAGCCAAACAPMRD
osa-miRf11435-akrGAUCCGUCGCCAUCGAGCUUGPMRD
osa-miRf11436-akrGCGCUGAACAUAGACACUUCAACPMRD
osa-miRf11437-akrGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11438-akrCCUUUGUUGCACAAUGGACCPMRD
osa-miRf11439-akrUGCCAACGUUUGACUGUCCAUCPMRD
osa-miRf11440-akrGGUCAUCGGUGACGGGCUUCAPMRD
osa-miRf11441-akrUGCACCACCGGCUGAAUUGGUGGUPMRD
osa-miRf11443-akrCACGGGAUAAUCGAUUAUCCPMRD
osa-miRf11444-akrAUCUUCGUAGGCGGGCGGUCPMRD
osa-miRf11445-akrGAUGACUCAUCUGUGACGGGCCCPMRD
osa-miRf11446-akrACUCAUCUGUGACGGGCCCUPMRD
osa-miRf11447-akrACUCAUCUGUGUCGGGCUCUAUPMRD
osa-miRf11448-akrGCCAUCGAACACGACCAGCUPMRD
osa-miRf11449-akrUAACUUUAGUCCCGGUUGGUGUUPMRD
osa-miRf11450-akrCCCGGUUGGACAACUGGAACPMRD
osa-miRf11452-akrUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf11454-akrAGUCCCGGUUGGUAACACCAACCGAGAPMRD
osa-miRf11456-akrUCUCGGUUGGUAUUACCAACCAPMRD
osa-miRf11457-akrACUUGCAUUGUGAAACGGAGGGPMRD
osa-miRf11458-akrCUCAUGGUGACGUGGAUGAAPMRD
osa-miRf11459-akrGUUGCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11460-akrCCGACUGGUUUCCAGUCGGCGGCPMRD
osa-miRf11461-akrAGCGCCAUGCUAUUUGGCUCUGPMRD
osa-miRf11462-akrAAAACCAUGGGCCCACAUGUCAAUPMRD
osa-miRf11463-akrAAAACCAUGGGCCCACAUGUPMRD
osa-miRf11464-akrGAUGAGUCAUCUGUGACGGGCCCUAPMRD
osa-miRf11466-akrGCCCGUCACAGAUGACUCAUCPMRD
osa-miRf11468-akrGGUUGGUGUUACCAAACGGGAPMRD
osa-miRf11469-akrGCUCGUUAUCCUAACGAGCUPMRD
osa-miRf11470-akrACUGUACCGUGCCUUUGUCAPMRD
osa-miRf11471-akrUCAGUGAUAAAGGCACGGUGCAPMRD
osa-miRf11472-akrUUGCCAUGCCUGUCUGGCUGPMRD
osa-miRf11473-akrGCCUUAAUUCCGGCCCAUCCPMRD
osa-miRf11474-akrAAUGAUCUUUAGUCCCGGUUGGAPMRD
osa-miRf11475-akrUCGGUGACAAGAUGAGGGACCUPMRD
osa-miRf11477-akrCUGUCGAACAACCGCAGUUCPMRD
osa-miRf11478-akrUCCUGGUUGGUGUUACCAACCGPMRD
osa-miRf11479-akrUCCCGGUUGGUAACACCAACAGGPMRD
osa-miRf11481-akrGUGUCAUCUGUGACGGGCUCCPMRD
osa-miRf11482-akrGUCCGGAGGUUCCGAUCAAUPMRD
osa-miRf11486-akrGGCUCGUUAUCCUAACGAGCUPMRD
osa-miRf11487-akrGCCCGUCACAGAUGAGUCAUCPMRD
osa-miRf11488-akrCAGAUGAGUCAUCGGUGAUGGGPMRD
osa-miRf11489-akrCCCGGUUGGUAACACAAACCGGPMRD
osa-miRf11490-akrGAUCUUUAGUCCCGGUUGGUAUUPMRD
osa-miRf11491-akrUGGGCAAUACUAGAAAGUCUPMRD
osa-miRf11493-akrAUCUUUAGUCCCGGUUGAUAGCPMRD
osa-miRf11494-akrCUAUCUUUAGUCCCGGUUGAPMRD
osa-miRf11495-akrGUGGCCUCCUCGAGCUCCUCUGPMRD
osa-miRf11496-akrGGUUGGUGUCACCAACCGGGAAPMRD
osa-miRf11497-akrACAGGGAUCUACGUAGUACGACAUPMRD
osa-miRf11498-akrAGCGCCAAAGUCAAUGGCGCPMRD
osa-miRf11499-akrCCGGUUGAUAUUACCAACCGPMRD
osa-miRf11500-akrCGCAGGCAUCAGGUGGAGGAPMRD
osa-miRf11501-akrGUGAUGCUUGCGAUGUAUCAGGUPMRD
osa-miRf11502-akrGUGCCUCUAUCUGCAUUGCUGPMRD
osa-miRf11503-akrUGGAGCUGGAACUUUGCCAAACAGPMRD
osa-miRf11504-akrUGGAGCUGGAACUUUGCCAAPMRD
osa-miRf11505-akrUCAGUGACUCAAAGUCAGAGGGAAGPMRD
osa-miRf11506-akrGGGUUCACAUGUCAGUGAGCAPMRD
osa-miRf11508-akrAGAGCCUGUUUGGCACAGCUCUAGCUCPMRD
osa-miRf11509-akrGAGCUGGAGCUCAGCCAAACAGGPMRD
osa-miRf11510-akrCUGUUUGGCACAGCUCUAGCUCPMRD
osa-miRf11513-akrAGUGCUGGCUGCUGCAGCAGPMRD
osa-miRf11514-akrCUGUUUGGCUGAGCUCCAGCUPMRD
osa-miRf11515-akrAAUGCAGCCAUGGUCCAUCGUCPMRD
osa-miRf11516-akrUCGGUCGGACGAUCGUCAGGPMRD
osa-miRf11517-akrAUAGCCGAACAGGCCCUUUGPMRD
osa-miRf11518-akrGCUGCCGCUUCCGCCUUGGAGAPMRD
osa-miRf11519-akrCAUUUUGUCAGGAAGUUCCGGGPMRD
osa-miRf11521-akrGGUCACAUCCCCUCCUAGGUPMRD
osa-miRf11522-akrCUUUAGUCCCGGUUGGUGAUPMRD
osa-miRf11523-akrUAUGUACUCCUUUCGUCCCAUAAUAUPMRD
osa-miRf11524-akrGGGAUCUUUAGUCCCGGUUGGUAPMRD
osa-miRf11525-akrCUCGCGAGCUGCUUGAGCUUGGCUPMRD
osa-miRf11526-akrCGAGCUCGAAUAGCUCGUCGPMRD
osa-miRf11528-akrGGCUUGUUAUCCUAACGAGCUAPMRD
osa-miRf11529-akrUGCCGACUGGACUCCAGUUGGPMRD
osa-miRf11530-akrGCAGCAGCUGCUGCUCCCUUUCCUPMRD
osa-miRf11531-akrGUUCGUGGCUAACCCACUUAPMRD
osa-miRf11532-akrCCUGUCGAACGGAGGCAGUUCGAPMRD
osa-miRf11533-akrGAGCCUGGCUUGUCUUGGCUCPMRD
osa-miRf11534-akrUCGAACCGUGGCAGUUCGACAGGPMRD
osa-miRf11537-akrUAACUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11538-akrUGGCGGCCACAAUGUCCUCCAPMRD
osa-miRf11539-akrAGCUGCCGACUGGUUUCCAGUCGGPMRD
osa-miRf11540-akrUUCCAACCGGGACUAAAGUUPMRD
osa-miRf11541-akrCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11542-akrCUGGUUGAUAACACCAACCGGPMRD
osa-miRf11543-akrUCAGUGCCAGGACCGUUGGCGCUGAPMRD
osa-miRf11544-akrCAUCUGUGACGGGCCACAACUPMRD
osa-miRf11545-akrAUACUCCUUGUAUGACGCCUGCPMRD
osa-miRf11546-akrUAGUCCCGGUUUGUAACACCAACCGGPMRD
osa-miRf11549-akrCAACCGGGACUAAAGAUGAUCPMRD
osa-miRf11550-akrCCCGGUUGGUACUACCAACCGAGAPMRD
osa-miRf11551-akrAGCGCCAAGGCGGUUGGCACUGAGPMRD
osa-miRf11553-akrAGCCAUCUUGAGUCCCGGUUPMRD
osa-miRf11554-akrCCGGUUGGUGUUACCCACCAPMRD
osa-miRf11557-akrUCCUUGAGGAGGUACCAUGAGGUAUPMRD
osa-miRf11559-akrAGACCUGCCGUGCAAUGCCGGUCAPMRD
osa-miRf11560-akrUUAUCUUCGCCCCUUGCAAAPMRD
osa-miRf11561-akrUUCGCGGGUUAGUCACUUACACCPMRD
osa-miRf11562-akrUACGGCUGCUUAAGACGCCCPMRD
osa-miRf11563-akrGGGGUUACCAACCGGGACUAAAPMRD
osa-miRf11564-akrGGUGUUACCAACCGGGACUAAAPMRD
osa-miRf11565-akrUGUCGAACUGCGGUAGUUCGACAGGUPMRD
osa-miRf11568-akrCUCUUGGUCGAGACGCCAGUPMRD
osa-miRf11570-akrCCUUCUCGCUCUCCACUAGGPMRD
osa-miRf11571-akrAGCUCGUCAUAGAUGACCUCPMRD
osa-miRf11572-akrGGUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11573-akrUCCUUGAGGAGGUACCAUGAPMRD
osa-miRf11575-akrCCCGGUUGUUAAUACCAACCGGPMRD
osa-miRf11578-akrUCUGCAGUCACUGCACCGUGCCPMRD
osa-miRf11579-akrUGUUUGGGGGAGUUUCUGGCAPMRD
osa-miRf11580-akrCGUCAGAGGUGACUGUCACCPMRD
osa-miRf11581-akrGUGCACGUGGAAAACGAGGGAGAGAPMRD
osa-miRf11583-akrUACCUCAUGGCACCUCCUCAAGAACCGUPMRD
osa-miRf11586-akrUUCUUGAGGAGGUGCCAUGAGGUACPMRD
osa-miRf11587-akrAGAUCGAUCUUUAGUCCCGGUUGPMRD
osa-miRf11588-akrUCCCGGUUGGUGUUAUCAACCGGGACUAPMRD
osa-miRf11589-akrUCUCGGUUGGUGUUACCAACCPMRD
osa-miRf11590-akrUCCCGGUUGAUAACACCAACCGGGAPMRD
osa-miRf11592-akrAGACCGGCUGUGCAAUGCCAGUCPMRD
osa-miRf11595-akrCAUCGGUGUUGGAGGUGGCPMRD
osa-miRf11596-akrGAUCUUUAGCCCCGGUUGGUPMRD
osa-miRf11597-akrACCGGUCUGACCGGCUGAUGGPMRD
osa-miRf11598-akrAAUUGCUUGUUUGUGUGCCCPMRD
osa-miRf11599-akrGCAACGAUAACGUGGGAAAUPMRD
osa-miRf11601-akrUGUCGCCCUCUGUAAGGGCGGUAAGPMRD
osa-miRf11603-akrCUACUCCCUCCGUCCCAAAAUAAGUPMRD
osa-miRf11604-akrCUACUCUCUCCGUCCCAAAAUAAAPMRD
osa-miRf11605-akrCUACUCUCUCCGUCCCAAAAPMRD
osa-miRf11608-akrACUCUCUUCCAUGCCGGAUCPMRD
osa-miRf11609-akrAUAGGCUUGGCUCGAGCUCGPMRD
osa-miRf11610-akrUUAGCUCGACUCGGCUCGUUPMRD
osa-miRf11611-akrUUUUGCAGGCGGACCUCUUAPMRD
osa-miRf11612-akrUACUCCCUCCGUCCCUAAAUAUAPMRD
osa-miRf11613-akrCUUCUCCACCUCGAUCCUCGGPMRD
osa-miRf11614-akrCGUGUCCAACGUUUGACUGUCPMRD
osa-miRf11615-akrAACUGGAGCUAGAGCUGUGCCPMRD
osa-miRf11616-akrGAUACUUGCGAGGUAUCAGGUPMRD
osa-miRf11617-akrUUUAGGCCCGAUUGAGAUGAGPMRD
osa-miRf11618-akrGUACUCCCUCAGUCCCAAAAPMRD
osa-miRf11619-akrACCUACUCCCUCUGUCCCAAAAUPMRD
osa-miRf11620-akrUUGACCAGCUCGGCCAUGAUPMRD
osa-miRf11622-akrUGCCAUCACCGGUAGCAGCACUUPMRD
osa-miRf11623-akrGUACUAGGAUGUGUCACAUCCPMRD
osa-miRf11624-akrCUACUCCCUAUGUCCCAAAAPMRD
osa-miRf11626-akrUGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf11627-akrCCCCUCCUGCCAGAUCUGGCAGPMRD
osa-miRf11628-akrGGACCCACAUGUCAGCCUCACPMRD
osa-miRf11629-akrCAUCGAUGCACGGCACCGUGCACPMRD
osa-miRf11632-akrUCGAGCCGAGCUUGAGCUUGUPMRD
osa-miRf11633-akrGUCAGACCGGCCGUGCAAUGCCGGUPMRD
osa-miRf11634-akrCGUCCCACGUGGCAUUGACGUGACGPMRD
osa-miRf11637-akrCGGUCAGACCGGCCUGAUGGPMRD
osa-miRf11638-akrCCGAUGCCGAACGGGUAUGGAAUPMRD
osa-miRf11639-akrCUCUGUGUCCAGGAGAACCCPMRD
osa-miRf11640-akrGGUAUUACCAACCGGGACUAPMRD
osa-miRf11641-akrUCGAGCUUGGUCAAGCUCGAPMRD
osa-miRf11642-akrCGGUCAGACCGGUCGUGCAUUGCCGGUPMRD
osa-miRf11644-akrCAUAGGUAUCAGGCCUGGUAPMRD
osa-miRf11645-akrAUAGGUAUCAGGUCUGAUACCUAPMRD
osa-miRf11646-akrGCCUGAUACCUAUAGGUAUCAGPMRD
osa-miRf11647-akrUGUCCUUGCUGGUGGCGGACPMRD
osa-miRf11648-akrGAUGACUCAUCUAUGACGGGCPMRD
osa-miRf11649-akrAAACCGUGCAAAGGAGGUCCCPMRD
osa-miRf11650-akrAUACUGCCAUGGGACCUCCUUUGCAPMRD
osa-miRf11651-akrGGAGGUCCCAUGGCAGUAUUUPMRD
osa-miRf11652-akrGAGGUCCCAUGGCAGUAUUUPMRD
osa-miRf11653-akrAUCUUUAGUCCCGCUUGGUGAGAPMRD
osa-miRf11656-akrUUCUCGCUGACGUGGUCGCUPMRD
osa-miRf11657-akrGGCGCCAACCACUUUGGCGCUGAGGUPMRD
osa-miRf11658-akrAGGUGUCUUUGCUGGUGGCCPMRD
osa-miRf11659-akrCCCGGUCCCAUAUGUCAGCCUPMRD
osa-miRf11660-akrGAAGGAGGCUGACAUAUGGGACCPMRD
osa-miRf11661-akrCCCGGUCUCACAUGUCAGCCUCCUUPMRD
osa-miRf11662-akrGCACACCGACGAGGUACCGGUPMRD
osa-miRf11663-akrGGAGCUAGAGCUGUGCCAAACCGGPMRD
osa-miRf11664-akrGGAGCUAGAGCUGUGCCAAAPMRD
osa-miRf11665-akrACCGGCAUUGCUUGGCCGGUPMRD
osa-miRf11667-akrGAUGAGUCAUCAGUGACGGGCCPMRD
osa-miRf11668-akrACCGGUGUAGAUCAAUCGGUCPMRD
osa-miRf11669-akrUCAACAACCGGGAGUAAAGAPMRD
osa-miRf11670-akrGUUGGUGUUACCAACCGGGACUAPMRD
osa-miRf11672-akrGUCUUGUCCCAGUCCCCACUGPMRD
osa-miRf11673-akrGCCCGUCACCGAUGACACUCAUCPMRD
osa-miRf11674-akrAGGGCUGCAAUCUGGUGGUUPMRD
osa-miRf11675-akrCCCACAUAUCAGUGACUCAAPMRD
osa-miRf11676-akrAAGGAUGUGUCCCAUCCAGUPMRD
osa-miRf11677-akrAGUUGGUGCCCGUCACGGAUGAPMRD
osa-miRf11678-akrUUCGCGGGUUAACCACUUACAPMRD
osa-miRf11679-akrAGAUCUUUAGUCCCGGUUGGUPMRD
osa-miRf11680-akrAUUCGUCUCGCGGUUUACAGGCGPMRD
osa-miRf11682-akrACGUAAAGUCAGAGGGACGUGGPMRD
osa-miRf11683-akrUCCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf11684-akrCCGGUUGAUAAUACCAACCGGPMRD
osa-miRf11686-akrCGGCGUGUGCCAUCCCACACAUCPMRD
osa-miRf11687-akrCAUGUGCCAUCCCACACGUCPMRD
osa-miRf11688-akrGUACCGUGAGGUACUGGUACCUCGAPMRD
osa-miRf11689-akrAAGGUACCGGUACCUCAUGGUAPMRD
osa-miRf11690-akrCACGGGAUAAUCGAUUAACCPMRD
osa-miRf11691-akrGCGGCGUCAGCUAGGUUUGGGGPMRD
osa-miRf11692-akrUCCCCGGUUCUGAUCACUUGCPMRD
osa-miRf11693-akrUGACGUGAAGUCAGAGGGACGUGGPMRD
osa-miRf11694-akrCCGCCUGCGAAAAUCUAUUUUCGCAGPMRD
osa-miRf11695-akrCCUGCGAAAAUCAUUUUCGCAGGCGPMRD
osa-miRf11696-akrCGGUCCUUGAGGAGGUACCAUGAGAUACPMRD
osa-miRf11699-akrCUUGAGGAGGUACCAUGAGAUAPMRD
osa-miRf11701-akrUCGAGGUACCGGUACCUCACGGUACUPMRD
osa-miRf11702-akrGGUACCGGUACCUCACGGUACPMRD
osa-miRf11703-akrAGCUCACGUCGAUUUGGUUGPMRD
osa-miRf11704-akrCCAAAUCGAGGUGAGCUCUAPMRD
osa-miRf11705-akrGAGACAACUACUCCCUCCGUUCUPMRD
osa-miRf11706-akrUCCCGGUUGGUACUAUCAACCGGGAPMRD
osa-miRf11708-akrGUUACCAACCGGGACUAAAGAUPMRD
osa-miRf11711-akrUCCUUAAGGAGGUACCAUGAGGUACPMRD
osa-miRf11714-akrUUCUAGCAUUGCCUACAUUCPMRD
osa-miRf11715-akrGCUUGCGUCGUAAGCCGGCUUPMRD
osa-miRf11716-akrUAGUCCCGGUUGGUAACACCAACCGGPMRD
osa-miRf11718-akrGGUUGGUAAUACCAACCGGGAGUPMRD
osa-miRf11720-akrUUAGUCCCGGUUGGUGUUAAPMRD
osa-miRf11723-akrGUAUCAUCAUGUCCGAACGGGPMRD
osa-miRf11724-akrAGGCCCGUCACAGAUGACUCPMRD
osa-miRf11726-akrUUUCCCGGUCUGUAACACCAACPMRD
osa-miRf11727-akrGACCGCACGGGAUAAUCGAUUAUCCPMRD
osa-miRf11728-akrACACUGAUGAUCCCCUUAUCGPMRD
osa-miRf11729-akrUGAGGCUGACAUGUGGGUCCGAPMRD
osa-miRf11730-akrUCGGACCCACAUGUCAGCCUCACUCPMRD
osa-miRf11731-akrGGGCCUACAUGUCAGCCUCACPMRD
osa-miRf11732-akrCUCUCUCUCCCUUGAAGGCUAUCUPMRD
osa-miRf11735-akrUUCCCGUGUCCAACGUUUGACUGUCUGUPMRD
osa-miRf11736-akrCCAACAGGGUAGCCUUCCUCPMRD
osa-miRf11737-akrACUCCGUCCCAUAAUGUAGCPMRD
osa-miRf11738-akrAUACUCCCUCCGUCCCAAAAAPMRD
osa-miRf11739-akrGGGGAUUAACUGAACAAGGCUUGAPMRD
osa-miRf11741-akrUCAGUGCCAAACACCUUGGCGCUGAGPMRD
osa-miRf11742-akrAGCUCGAGCUAGCUUGUUAGPMRD
osa-miRf11743-akrAGCGAAAAUGGAUCUUUGCUGGCPMRD
osa-miRf11744-akrGCCAAUGUCCAUGGCGCUGAPMRD
osa-miRf11745-akrCUUAUCUGUGACGGGCAUUAPMRD
osa-miRf11746-akrUGUUACCAAACGGGACUAAAGAUPMRD
osa-miRf11747-akrACCAAACGGGACUAAAGAUCCPMRD
osa-miRf11748-akrUAGUCCCGGUUGGUAACACCAAPMRD
osa-miRf11749-akrUUGGUGUUACCAACCGGGACUAAAGPMRD
osa-miRf11750-akrCAGUCCUUGAGGAGGUACCACGPMRD
osa-miRf11751-akrCCGGUUGGUAAUACCAACCGGPMRD
osa-miRf11752-akrCCGGUUGGUAUUACCAACCGGPMRD
osa-miRf11753-akrUCCCGGUUUUCCAACCGGGAGUAAPMRD
osa-miRf11754-akrAGGUAUCGGUUGAUACCUAGPMRD
osa-miRf11755-akrCUGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf11756-akrCUGGUUGGUAACACCAACCGPMRD
osa-miRf11757-akrUCUUUAGUCCCGGAUGGUGUUACCPMRD
osa-miRf11758-akrGAGCUCGAGCUCGAACGAGCUCGAPMRD
osa-miRf11759-akrGGCACUGAUGCAGCAUCAGUGCCPMRD
osa-miRf11762-akrAAUCUUUAGUCCCGGUUGGUGUUAPMRD
osa-miRf11763-akrCCGGUUGGUAACAACAACCGGGAPMRD
osa-miRf11765-akrAUGUCGUUGGCGUCAUCCCUUCPMRD
osa-miRf11766-akrGCUCGUUAUCCUAACGAGCCAPMRD
osa-miRf11767-akrGGGAGGAUAGGCUUGGCAUCCAAPMRD
osa-miRf11768-akrUAGGCUCGAUUUGAGCUCGGCUCGPMRD
osa-miRf11769-akrGAACCUCCUGGUAACCCUCUAPMRD
osa-miRf11771-akrUCCCGGUUGAUGUUACCAACCPMRD
osa-miRf11772-akrCCUAGAUCUGGCCGGAGGAGGAPMRD
osa-miRf11773-akrGCCAUUGCCAUGGCCAUGGCCUCGPMRD
osa-miRf11774-akrUUGCCAUUGCCAUGGCCAUGGCPMRD
osa-miRf11775-akrACACCGAAGGUCCCUUAACUUGUPMRD
osa-miRf11776-akrACACCUAAGGUCCCUCAACUUGUPMRD
osa-miRf11777-akrUAAGGGACCUUCGGUGUACUPMRD
osa-miRf11778-akrUGAGGGACCUUAGGUGUACUPMRD
osa-miRf11779-akrCACCGUUAGGGUUCCGUCCAUPMRD
osa-miRf11780-akrCCUCCGUCCAAAAAUAUAGCAACCUPMRD
osa-miRf11781-akrGGACCCACAUGUCAGUGACUCAAUPMRD
osa-miRf11782-akrGAUCUUUAGUUCCGGUUGAUAPMRD
osa-miRf11783-akrUGCCGACUGGUUUCUAGUUGGCGPMRD
osa-miRf11784-akrCUGGUUGGUAUCACCAACCGPMRD
osa-miRf11786-akrGACGGAGUGGUACGGUUCCAAUUPMRD
osa-miRf11791-akrAUCGGAAGCAAUUUGGUACCPMRD
osa-miRf11793-akrCCUCCUCAAGGACCGUAGAAPMRD
osa-miRf11795-akrAUGGUACCUGCUCAAGGACCGUAGAPMRD
osa-miRf11796-akrGGUCCUUGAGGAGGUACCAUGAAGUACPMRD
osa-miRf11798-akrGGUUGGUAACACCAACCGGGAGUPMRD
osa-miRf11800-akrGGUGUUACCAAUCGGGACUAPMRD
osa-miRf11801-akrGGUGUUACCAACCAGGACUAPMRD
osa-miRf11802-akrUAGUCCCGAUUGGUAACACCAACCGGPMRD
osa-miRf11803-akrAAAAAGUCCACUUAGACUCCCUPMRD
osa-miRf11804-akrUCUCGGUUGGUAACACCAACCGGUPMRD
osa-miRf11806-akrCCUGGUUUUCUUGGAGCAUGAGGUUPMRD
osa-miRf11808-akrGUACUCCCUCCGUCCCUAAAUAUAPMRD
osa-miRf11810-akrAUACUUAUCGGUGACGGGCUUUPMRD
osa-miRf11811-akrUCGCAGAUGAGUCAUCCGUGAPMRD
osa-miRf11812-akrGAAGAUCUAUUUUCGCAUGCGGCPMRD
osa-miRf11813-akrAAAGGACCGUAAAAUUGCUCPMRD
osa-miRf11814-akrGGGUCCACAUGUCAGUCACCAPMRD
osa-miRf11815-akrGCUGGCAAUGGCAGAUUGGCAGUPMRD
osa-miRf11816-akrAGUCCCGGUUGGUAACUCCAACCGGGACPMRD
osa-miRf11817-akrGUGCGAGGCAUUUUCGUCUUPMRD
osa-miRf11818-akrCUGGUUGGUGUUACCAACCGAPMRD
osa-miRf11820-akrAUGACUCAUCUCUGACGGGUUPMRD
osa-miRf11821-akrUGCUUUGGCUGAUCAGCUAUUPMRD
osa-miRf11823-akrUGAUCUUUAGUCUCGGUUGGUAPMRD
osa-miRf11824-akrUGAUACCUACCAGGUAUCAUPMRD
osa-miRf11825-akrACCUCGAGGUACCGGUAUCUCACPMRD
osa-miRf11826-akrUAUCUCGAGGUACCGGUAUCUCPMRD
osa-miRf11827-akrAGUCCUGGUUGGUAACACCAACPMRD
osa-miRf11828-akrGUUGGUAACUCCAACCGGGACPMRD
osa-miRf11829-akrACGCGGAGGAGGUGGUGUUCUPMRD
osa-miRf11830-akrACAUGGCGGUGUUGACCUGGPMRD
osa-miRf11831-akrAGGUCAACACCGCCAUGUAGPMRD
osa-miRf11832-akrUCCCGGUUGAUGAUACCAACCGGGAPMRD
osa-miRf11833-akrUUUAGUCCUGGUUGGUAACACCAPMRD
osa-miRf11834-akrUCCGGUUGGUAAUACCAACCGGGAPMRD
osa-miRf11835-akrAGAGGGCCCACAUGUCAGUGAUPMRD
osa-miRf11836-akrGCCGCCAUUCUAGCUGUUGUUPMRD
osa-miRf11838-akrAGCUAGCUACAGAUCUGUAGCPMRD
osa-miRf11839-akrCGGUCAGACCAGCCUGAGGCGUPMRD
osa-miRf11841-akrCGUGCGCGCGAAAAACGAGGGPMRD
osa-miRf11842-akrUUUCCGUCCGCCUUGAUCGCPMRD
osa-miRf11843-akrUUUCGUCCGCCUUGAUCGCUPMRD
osa-miRf11845-akrGGCUCGUUAUCCUAACGAGCUAGAAPMRD
osa-miRf11848-akrGCGAGAUGUUUCUCCCUUCGPMRD
osa-miRf11851-akrUCCUCCGCCAGCGAAAAUGUPMRD
osa-miRf11853-akrGGUUGGUGACAUCAAUCGGGAPMRD
osa-miRf11855-akrUCGAACAGCAGCCGUUCGACPMRD
osa-miRf11856-akrUUGGUGCCCGUCACCGAUGACPMRD
osa-miRf11858-akrGAAGAUCGCCGAUCUUCGCAGPMRD
osa-miRf11859-akrUUAGGGUUCCGACCAUUCCACPMRD
osa-miRf11860-akrUGAUCUUUAGUCCCGGUUGGUAAPMRD
osa-miRf11861-akrCCGGAGAGAAGACGAUGACAPMRD
osa-miRf11862-akrGCAGAACAUCAGCAUCCUCCAPMRD
osa-miRf11863-akrGUUAUCCCUCACGGCUGGCAUPMRD
osa-miRf11864-akrUGCGCCAUAGUAUAAUGGCUUGGCPMRD
osa-miRf11865-akrGUGGCACGCCCUGGUGUAGAUCCCGPMRD
osa-miRf11866-akrCUUUAGUCCCGGUUGGUGGCPMRD
osa-miRf11867-akrAGGGUAGGCCGGUCAGACCGPMRD
osa-miRf11872-akrACCGCCGGUGUGUCGCCGGUUAGACPMRD
osa-miRf11873-akrUUGGGCCUACAUGUCAGCCUCAUPMRD
osa-miRf11874-akrACCGGCCGUGCAAGGCCGGUCAGAPMRD
osa-miRf11875-akrGGUGUUACGAACCGGGACUAAAGAUPMRD
osa-miRf11877-akrCCGGUCCCAUAUGUCAGCCUPMRD
osa-miRf11878-akrGGUCUCACAUGUCAGCCUCCUUPMRD
osa-miRf11880-akrAGUAGUUAGCUCGAUCGAUCGAUCPMRD
osa-miRf11881-akrACGAGCUUCAAAAGGCGGCGPMRD
osa-miRf11882-akrAGUCCCGGUUGGUAAAACCAACCGGGAPMRD
osa-miRf11884-akrACACGUGGCAGUCCAGUCAGCAUPMRD
osa-miRf11885-akrGUGGCAGUCCAGUCAGCAUAPMRD
osa-miRf11886-akrCAGGUGAGGUUACCUCACCUPMRD
osa-miRf11887-akrCCGACUGGUCUCCAGUUGGCGGCUGPMRD
osa-miRf11888-akrAGAUCAUCUUUAGUCCCGGUUCGPMRD
osa-miRf11890-akrAGGGGAUACCUGUGACGGGCCPMRD
osa-miRf11892-akrGCCGGUCAGACCGACAUUUGGCGCPMRD
osa-miRf11893-akrAUUCAAACAUCCGAUGUGAUAGGGPMRD
osa-miRf11894-akrCCCUAUCACAUCGGAUGUUUGAAPMRD
osa-miRf11895-akrACAAAUCUGUAGCCCGCUUCPMRD
osa-miRf11897-akrCUCCAACCGGGACUAAAGAUPMRD
osa-miRf11899-akrUCAGCGCCAUGGACAUUGGCGPMRD
osa-miRf11900-akrUAGCGCCAAUGUCCAUGGCGCUPMRD
osa-miRf11901-akrAUCUUCACAGGCGGACGGCCGCPMRD
osa-miRf11902-akrAACCGCGACUAAAGAUCCCGGGPMRD
osa-miRf11903-akrGGAUCUUUAGUCGCGGUUGGUGPMRD
osa-miRf11904-akrCGGUUGGUAAAACCAAUCGGGAPMRD
osa-miRf11905-akrCCAACGUUUGACCGUCCGUCPMRD
osa-miRf11907-akrGAGCCCGGUCUGACCGGUCCACAUPMRD
osa-miRf11908-akrUCCCACCCAGAGGUUUUGGCUPMRD
osa-miRf11909-akrUGGUUUCCGCCGGUCUGACCGPMRD
osa-miRf11911-akrUCACCGGUUAGACCGCCGAAACCCAGUPMRD
osa-miRf11912-akrUCACCGGUUAGAUCGCCGAAPMRD
osa-miRf11913-akrUAGUCCCGGUUGAUAACACCAACCGGPMRD
osa-miRf11914-akrCACCAACCGGGACUAAAGAUCCPMRD
osa-miRf11916-akrCGGUUUUCCCAACCAGCACUAUGPMRD
osa-miRf11917-akrGAGCUGCUCGAGCUCGGCUCGUCUCPMRD
osa-miRf11918-akrUCCCGGUUGGUAACACCAACCGGGPMRD
osa-miRf11919-akrGGUUGGUAACACCAACCGGGGACPMRD
osa-miRf11921-akrCCUUGGCAACCGGAGCACUUCUUPMRD
osa-miRf11922-akrCUUCCGACUGGUUUCCAGUCGGUGPMRD
osa-miRf11923-akrCUUCCGACUGGUUUCCAGUCPMRD
osa-miRf11924-akrGGCUGGCCUAUUAUGCCGCCGUUGPMRD
osa-miRf11927-akrUCCCAGUUGGUAACACCAACCGGPMRD
osa-miRf11928-akrGAGCCCGGUCUGACCGGUCUACAUPMRD
osa-miRf11930-akrCGUCCGCCUGCGAAGAUUAUPMRD
osa-miRf11931-akrGGAUCGAUUUUCGCAGGCGGPMRD
osa-miRf11932-akrGACGCCCGAUAUUCGUCCACPMRD
osa-miRf11933-akrGCAUGAUACCUCAUAGGUAUCAPMRD
osa-miRf11936-akrAAAACGUGCGUGCGGAAAACGAPMRD
osa-miRf11937-akrCGUGCGUGCGGAAAACGAGGGAPMRD
osa-miRf11938-akrAACUUCGGCGACCUCUUCUUPMRD
osa-miRf11939-akrCGGAACCUUGUGUGGGUUGGPMRD
osa-miRf11940-akrUGGAGCUGGAGCUGUGCCAAACGGPMRD
osa-miRf11941-akrGUGCCGGUUGGGAAAUCCGACACCPMRD
osa-miRf11943-akrACGAGCGUCUUAAGGAGCCGPMRD
osa-miRf11944-akrUAGUCCCGGUUGUUCAACCGGPMRD
osa-miRf11946-akrCCCGGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11947-akrGUUGGUGUUACCAACCGGGAPMRD
osa-miRf11949-akrUAGUACUAGGACGUGUCACAUCCCPMRD
osa-miRf11950-akrACACUCAUCUAUGACGGGCUPMRD
osa-miRf11951-akrUCCGUGUCUAACGUUUGACCGUCCPMRD
osa-miRf11952-akrUUACUCCCUCCGUCCCAAUAUAUAPMRD
osa-miRf11953-akrUAGUACUCCCUCCGUCCCAAUAUAUPMRD
osa-miRf11954-akrUUUAGUACUCCCUCCGUCCCAAPMRD
osa-miRf11955-akrCUUUCUAGCAUUGCCCACAUPMRD
osa-miRf11957-akrUGAACCGGGACUAAAGAUCUCGGGPMRD
osa-miRf11961-akrCGGUUGGUGUUACUAACCGGGACUAPMRD
osa-miRf11962-akrGGGUUACGAACCGGGACUAAAPMRD
osa-miRf11963-akrUUAGUCCCGGAUUCGUAGUCCCPMRD
osa-miRf11964-akrUCCCGAUUGGUAAGACCAACCGPMRD
osa-miRf11967-akrACCAGCGAGUAGAAUUAUCUCUCPMRD
osa-miRf11969-akrGAGGAGCUCGAGCUUGGCUUGUCPMRD
osa-miRf11970-akrUCCCGGUUGGUAACUCCAACCPMRD
osa-miRf11971-akrCACUACCAACCGGGACUAAAGPMRD
osa-miRf11972-akrAUUUGGUACCGUGAGGUACCAPMRD
osa-miRf11975-akrCCGGUUGGUGUCACCAACCGGGACUAPMRD
osa-miRf11976-akrUUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf11979-akrAGUUAAUGCCCGUCACAGAUPMRD
osa-miRf11980-akrUCUCAACAACCGGGACUAAAGPMRD
osa-miRf11982-akrCGGAUUGAGAUCAGGUGCAGUPMRD
osa-miRf11983-akrAUCCGGUCAAACGUCCGAUGUGACPMRD
osa-miRf11984-akrGGUGUCACAUUGAACGUUUGAPMRD
osa-miRf11985-akrUGCGGCGCAACUGCUCCGUUUCPMRD
osa-miRf11987-akrCCGGUUGAUAACAUUAACCGGPMRD
osa-miRf11988-akrUAGUCCCGGUUGGUAAAACCAACCGGPMRD
osa-miRf11990-akrCGCGAGACAAAUCUAUUGAGCCPMRD
osa-miRf11991-akrAGUACCGUGAGGUACCGGUACCPMRD
osa-miRf11992-akrGAAACGAUUUGGUACCGUGCPMRD
osa-miRf11993-akrAUCCAACGAUCGGAAACGAUUPMRD
osa-miRf11994-akrUUGCUUGCAACGUUUGACCAPMRD
osa-miRf11995-akrUACCCGUGAUACCUGAUACCUAGPMRD
osa-miRf11996-akrGUCUUAUAACCUGAAACGGGGGPMRD
osa-miRf11997-akrAAGUGGUCCGCCUGCGAAAAUAGPMRD
osa-miRf11998-akrUGGUCCGCUUGCGAAAAUAGAPMRD
osa-miRf11999-akrCUAUUUUCGCAGGCGGACCACUUPMRD
osa-miRf12000-akrUCUAUUUUCGCAGGCGGACCPMRD
osa-miRf12001-akrUGUUUGGCUGAGCUCCAGCUPMRD
osa-miRf12002-akrGCCUCCAUCGCCAUCGCCAUPMRD
osa-miRf12003-akrUGGGACCUAUGUGGACCCCACAUGUPMRD
osa-miRf12004-akrUCCUGACAUGUGGGGCCCACGUGGGUCCPMRD
osa-miRf12005-akrCCUAUGUGGACCCCACAUGUUAGUAPMRD
osa-miRf12006-akrCCCCACAUGUUAGUAUGCCACPMRD
osa-miRf12007-akrCGGCGGCGAUGAUCGUCUCCGUCAPMRD
osa-miRf12010-akrUCGCCGUCAACUGCGAGGUCGPMRD
osa-miRf12011-akrGGUUGGUAAAACCAACCGGGAGUPMRD
osa-miRf12012-akrUCCUGGUUGGUAACACCAACCGGPMRD
osa-miRf12013-akrCCGGUUGGUUUUACCAACCGGGAPMRD
osa-miRf12014-akrAUGUAAGUCAUUCUAGCAUUCCCCPMRD
osa-miRf12015-akrAAGUCAUUCUAGCAUUCCCCACAUUCPMRD
osa-miRf12016-akrUAAGUCAUUCUAGCAUUCCCCPMRD
osa-miRf12017-akrAGGCCUGGUCGGAGAUGAACPMRD
osa-miRf12019-akrUCCCGGUUGGUAACACCAACCPMRD
osa-miRf12021-akrUCAGAGACACAUACUGCAUGUPMRD
osa-miRf12022-akrGCUCGAGCUUGAUCGAGCUCCPMRD
osa-miRf12023-akrAAAAAACUCAACCUAGGAGGGGPMRD
osa-miRf12024-akrCUUCUCUGACGUAAAGUCAGAGGPMRD
osa-miRf12027-akrUCCCGGUUGGUAACACGAACCGGPMRD
osa-miRf12028-akrCUUUAGUCCCGGUUGGUAACACPMRD
osa-miRf12029-akrAUGUUGGCCGCCGCCGCUGCCAUPMRD
osa-miRf12030-akrCCCACCAAUCGUCAUCAUCGPMRD
osa-miRf12031-akrGUUAGAAGCUCCCCCAAACGGAUCPMRD
osa-miRf12032-akrAGUUAGAAGCUCCCCCAAACGPMRD
osa-miRf12033-akrAGAUCCUGGCACCACCUGGUPMRD
osa-miRf12034-akrCUCAAGAGAUUCAUCUCGCGPMRD
osa-miRf12035-akrUGAACUACUCCCUCCGUCCCAUAAPMRD
osa-miRf12036-akrUCCUAGGACAACGAAUCUGGACAUPMRD
osa-miRf12037-akrCUGUUUAGGGGAGCUUCUGGCAPMRD
osa-miRf12038-akrCAGCUGCUAGAAGCUCCCUCAAACAGPMRD
osa-miRf12039-akrAGGUACUCCCUCCGUCCCAUAAUAUAAGPMRD
osa-miRf12040-akrACUCCCUCCGUCCCAUAAUAUAAGPMRD
osa-miRf12042-akrGGUUGGUAGUACUAACCGAGAGUPMRD
osa-miRf12043-akrCAGUGCCACGCUAUUUGGCGPMRD
osa-miRf12044-akrUCCUCGACACACUCGUCGACPMRD
osa-miRf12046-akrGGGUGUAAGUGGCUAACCCGPMRD
osa-miRf12047-akrCCUCCUCAAGGACCGUAAAAPMRD
osa-miRf12050-akrAUCUUCGCAGACGGACGGCCGCPMRD
osa-miRf12051-akrGGUUUCGCGGGUUAGCCACUUACACPMRD
osa-miRf12052-akrUGGGUUUCGCGGGUUAGCCAPMRD
osa-miRf12053-akrCAUGCCAAAUUUUGGUAAGGCCPMRD
osa-miRf12054-akrGGCCUCUUAAGUAGCCGUAUPMRD
osa-miRf12055-akrCCGGUUGGUAACACCAACCGGUPMRD
osa-miRf12056-akrGCUGACAUGUGGGCCCGAGUGGUPMRD
osa-miRf12057-akrUAAGGCUGACAUGUGGGCCCGAPMRD
osa-miRf12058-akrACCCGGGCCCACAUGUCAGCCUCACPMRD
osa-miRf12059-akrAUUACCAACCGGGACUAAAGCUUPMRD
osa-miRf12060-akrGGAUCUUUAGUCCCGGUUGGPMRD
osa-miRf12062-akrUAGUCCCGGUUGGACAACCGGGAPMRD
osa-miRf12063-akrGGUUGGAGAUAUCAACCGGGAPMRD
osa-miRf12064-akrGAUCUUUAGUCCUGGUUGGUAACAPMRD
osa-miRf12065-akrCGAUCUUUAGUCCUGGUUGGUPMRD
osa-miRf12066-akrUCUUUAGUCCCGGUUGGUGUUACCPMRD
osa-miRf12068-akrGCCACUUAAGCAGCCGUAUGPMRD
osa-miRf12069-akrGUUGGUAGUAUCAACCGGGAPMRD
osa-miRf12070-akrCGGUUGGUAGUACCAACCGGPMRD
osa-miRf12073-akrGCCGGUCAGACUGCCUCUGGUCACCPMRD
osa-miRf12078-akrACCUCUUAGCAUGGCUGCUAGCPMRD
osa-miRf12080-akrAGAUCGAUCUUCGCAAGCGGCPMRD
osa-miRf12081-akrCCUCAGCACCAGCGCUUGUGPMRD
osa-miRf12085-akrACUUUAGUCCCGGUUGGUGUPMRD
osa-miRf12087-akrCCUGGGUCCACAUGUCAGCCUCUPMRD
osa-miRf12088-akrGGUCCACAUGUCAGCCUCUUUUCPMRD
osa-miRf12089-akrCUCAAAAGAUUCGUCUCGCGPMRD
osa-miRf12090-akrUCUAGUCACCUGUGACGGGUCUAPMRD
osa-miRf12091-akrAACCCGUCACAGAUGAUCAUPMRD
osa-miRf12092-akrUAGUCCCGGUUUUCCAACCGGGAPMRD
osa-miRf12093-akrGUUGGUGUUACCAACCGGGAUUAPMRD
osa-miRf12095-akrGGUUGGUAACACCAAUCGGGPMRD
osa-miRf12097-akrCCGGUUGGUGUUACCAACCAGGAPMRD
osa-miRf12098-akrUCCUGGUUGGUAACACCAACCGGGACUPMRD
osa-miRf12099-akrCUCUCUCGUUUUCCACGCGCACGPMRD
osa-miRf12100-akrGUGCGCGCGGAAAAUGAGAGAGGUGPMRD
osa-miRf12102-akrCCCGGUUGGUAGUACCAACCGUGAPMRD
osa-miRf12103-akrCUUGCUGGUUCUCGAACCAGUGPMRD
NolmiR-23UGGUUUGGUCUGGGAUGGAGUAJian Yang et al. (2014)
NolmiR-36UUUGCAUGACCCGGGAGAUGAJian Yang et al. (2014)
NolmiR-50AUGAACGGAACCCUAACGGCGJian Yang et al. (2014)
NolmiR-53UUGGGAGGUGGUGAGUACUAAGJian Yang et al. (2014)
NolmiR-56AGCUUUUGGGGUGUAGUAAGGCUUJian Yang et al. (2014)
NolmiR-58AUUUUAUGGUCUGUAAGAAGGUAUJian Yang et al. (2014)
NolmiR-62AGAAUGAUUUAUAUUGUAAAACGGJian Yang et al. (2014)
NolmiR-63AGAAUCUGUACUAAAAGAUGGACUJian Yang et al. (2014)
NolmiR-74UGGAUUUAUUUUAGGACAGAUGGAJian Yang et al. (2014)
NolmiR-86AGUGUACUCAGUUCAGAAUGGUAUJian Yang et al. (2014)
NolmiR-95ACAACAAAACUAGAAAAUAUGCGUJian Yang et al. (2014)
NolmiR-101AGUGGGAUUUUUGUUCAAAAUGGCJian Yang et al. (2014)
NolmiR-105AACCUUUAGCUAUGCAUCUGGACAJian Yang et al. (2014)
NolmiR-112GGGACUUAUACUUUUGUAAGAGGGJian Yang et al. (2014)
NolmiR-142GAGAACUUUCGAUGGCAUGGAACCJian Yang et al. (2014)
NolmiR-150GGAACCGGGACUGUGGAUUUCGGCJian Yang et al. (2014)
NolmiR-162AGAGAAACUGUAGCAGUCAGAAGCJian Yang et al. (2014)
NolmiR-185ACAGAAAAUGUCAACUCAAGCJian Yang et al. (2014)
NolmiR-230AGAGAAACUGUAGCUGCUAGAAGCJian Yang et al. (2014)
NolmiR-349AGAAAUUCGGUUAUCUGUUCGGUCJian Yang et al. (2014)
NolmiR-432AAUGACUGGUUAGAAAAGAUGGAGJian Yang et al. (2014)
283NRmaizeknownmiRfrommiRBAse+PMRDmiR_sequencedatabasename
zma-miR529-5pAGAAGAGAGAGAGUACAGCCUmiRBase.V20
zma-miR168b-3pCCCGCCUUGCAUCAAGUGAAmiRBase.V20
zma-miR167h-3pGAUCAUGUUGCAGCUUCACmiRBase.V20
zma-miR168a-3pCCCGCCUUGCACCAAGUGAAmiRBase.V20
zma-miR827-5pUUUGUUGGUGGUCAUUUAACCmiRBase.V20
zma-miR156l-3pGCUCACUGCUCUAUCUGUCACCmiRBase.V20
zma-miR396b-3pGUUCAAUAAAGCUGUGGGAAAmiRBase.V20
zma-miR319b-5pAGAGCGUCCUUCAGUCCACUCmiRBase.V20
zma-miR159a-5pGAGCUCCUAUCAUUCCAAUGAmiRBase.V20
zma-miR408b-5pCAGGGACGAGGCAGAGCAUGGmiRBase.V20
zma-miR169i-3pGGCAGUCUCCUUGGCUAGmiRBase.V20
zma-miR2275b-5pAGGAUUAGAGGCAACUGAACCmiRBase.V20
zma-miR156b-3pGCUCACCCUCUAUCUGUCAGUmiRBase.V20
zma-miR159h-3pUUUGGAGUGAAGGGAGCUCUGmiRBase.V20
zma-miR2275a-5pAGAGUUGGAGGAAAGCAAACCmiRBase.V20
zma-miR171b-3pUUGAGCCGUGCCAAUAUCACmiRBase.V20
zma-miR167g-3pGGUCAUGCUGUAGUUUCAUCmiRBase.V20
zma-miR167c-3pGAUCAUGCUGUGGCAGCCUCACUmiRBase.V20
zma-miR156a-3pGCUCACUUCUCUCUCUGUCAGUmiRBase.V20
zma-miR156k-3pGCUCGCUUCUCUUUCUGUCAGCmiRBase.V20
zma-miR166n-5pGGAUUGUUGUCUGGCUCGGUGmiRBase.V20
zma-miR168cUCGCUUGUUGCAGAUCGGGACPMRD
zma-miR156rUGACAGAAGAGAGUGGGCACPMRD
zma-miR167j-3pGAUCAUGUGGCAGUUUCAUUmiRBase.V20
zma-miR398b-5pGGGGCGGACUGGGAACACAUGmiRBase.V20
zma-miR164c-3pCAUGUGCCCUUCUUCUCCAUCmiRBase.V20
zma-miR171k-5pUGGUAUUGUUUCGGCUCAUGUmiRBase.V20
zma-miR319a-5pGAGCUCUCUUCAGUCCACUCmiRBase.V20
zma-miR166g-5pGGAAUGUUGUCUGGUUGGAGAmiRBase.V20
zma-miR528a-3pCCUGUGCCUGCCUCUUCCAUUmiRBase.V20
zma-miR164b-3pAUGUGCCCAUCUUCUCCACCmiRBase.V20
zma-miR166uUCGGACCACGCUUCAUUCCCCPMRD
zma-miR156e-3pGCUCACUGCUCUCUCUGUCAUCmiRBase.V20
zma-miR156i-3pGCUCACUGCUCUAUCUGUCAUCmiRBase.V20
zma-miR2118gUUCCUGAUGCCUCCUAUUCCUAmiRBase.V20
zma-miR529-3pGCUGUACCCUCUCUCUUCUUCmiRBase.V20
zma-miR166j-5pGGUUUGUUUGUCUGGUUCAAGGmiRBase.V20
zma-miR397a-5pUCAUUGAGCGCAGCGUUGAUGmiRBase.V20
zma-miR2275b-3pUUCAGUUUCCUCUAAUAUCUCAmiRBase.V20
zma-miR169l-5pUAGCCAGGGAUGAUUUGCCUGmiRBase.V20
zma-miR390a-3pCGCUAUCUAUCCUGAGCUCCAmiRBase.V20
zma-miR156h-3pGCUCACUGCUCUUUCUGUCAUCmiRBase.V20
zma-miR167d-3pGGUCAUGCUGCUGCAGCCUCACUmiRBase.V20
zma-miR171i-5pUGUUGGCACGGUUCAAUCAAAmiRBase.V20
zma-miR2275a-3pUUUGUUUUCCUCCAAUAUCUCAmiRBase.V20
zma-miR159f-5pGAGCUCCUCUCAUUCCAAUGAmiRBase.V20
zma-miR398aUGUGUUCUCAGUUCGCCCCCGPMRD
zma-miR164g-3pCACGUGCUCCCCUUCUCCACCmiRBase.V20
zma-miR398a-5pGGGGCGAACUGAGAACACAUGmiRBase.V20
zma-miR169c-3pGGCAAGUCUGUCCUUGGCUACAmiRBase.V20
zma-miR166k-5pGGAUUGUUGUCUGGCUCGGGGmiRBase.V20
zma-miR399b-5pGUGCAGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR160a-3pGCGUGCAAGGGGCCAAGCAUGmiRBase.V20
zma-miR169m-3pGGCAUCCAUUCUUGGCUAAGmiRBase.V20
zma-miR172c-5pCAGCACCACCAAGAUUCACAmiRBase.V20
zma-miR171a-3pUGAUUGAGCCGCGCCAAUAUmiRBase.V20
zma-miR164d-3pCACGUGGUCUCCUUCUCCAUmiRBase.V20
zma-miR394a-3pAGGUGGGCAUACUGCCAAUGmiRBase.V20
zma-miR167f-3pGAUCGUGCUGCGCAGUUUCACCmiRBase.V20
zma-miR399d-5pGUGUGGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR172d-5pCAGCACCAUCAAGAUUCACAmiRBase.V20
zma-miR399f-5pGGGCAACUUCUCCUUUGGCAGAmiRBase.V20
zma-miR167b-3pGAUCAUGCUGUGACAGUUUCACUmiRBase.V20
zma-miR166i-5pGGAAUGUCGUCUGGCGCGAGAmiRBase.V20
zma-miR399b-3pUGCCAAAGGAGAGCUGUCCUGmiRBase.V20
zma-miR171c-3pUGACUGAGCCGUGCCAAUAUCmiRBase.V20
zma-miR171b-5pGAUAUUGGCGCGGUUCAAUCmiRBase.V20
zma-miR164a-3pCACGUGUUCUCCUUCUCCAUCmiRBase.V20
zma-miR396g-5pUCCCACAGCUUUAUUGAACUGmiRBase.V20
zma-miR397b-3pCCAGCGCUGCACUCAAUUACGmiRBase.V20
zma-miR395e-5pGUUCCCUUCAAGCACUUCACAUmiRBase.V20
zma-miR162-5pGGGCGCAGUGGUUUAUCGAUCmiRBase.V20
zma-miR399e-5pGGGCUUCUCUUUCUUGGCAGGmiRBase.V20
zma-miR399c-5pGGGUACGUCUCCUUUGGCACAmiRBase.V20
zma-miR393a-3pAUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
zma-miR393aUCCAAAGGGAUCGCAUUGAUCPMRD
zma-miR437cUCAAAGUUAGAGAAGUUUGACPMRD
zma-miR393c-3pGUCAGUGCAAUCCCUUUGGAAUmiRBase.V20
zma-miR393dUCCAAAGGGAUUGCACUGAUCPMRD
zma-miR160c-3pGCGUGCAUGGUGCCAAGCAUAmiRBase.V20
zma-miR160d-3pGCGUGCGUGGAGCCAAGCAUGmiRBase.V20
zma-miR2118eUUCCUGAUGUCUCCCAUUCCUAmiRBase.V20
zma-miR169a-3pGGCAAGUUGUUCUUGGCUACAmiRBase.V20
zma-miR169n-3pGGCAGGCCUUCUUGGCUAAGmiRBase.V20
zma-miR437gAAAGUUAGAGAAGUUUGACUCPMRD
zma-miR395n-5pGUUCUCUACAAGCACUUCACGAmiRBase.V20
zma-miR396g-3pGUUCAAGAAAGCUGUGGAAGAmiRBase.V20
zma-miR167uUGAAGCUGCCACAUGAUCUGPMRD
zma-miR399a-5pGUGCGGUUCUCCUCUGGCACGmiRBase.V20
zma-miR395o-5pGUUCUCUUCAAGCACUUCACGAmiRBase.V20
zma-miR171a-5pUAUUGGCGAGGUUCAAUCAGAmiRBase.V20
zma-miR395a-5pGUUCUCCUCAAACCACUUCAGUUmiRBase.V20
zma-miR396e-3pGGUCAAGAAAGCCGUGGGAAGmiRBase.V20
zma-miR2275c-5pAGGAUUAGAGGGACUUGAACCmiRBase.V20
zma-miR167a-3pGAUCAUGCAUGACAGCCUCAUUmiRBase.V20
zma-miR166h-5pGGAAUGACGUCCGGUCCGAACmiRBase.V20
zma-miR395b-5pGUUCCCUACAAGCACUUCACAAmiRBase.V20
zma-miR169r-3pGGCAAGUUGUCCUUGGCUACAmiRBase.V20
zma-miR395dGUGAAGUGUUUGGAGGAACUPMRD
zma-miR159b-5pGUGCUCCCUUCAAACCAAUAAmiRBase.V20
zma-miR395o-3pGUGAAGUGUUUGGGUGAACUCmiRBase.V20
zma-miR399h-5pGUGCAGUUCUCCUCUGGCACGmiRBase.V20
zma-miR159g-5pGUGCUCCCUUCACACCAAUAAmiRBase.V20
zma-miR169l-3pGGCAAAUCAUCCCUGCUACCmiRBase.V20
zma-miR159c-5pGAGCUCCCUUCGAUCCAAUCCmiRBase.V20
zma-miR171c-5pUAUUGGUGCGGUUCAAUCAGAmiRBase.V20
zma-miR2118fUUCCCAAUGCCUUCCAUGCCUAmiRBase.V20
zma-miR159g-3pUUUGGAGUGAAGGGAGUUCUGmiRBase.V20
zma-miR393b-3pAUCAAUGCGAUCCUUUUGGAGGmiRBase.V20
zma-miR171g-5pUAUUGACUUGGCUCAUCUCUCmiRBase.V20
zma-miR164e-3pCAUGUGUCCGCCCUCUCCACCmiRBase.V20
zma-miR171m-5pUAUUGGCGCGCCUCAAUCCGAmiRBase.V20
zma-miR171mGAUGUUGGCAUGGCUCAAUCAPMRD
zma-miR169o-3pGGCAGGUCUUCUUGGCUAGCmiRBase.V20
zma-miR169q-3pGGCAGGCCUUCUGGCUAAGmiRBase.V20
zma-miR399j-5pAGGCAGCUCUCCUCUGGCAGGmiRBase.V20
zma-miR169f-3pGGCAUGUCUUCCUUGGCUACUmiRBase.V20
zma-miR169p-3pGGCAAGUCAUCUGGGGCUACGmiRBase.V20
zma-miR395k-5pGUUUCCUUCAAGCACUUCACAUmiRBase.V20
zma-miR399i-5pGUGCGGCUCUCCUCUGGCAUGmiRBase.V20
zma-miR437eGAAGUUAAAGAAGUUUGACUUPMRD
zma-miR166l-5pGAAUGGAGGCUGGUCCAAGAmiRBase.V20
zma-miR2275d-5pAGAGUUGGAGGAAAGAAAACUmiRBase.V20
zma-miR164f-3pCACGUGCGCUCCUUCUCCAACmiRBase.V20
zma-miR164h-5pUGGAGAAGCAGGGCACGUGUGmiRBase.V20
zma-miR171l-5pUAUUGGCGUGCCUCAAUCCGAmiRBase.V20
zma-miR395i-5pGUUCCCUACAAGCACUUCACGAmiRBase.V20
zma-miR395l-5pGUUCCUUCCAAACACUUCACCAmiRBase.V20
zma-miR399g-5pGGGCAACCCCCCGUUGGCAGGmiRBase.V20
zma-miR1432-3pGGGUGUCAUCUCGCCUGAAGCAmiRBase.V20
zma-miR437dUAAGUUAGAGAAGUUUGACUUPMRD
zma-miR171j-5pUAUUGACGCGGUUCAAUUCGAmiRBase.V20
zma-miR395f-5pGUUACCUACAAGCACGUCUCGAmiRBase.V20
zma-miR395k-3pGUGAAGUGUUUGAGGAAACUCmiRBase.V20
zma-miR395m-5pGUUCCUUUCAAACACUUCACAUmiRBase.V20
zma-miR158UCCUAAAUGUAGACAAAGCAPMRD
zma-miR407CCUAAAUCAUAUACUUUUGGAPMRD
zma-miR414UCAUCCUCAUCAUCGUCGUCCPMRD
zma-miR156d-5pUGACAGAAGAGAGUGAGCACmiRBase.V20
zma-miR156d-3pGCUCACUUCUCUUUCUGUCAGCmiRBase.V20
zma-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase.V20
zma-miR160b-3pGCGUGCAAGGAGCCAAGCAUGmiRBase.V20
zma-miR164a-5pUGGAGAAGCAGGGCACGUGCAmiRBase.V20
zma-miR169a-5pCAGCCAAGGAUGACUUGCCGAmiRBase.V20
zma-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase.V20
zma-miR166a-5pGGAAUGUUGUCUGGCUCGGGGmiRBase.V20
zma-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase.V20
zma-miR162-3pUCGAUAAACCUCUGCAUCCAmiRBase.V20
zma-miR166h-3pUCGGACCAGGCUUCAUUCCCmiRBase.V20
zma-miR166b-5pGGAAUGUUGUCUGGUUCAAGGmiRBase.V20
zma-miR166c-5pGGAAUGUUGUCUGGCUCGAGGmiRBase.V20
zma-miR172aAGAAUCUUGAUGAUGCUGCAmiRBase.V20
zma-miR171d-5pUGUUGGCUCGGCUCACUCAGAmiRBase.V20
zma-miR171d-3pUGAUUGAGCCGUGCCAAUAUCmiRBase.V20
zma-miR171f-5pCGAUGUUGGCAUGGCUCAAUCmiRBase.V20
zma-miR171f-3pUUGAGCCGUGCCAAUAUCACAmiRBase.V20
zma-miR394a-5pUUGGCAUUCUGUCCACCUCCmiRBase.V20
zma-miR395b-3pGUGAAGUGUUUGGGGGAACUCmiRBase.V20
zma-miR395c-5pGUUCCCUGCAAACACUUCACCAmiRBase.V20
zma-miR395c-3pGUGAAGUGUUUGGAGGAACUCmiRBase.V20
zma-miR396b-5pUUCCACAGCUUUCUUGAACUGmiRBase.V20
zma-miR399a-3pUGCCAAAGGAGAAUUGCCCUGmiRBase.V20
zma-miR399d-3pUGCCAAAGGAGAGCUGCCCUGmiRBase.V20
zma-miR399e-3pUGCCAAAGGAGAGUUGCCCUGmiRBase.V20
zma-miR399f-3pUGCCAAAGGAAAUUUGCCCCGmiRBase.V20
zma-miR156j-5pUGACAGAAGAGAGAGAGCACAmiRBase.V20
zma-miR156j-3pUGCUCUCUGCUCUCACUGUCAUCmiRBase.V20
zma-miR159a-3pUUUGGAUUGAAGGGAGCUCUGmiRBase.V20
zma-miR159c-3pCUUGGAUUGAAGGGAGCUCCUmiRBase.V20
zma-miR319a-3pUUGGACUGAAGGGUGCUCCCmiRBase.V20
zma-miR166k-3pUCGGACCAGGCUUCAAUCCCUmiRBase.V20
zma-miR167e-5pUGAAGCUGCCAGCAUGAUCUGmiRBase.V20
zma-miR167e-3pGAUCAUGCUGUGCAGUUUCAUCmiRBase.V20
zma-miR168a-5pUCGCUUGGUGCAGAUCGGGACmiRBase.V20
zma-miR169c-5pCAGCCAAGGAUGACUUGCCGGmiRBase.V20
zma-miR169f-5pUAGCCAAGGAUGACUUGCCUAmiRBase.V20
zma-miR169i-5pUAGCCAAGGAUGACUUGCCUGmiRBase.V20
zma-miR169dUAGCCAAGGAGACUGCCUAUGmiRBase.V20
zma-miR169eUAGCCAAGGAGACUGCCUACGmiRBase.V20
zma-miR171g-3pGAGGUGAGCCGAGCCAAUAUCmiRBase.V20
zma-miR172eGGAAUCUUGAUGAUGCUGCAUmiRBase.V20
zma-miR166l-3pUCGGACCAGGCUUCAUUCCUCmiRBase.V20
zma-miR166m-5pGGAAUGUUGGCUGGCUCGAGGmiRBase.V20
zma-miR171k-3pGUGAGCCGAACCAAUAUCACUmiRBase.V20
zma-miR393a-5pUCCAAAGGGAUCGCAUUGAUCUmiRBase.V20
zma-miR408aCUGCACUGCCUCUUCCCUGGCmiRBase.V20
zma-miR156k-5pUGACAGAAGAGAGCGAGCACmiRBase.V20
zma-miR160f-5pUGCCUGGCUCCCUGUAUGCCGmiRBase.V20
zma-miR160f-3pGCGUGCGAGGUGCCAGGCAUGmiRBase.V20
zma-miR396cUUCCACAGGCUUUCUUGAACUGmiRBase.V20
zma-miR2118aUUCCUGAUGCCUCUCAUUCCUAmiRBase.V20
zma-miR2118bUUCCCGAUGCCUCCCAUUCCUAmiRBase.V20
zma-miR2118cUUCCUAAUGCCUCCCAUUCCUAmiRBase.V20
zma-miR2118dUUCCUGAUGCCUCCCAUGCCUAmiRBase.V20
zma-miR2275d-3pUUUGUUUUCCUCUAAUAUCUCAmiRBase.V20
zma-miR159e-5pCAGCUCCUGCAGCAUCUGUUCmiRBase.V20
zma-miR159e-3pAUUGGUUUGAAGGGAGCUCCAmiRBase.V20
zma-miR164e-5pUGGAGAAGCAGGACACGUGAGmiRBase.V20
zma-miR164f-5pUGGAGAAGCAGGGCACGUGCUmiRBase.V20
zma-miR169m-5pUAGCCAAGAAUGGCUUGCCUAmiRBase.V20
zma-miR169o-5pUAGCCAAGAAUGACUUGCCUAmiRBase.V20
zma-miR169p-5pUAGCCAAGGAUGACUUGCCGGmiRBase.V20
zma-miR171l-3pGGAUUGAGCCGCGUCAAUAUCmiRBase.V20
zma-miR171n-5pUAUUGGUGAGGUUCAAUCCGAmiRBase.V20
zma-miR171n-3pUGAUUGAGCCGCGCCAAUAUCmiRBase.V20
zma-miR390a-5pAAGCUCAGGAGGGAUAGCGCCmiRBase.V20
zma-miR393b-5pUCCAAAGGGAUCGCAUUGAUCCmiRBase.V20
zma-miR395d-5pGUUCUAUGCAAGCACUUCACGAmiRBase.V20
zma-miR396e-5pUUCCACAGCUUUCUUGAACUUmiRBase.V20
zma-miR396f-3pGGUCAAGAAAGCUGUGGGAAGmiRBase.V20
zma-miR397a-3pUAGCCGUUAGCGCUCAUUAACUmiRBase.V20
zma-miR398a-3pUGUGUUCUCAGGUCGCCCCCGmiRBase.V20
zma-miR399g-3pUGCCAAAGGGGAUUUGCCCGGmiRBase.V20
zma-miR482-5pUGGGAGAUGAAGGAGCCUUmiRBase.V20
zma-miR482-3pUCUUCCUUGUUCCUCCCAUUmiRBase.V20
zma-miR528a-5pUGGAAGGGGCAUGCAGAGGAGmiRBase.V20
zma-miR827-3pUUAGAUGACCAUCAGCAAACAmiRBase.V20
zma-miR1432-5pCUCAGGAGAGAUGACACCGACmiRBase.V20
zma-miR444aUGCAGUUGUUGUCUCAAGCUUmiRBase.V20
zma-miR156pUGACAGAAGAGAGAGAGCACPMRD
zma-miR157mUUGACAGAAGAGAGAGAGCACPMRD
zma-miR162bUCGAUAAACCUCUGCAUCCAGPMRD
zma-miR170nUGAUUGAGCCACGUCAAUAUCPMRD
zma-miR172mAGAAUCCUGAUGAUGCUGCAGPMRD
zma-miR172nAGAAUCCUGAUGAUGCUGCAUPMRD
zma-miR173AGCGCUUGCAGAGUGAAAUCAPMRD
zma-miR319mUUGGAUUGAAGGGAGCUCCUPMRD
zma-miR396dUCCACAGGCUUUCUUGAACUGPMRD
zma-miR413AUAGUUUCUCUUGUUUUGCACPMRD
zma-miR437aAAAGUUAGAGAAGUUUGACUUPMRD
zma-miR437fGAAGUCAGAGAAGUUUGACUUPMRD
zma-miR444bUUGCUGCCUCAAGCUUCCUGCPMRD
zma-miR447AGGGAUGAGAUGUUUUGUUGGPMRD
zma-miR-n1AACGGUGCUGUGUUAGGGGGGUUD Ding et al (2013)
zma-miR-n2aCGGAGGGGAUUGGAGAGGCUAD Ding et al (2013)
zma-miR-n2gGGAGGGGAUUGGAGAGGCUAAD Ding et al (2013)
zma-miR-n3aUAUAUAAGUUGGAUUAUGGUAD Ding et al (2013)
zma-miR-n4aUCGCGUCUUUCGCGGUCGGGCD Ding et al (2013)
zma-miR-n5UCGCUAGAUCGUUGAGGGAUUD Ding et al (2013)
zma-miR-n6UGAAAGGCGGAUGGCUCUCUAD Ding et al (2013)
zma-miR-n7UUAGAUUAUAGUAGAAGAGUAD Ding et al (2013)
zma-miR-n8UUAGGCUCGGGGACUACGGUGD Ding et al (2013)
zma-miR-n9aUUUCAAAGUUCGUGGACCUAAD Ding et al (2013)
osa-miR530-3pGTTGCATCTGCCTCTGCACCTFangli Wu et al (2014)
osa-miR811aACGTCCATTTCTCGATCTAACGGTFangli Wu et al (2014)
ath-miR829_1ATTCCATCATTTGGTATCAGAGCTFangli Wu et al (2014)
ath-miR845aCATCAATTGGTATCAGAGCCGFangli Wu et al (2014)
zmiRs1aGGUGAACCACCGGACAUCGCACHongjun Liu et al (2014)
zma-miRs2UUUGACCAAGUUUGUAGAAAAHongjun Liu et al (2014)
zma-miRs3UAUACACUGUGGUUGUGGAUGHongjun Liu et al (2014)
zma-miRs4UAGCCAAGCAUGAUUUGCCCGUHongjun Liu et al (2014)
zma-miRs5UGAUGCCAUUCAUUAAUCUCHongjun Liu et al (2014)
zma-miRs6aUGGGUCAAGAAAGUAGAUGAAGHongjun Liu et al (2014)
zma-miRs7UUGGAGGGGAUUGAGGGGGCUAHongjun Liu et al (2014)
zma-miRs8UUGGAUUGGUUUAGAGUGGUUHongjun Liu et al (2014)
zma-miRs9UUAGGCUCGGGGACUAUGGUGHongjun Liu et al (2014)
zma-miRs10AUCGGCUGAUCGUUUGGCCUGHongjun Liu et al (2014)
zma-miRs11CGUGGAACUUCUUCGGCGUAGHongjun Liu et al (2014)
zma-miRs12UGGCUGUGAUGACAAAAAGGUHongjun Liu et al (2014)
zma-miRs13UGAGUUUAGGGACUGGGAUGGHongjun Liu et al (2014)
zma-miRs14UGAAACUGUCACAGCAUGAUCHongjun Liu et al (2014)
zma-miRs15UGUUCGGUUGCUCAGGAACGGUHongjun Liu et al (2014)
zma-miRs16UUGCCAGGAGGAGGAUGGAGCHongjun Liu et al (2014)
zma-miRs17UGAAAAGCUAGAACGAUUUACHongjun Liu et al (2014)
zma-miRs18GUACUACGGGUACUGCGAGCHongjun Liu et al (2014)
zma-miRs19aUGGUUGACAUAUGGACCCCACHongjun Liu et al (2014)
zma-miRs20AGGGCUUGUUCGUUUUGGAGUHongjun Liu et al (2014)
zma-miRs21GGUGUUGGUGCCUGUAGCGGHongjun Liu et al (2014)
Zma_miR_Seq01AAAATTTAGAGGACGTTGCTGGAGThiebaut et al (2014)
Zma_miR_Seq02AAACCGTCGGAGATAGCTTATGTCThiebaut et al (2014)
Zma_miR_Seq03AACCTATGTCCGACGGTTTTAGGCThiebaut et al (2014)
Zma_miR_Seq04ACGTCTATGGTTAGATCACGCGGCThiebaut et al (2014)
Zma_miR_Seq05ATAACTGTAGTGCATTAAAGCGGGThiebaut et al (2014)
Zma_miR_Seq06ATCCATATGGACTGGGAGGAAAGCThiebaut et al (2014)
Zma_miR_Seq07aCCCGCCGGCGAGCGCTTTCCTThiebaut et al (2014)
Zma_miR_Seq08CGGCGGGGGCGAACTGAGAACThiebaut et al (2014)
Zma_miR_Seq09aCGTGGTATTGTTTCGGCTCATGThiebaut et al (2014)
Zma_miR_Seq10TCCTTGTTGGACAGATAAAGGAGCThiebaut et al (2014)
Zma_miR_Seq11TTGTTGGTCTATTCGGGTTTTCGAThiebaut et al (2014)
Zma_miR_Seq12CATGAACCGAGCGAGCTAGCGAGCThiebaut et al (2014)
Zma_miR_Seq13GGCGGACTGGGAACACATGGGThiebaut et al (2014)
Zma_miR_Seq14TTGGGAGCCACAAAACTGAAGThiebaut et al (2014)
Zma_miR_Seq15TTTTGTTGGTGGTCATTTAACCThiebaut et al (2014)

1487NRArabidopsis_miR_IDmiR_sequencedatabase name
aly-miR156a-5pUGACAGAAGAGAGUGAGCACmiRBase21
aly-miR156a-3pGCUCACUGCUCUUUCUGUCAGAmiRBase21
aly-miR156b-3pGCUCACCUCUCUUUCUGUCAGUmiRBase21
aly-miR156c-3pGCUCACUGCUCUAUCUGUCAGAmiRBase21
aly-miR156d-3pGCUCACUCUCUUUCUGUCAUAmiRBase21
aly-miR156e-3pGCUUACUCUCUCUCUGUCACCmiRBase21
aly-miR156f-3pGCUCACUCUCUAUCUGUCACCmiRBase21
aly-miR156g-5pCGACAGAAGAGAGUGAGCACmiRBase21
aly-miR156g-3pGCUUACUCUCUUCUUGUCUCCmiRBase21
aly-miR156h-5pUGACAGAAGAAAGAGAGCACmiRBase21
aly-miR156h-3pGCUCUCUUUCCUUCUGCCACCmiRBase21
aly-miR157a-5pUUGACAGAAGAUAGAGAGCACmiRBase21
aly-miR157a-3pGCUCUCUAGCCUUCUGUCAUCAmiRBase21
aly-miR157b-3pGCUCUCUAAGCUUCUGUCAUCAmiRBase21
aly-miR157c-3pGCUCUCUAUACUUCUGUCACCmiRBase21
aly-miR157d-5pUGACAGAAGAUAGAGAGCACmiRBase21
aly-miR157d-3pGCUCUCUAUGCUUCUGUCAUCmiRBase21
aly-miR158a-5pCUUUGUCUACAAUUUUGGAAAmiRBase21
aly-miR158a-3pUCCCAAAUGUAGACAAAGCAmiRBase21
aly-miR159a-5pGAGCUCCUUGAAGUUCAAACGmiRBase21
aly-miR159a-3pUUUGGAUUGAAGGGAGCUCUAmiRBase21
aly-miR159b-5pGAGCUCCUUGAAGUUCAAUGGmiRBase21
aly-miR159b-3pUUUGGAUUGAAGGGAGCUCUUmiRBase21
aly-miR159c-5pGAGCUCCCUUCCUCCAAAACGmiRBase21
aly-miR159c-3pUUUGGAUUGAAGGGAGCUCCUmiRBase21
aly-miR319a-5pAGAGCUUCCUUGAGUCCAUUCmiRBase21
aly-miR319a-3pUUGGACUGAAGGGAGCUCCCUmiRBase21
aly-miR319b-5pAGAGCUUUCUUCGGUCCACUCmiRBase21
aly-miR319c-5pGGAGAUUCUUUCAGUCCAGUCmiRBase21
aly-miR319c-3pUUGGACUGAAGGGAGCUCCUUmiRBase21
aly-miR160a-5pUGCCUGGCUCCCUGUAUGCCAmiRBase21
aly-miR160a-3pGCGUAUGAGGAGCCAUGCAUAmiRBase21
aly-miR160b-3pGCGUACAGAGUAGUCAAGCAUGmiRBase21
aly-miR160c-3pGCGUACAAGGAGCCAAGCAUGmiRBase21
aly-miR161-5p.2UCAAUGCAUUGAAAGUGACUAmiRBase21
aly-miR161-5p.1UUGAAAGUGACUACAUCGGGGmiRBase21
aly-miR161-3p.1CCGGUUUAGUCACUUUCACmiRBase21
aly-miR161-3p.2GUCACUUUCACUGCAUUAAUCmiRBase21
aly-miR162a-5pGGAGGCAGCGGUUCAUCGAUCmiRBase21
aly-miR162a-3pUCGAUAAACCUCUGCAUCCAGmiRBase21
aly-miR164a-5pUGGAGAAGCAGGGCACGUGCAmiRBase21
aly-miR164a-3pCACGUACUCCCCUUCUCCAACmiRBase21
aly-miR164b-3pCAUGUGCCCAUCUUCACCAUCmiRBase21
aly-miR164c-5pUGGAGAAGCAGGGCACGUGCGmiRBase21
aly-miR164c-3pCACGUGUUCUACUCCUCCAACmiRBase21
aly-miR165a-5pGAAUGUUGUCUGGAUCGAGGmiRBase21
aly-miR165a-3pUCGGACCAGGCUUCAUCCCCmiRBase21
aly-miR165b-5pGAAUGUUGUUUGGAUCGAGGmiRBase21
aly-miR166a-5pGGAAUGUUGUCUGGCUCGAGGmiRBase21
aly-miR166a-3pUCGGACCAGGCUUCAUUCCCCmiRBase21
aly-miR166b-5pGGACUGUUGUCUGGCUCGAGGmiRBase21
aly-miR166e-5pGGAAUGUUGUCUGGCACGAGGmiRBase21
aly-miR166f-5pUGAAUGAUGCCUGGCUCGAGAmiRBase21
aly-miR166g-5pGGAAUGUUGUUUGGCUCGAGGmiRBase21
aly-miR167a-5pUGAAGCUGCCAGCAUGAUCUAmiRBase21
aly-miR167a-3pGAUCAUGUUCGCAGUUUCACCmiRBase21
aly-miR167b-3pGGUCAUGCUCUGACAGCCUCACUmiRBase21
aly-miR167c-5pUAAGCUGCCAGCAUGAUCUUGmiRBase21
aly-miR167c-3pAGGUCAUGCUGGUAGUUUCACmiRBase21
aly-miR167d-5pUGAAGCUGCCAGCAUGAUCUGGmiRBase21
aly-miR167d-3pAGGUCAUCCUGCAGCUUCAGUmiRBase21
aly-miR168a-5pUCGCUUGGUGCAGGUCGGGAAmiRBase21
aly-miR168a-3pCCCGCCUUGCAUCAACUGAAUmiRBase21
aly-miR168b-3pCCCGUCUUGUAUCAACUGAAUmiRBase21
aly-miR169a-5pCAGCCAAGGAUGACUUGCCGAmiRBase21
aly-miR169a-3pGGCAAGUUGUCCUUGGCUACAmiRBase21
aly-miR169b-5pCAGCCAAGGAUGACUUGCCGGmiRBase21
aly-miR169b-3pGGCAAGUUGUCCUUCGGCUACAmiRBase21
aly-miR169c-3pGGCAAGUCAUCUCUGGCUAUGmiRBase21
aly-miR169d-5pUGAGCCAAGGAUGACUUGCCGmiRBase21
aly-miR169d-3pGCAAGUUGACCUUGGCUCUGUmiRBase21
aly-miR169f-3pGCAAGUUGACCUUGGCUCUGCmiRBase21
aly-miR169h-5pUAGCCAAGGAUGACUUGCCUGmiRBase21
aly-miR169h-3pGGCAGUCUCCUUGGCUAUUmiRBase21
aly-miR169i-3pGGCAGUCUCCUUGGAUAUCmiRBase21
aly-miR169j-3pGGCAGUCUCCUUGGCUAUCmiRBase21
aly-miR169m-3pGGCAGUCUUCUUGGCUAUCmiRBase21
aly-miR169n-5pUAGCCAAAGAUGACUUGCCUGmiRBase21
aly-miR169n-3pGGCAGUCUCUUUGGCUAUCmiRBase21
aly-miR170-5pUAUUGGCCUGGUUCACUCAGAmiRBase21
aly-miR170-3pUGAUUGAGCCGUGUCAAUAUCmiRBase21
aly-miR171a-3pUGAUUGAGCCGCGCCAAUAUCmiRBase21
aly-miR171b-5pAGAUAUUAGUGCGGUUCAAUCmiRBase21
aly-miR171b-3pUUGAGCCGUGCCAAUAUCACGmiRBase21
aly-miR171c-5pAGAUAUUGGUGCGGUUCAAUCmiRBase21
aly-miR172a-5pGUGGCAUCAUCAAGAUUCACAmiRBase21
aly-miR172a-3pAGAAUCUUGAUGAUGCUGCAUmiRBase21
aly-miR172b-5pGCAGCACCAUCAAGAUUCACAmiRBase21
aly-miR172c-5pGGAGCAUCAUCAAGAUUCACAmiRBase21
aly-miR172c-3pAGAAUCUUGAUGAUGCUGCAGmiRBase21
aly-miR172d-5pGCAACAUCUUCAAGAUUCAGAmiRBase21
aly-miR172e-5pGCAGCACCAUUAAGAUUCACmiRBase21
aly-miR172e-3pGAAUCUUGAUGAUGCUGCAUmiRBase21
aly-miR173a-5pUUCGCUUGCAGAGAGAAAUCACmiRBase21
aly-miR173a-3pGAUUCUCUGUGCAAGUGGAAGmiRBase21
aly-miR390a-5pAAGCUCAGGAGGGAUAGCGCCmiRBase21
aly-miR390a-3pCGCUAUCCAUCCUGAGUUUCAmiRBase21
aly-miR390b-3pCGCUAUCCAUCCUGAGUUCCAmiRBase21
aly-miR391-5pUUCGCAGGAGAGAUAGCGCCAmiRBase21
aly-miR391-3pACGGUAUCUCUCCUACGUAGCmiRBase21
aly-miR393a-5pUCCAAAGGGAUCGCAUUGAUCCmiRBase21
aly-miR393a-3pAUCAUGCUAUCUCUUUGGAUUmiRBase21
aly-miR393b-3pAUCAUGCGAUCUCUUUGGAUUmiRBase21
aly-miR394a-5pUUGGCAUUCUGUCCACCUCCmiRBase21
aly-miR394a-3pAGGUGGGUAUACUGCCAAUAmiRBase21
aly-miR394b-3pAGGUGGACAUAUUGCCAACAmiRBase21
aly-miR395b-5pGUUCCCUUUAACGCUUCAUUGmiRBase21
aly-miR395b-3pCUGAAGUGUUUGGGGGGACUCmiRBase21
aly-miR395c-3pCUGAAGUGUUUGGGGGGACUUmiRBase21
aly-miR395d-5pGUUCUCCCGAACACUUCAUUGmiRBase21
aly-miR395d-3pCUGAAGUGUUUGGGGGAACUCmiRBase21
aly-miR395e-5pGUUCCUCUGAGCACUUCAUUGmiRBase21
aly-miR395f-5pGUUCCCUUAAACGCUUUAUUGmiRBase21
aly-miR396a-5pUUCCACAGCUUUCUUGAACUGmiRBase21
aly-miR396a-3pGUUCAAUAAAGCUGUGGGAAGmiRBase21
aly-miR396b-5pUUCCACAGCUUUCUUGAACUUmiRBase21
aly-miR396b-3pGCUCAAGAAAGCUGUGGGAAAmiRBase21
aly-miR397a-5pUCAUUGAGUGCAGCGUUGAUGmiRBase21
aly-miR397a-3pCCGGCGUUGCGCUCAAUUAUGmiRBase21
aly-miR397b-3pUCAGCGUUGCAUUCAAUUAUGmiRBase21
aly-miR398a-5pGGAGUGUCAUGAGAACACAGAmiRBase21
aly-miR398a-3pUGUGUUCUCAGGUCACCCCUUmiRBase21
aly-miR398b-5pGGGUUGAUAUGAGGACACAUGmiRBase21
aly-miR398b-3pUGUGUUCUCAGGUCACCCCUGmiRBase21
aly-miR398c-5pGGGUCGACAUGAGAACAUAUGmiRBase21
aly-miR398c-3pUGUGUUAACUCAGGUCACCCCUGmiRBase21
aly-miR399a-5pGGGUAAGAUCUCUAUUGGCAGGmiRBase21
aly-miR399a-3pUGCCAAAGGAGAUUUGCCCGGmiRBase21
aly-miR399b-5pGGGCGCCUCUCCAUUGGCAGGmiRBase21
aly-miR399b-3pUGCCAAAGGAGAGUUGCCCUGmiRBase21
aly-miR399c-5pGGGCAUCUUUCUAUUGGCAGGmiRBase21
aly-miR399d-5pGGGCGAAUACUCCUAUGGCAGAmiRBase21
aly-miR399d-3pUGCCAAAGGAGAUUUGCCCCGmiRBase21
aly-miR399e-5pGGGCGAAUCCUCUAUUGGCAGGmiRBase21
aly-miR399e-3pUGCCAAAGGAGAUUUGCCUCGmiRBase21
aly-miR399f-5pGGGCAAGAUCACCAUUGGCAGAmiRBase21
aly-miR399f-3pUGCCAAAGGAGAUUUGCCCUGmiRBase21
aly-miR400-5pUAUGAGAGUAUUAUAAGUCACmiRBase21
aly-miR400-3pGACUUAUAAUAAUCUCAUGAAmiRBase21
aly-miR403a-5pUGUUUUGUGCGUGACUCUAAUUmiRBase21
aly-miR403a-3pUUAGAUUCACGCACAAACUCGmiRBase21
aly-miR408-5pCAGGGAACAAGCAGAGCAUGGmiRBase21
aly-miR408-3pAUGCACUGCCUCUUCCCUGGCmiRBase21
aly-miR472-5pAUGGUCGAAGUAGGCAAAAUCmiRBase21
aly-miR472-3pUUUUUCCUACUCCGCCCAUACCmiRBase21
aly-miR771-5pUGAGCCUCUGUGGCAGCCCUCmiRBase21
aly-miR771-3pGGGCUCCUCAGAUGUUCAUGmiRBase21
aly-miR774a-5p.1CGAGACGAAGAUAUGGGUGACmiRBase21
aly-miR774a-5p.2AGAUAUGGGUGACUAAUACUUmiRBase21
aly-miR774a-3p.2UUAUUUGUUACCCAUAUCUCCmiRBase21
aly-miR774a-3p.1UACCCAUAUCUCCAUCUCCAAmiRBase21
aly-miR781-5pUUAGAGUUUUCUGGAUACUUAmiRBase21
aly-miR781-3pAGUAUCCAGAAAACUCUAAUUmiRBase21
aly-miR822-5pAUGUAACGCAUGUUGUUUUCUmiRBase21
aly-miR822-3pGAAACAACAUACGUUACAUCCmiRBase21
aly-miR823-5pCUUGUAUGAUCACUAACCAUmiRBase21
aly-miR823-3pUAGGUUGGUGAUCAUAUAGGAUmiRBase21
aly-miR824-5pUAGACCAUUUGUGAGAAGGGAmiRBase21
aly-miR824-3pCCUUCUCAUCGAUGGUCUAGAmiRBase21
aly-miR825-5pUCAAGCACCAGCUCGAAGAAGCmiRBase21
aly-miR825-3pUUCUCGAGAAGGUGCAUGAACmiRBase21
aly-miR827-5pUUUGUUGAUUGACAUCUAUACmiRBase21
aly-miR827-3pUUAGAUGACCAUCAACAAACGmiRBase21
aly-miR828-5pUCUUGCUUAAAUGAGUAUUCCAmiRBase21
aly-miR828-3pAGAUGCUCAUUUGAGCAAGCAAmiRBase21
aly-miR829-5pACUUUGAAUCUUUGAUUUGAAmiRBase21
aly-miR829-3pCAAAUCAAAUCUUCAAGGUACmiRBase21
aly-miR831-5pAGAAGAGGUACAAGGAGAUGAGAmiRBase21
aly-miR831-3pUAAACUCCUCGUACUCUUCUUGmiRBase21
aly-miR833-5pUGUUAGUCUGAACUCGGUCUAGUmiRBase21
aly-miR833-3pUAGACCGAUGUCAACAAACAAGmiRBase21
aly-miR834-5pACCACAGCUUCUGCUACGAACmiRBase21
aly-miR834-3pUGGUAGCAGUAGCGGUGGUAAmiRBase21
aly-miR835-5pUUCUUGCAUAUGUUCUUUAUCmiRBase21
aly-miR835-3pUGAAGAAGAUACGCAAGAAAGmiRBase21
aly-miR838-5pUGCAAGAAUGAGAAGCAAAGCmiRBase21
aly-miR838-3pUUUUCUUCUUCUUCUUGCACAmiRBase21
aly-miR839-5pCACCAACCUCUCAUCGUUCCCmiRBase21
aly-miR839-3pGAACGCAUGAGAGGUUGGUGAAmiRBase21
aly-miR840-5pACACUAAAGGACCUAAACUAACmiRBase21
aly-miR840-3pUUGUUUAGGUCCCUUAGUUUCUmiRBase21
aly-miR842-5pAUGAUGGAUCCGACCAUGAUGmiRBase21
aly-miR842-3pUCAUGGUCAGAUCCGUCAUCCmiRBase21
aly-miR844-5pAGAAGGACUAGUAAGAUGGCUmiRBase21
aly-miR844-3pCCAUCUUACUAGUCUUUCUUUmiRBase21
aly-miR845a-5pUCGAUUGGUGUCAGAGCCACGmiRBase21
aly-miR845a-3pCGGCUCUGAUACCAGUUGAUGmiRBase21
aly-miR845b-5pUCAAUUGGUAUCAGAGCAACGmiRBase21
aly-miR845b-3pUCGCUCUGAUACCAAAUGAUGmiRBase21
aly-miR846-5pUUCAGGGACUUCAAUUCAGAAmiRBase21
aly-miR846-3pUUGAAUUGAAGUGCUUGAAUUmiRBase21
aly-miR847-5pUCUUGAUGAAGAGGAAUGGAAmiRBase21
aly-miR847-3pUCACUCCUCUUCUUCAUGAUGmiRBase21
aly-miR852-5pAGAACAAAGGCGCUUAUCUUAUmiRBase21
aly-miR852-3pAAGAUAAGCGCCUUAGUUCUGAmiRBase21
aly-miR856-5pUAAUUCCACCAAUAACUUCAGCmiRBase21
aly-miR856-3pUGAUGUUAUUUGUGGUAUAAAmiRBase21
aly-miR857-5pAAACUUUCACCAUACAAAAUAmiRBase21
aly-miR857-3pUUUUGUAUGUUGAAGGUGUAUmiRBase21
aly-miR858-5pUUUCGUUGUCUGUUCGACCUUmiRBase21
aly-miR858-3pGGUCGAGCAGACAACGAAGAUmiRBase21
aly-miR859-5pUCUCUCCGUUGUAAAAUCAAAmiRBase21
aly-miR859-3pUGAUUUUACAAUAGAUAGAUAmiRBase21
aly-miR860-5pAUAUAGUCCAAUCUAUUGAAGmiRBase21
aly-miR860-3pUCAAUAGAUUGGACUAUAUAUmiRBase21
aly-miR861-5pGUUUGGAGAAAUAUGCAUCAUmiRBase21
aly-miR861-3pGAUGGAUAUAUCUUCAAGAACmiRBase21
aly-miR862-5pUCCAAUAGGUCUAGCAUGUGCmiRBase21
aly-miR862-3pACAUGCUGGAUCUACUUGAAGmiRBase21
aly-miR868-5pCUUUCUCGGCACUUGAGGAUGUmiRBase21
aly-miR868-3pCUUCUUAAGUGCUGAUAAUGUmiRBase21
aly-miR2111a-5pUAAUCUGCAUCCUGAGGUUUAmiRBase21
aly-miR2111a-3pGUCCUCGGGAUGCGGAUUACCmiRBase21
aly-miR2111b-3pAUCCUCGGGAUACAGAUUACCmiRBase21
aly-miR2112-5pCGCAAAUGCGGAUAUCAAUGUmiRBase21
aly-miR2112-3pCUUUAUAUCCGCAUUUGCGCAmiRBase21
aly-miR395h-5pGUUCCCUUAAACGCUUCAUUGmiRBase21
aly-miR399g-5pGGGCAAAUACUCCAUUGGCAGAmiRBase21
aly-miR399h-5pGGGCAAGAUCUCUAUUGGCAGGmiRBase21
aly-miR158b-5pUUUGUCUACAAUUUUGGAAAmiRBase21
aly-miR158b-3pUCCCAAAUGUAGACAAAGCmiRBase21
aly-miR163-5p.1CGAGUUCCAGCCUCCUCAGAmiRBase21
aly-miR163-5p.2GACUUUAGCAACAACGAUUUCmiRBase21
aly-miR163-3p.2AAUCGUUGAGGCUGAAGUCGUmiRBase21
aly-miR163-3p.1UGAAGAGGACUUGGAACUCGAUCmiRBase21
aly-miR402-5pUUGGCCUAUUGAACCUCUGUUUmiRBase21
aly-miR402-3pACAGAGUUCCGUAGACCACGGmiRBase21
aly-miR773b-5pUAUCUUUGAACAAACAGUUGAmiRBase21
aly-miR773b-3pAAUUGUUCAUUCAAGGAUAUUmiRBase21
aly-miR3433-5pGGUCAUUUGAGAACUGUGAUGmiRBase21
aly-miR3433-3pUCACAGUUCUUGAUUACCCACmiRBase21
aly-miR837-5pCAUUGUUUCUUGUUUUUUUCAmiRBase21
aly-miR837-3pAAACGAACAAGAAACUGAUGAmiRBase21
aly-miR848-5pGGCAAUCCCAUGUCAAAmiRBase21
aly-miR848-3pUGACAUGGGACUAACAGACUAAmiRBase21
aly-miR851-5pUGGUCUUUGUUUGCGACCCAUACGmiRBase21
aly-miR851-3pUGUGGGUGGCAAACAAAGACGACAmiRBase21
aly-miR853-5pCUGCUAUCCUUUUCCUGUUGCAmiRBase21
aly-miR853-3pCAACCGGAAAGGGGAGCAGCAmiRBase21
aly-miR869-5pCACUUAUCUCAACCCUAGUGAmiRBase21
aly-miR869-3pCCUGGGUUUGAGAUAAUUGACmiRBase21
aly-miR3434-5pGCUGAUUCUCUGAUUUUGAACmiRBase21
aly-miR3434-3pUCAAAAUCAGAGAAUCAACCAmiRBase21
aly-miR774b-5pUGAGAUGAAGAUUUGGAUGACmiRBase21
aly-miR774b-3pCACCCAAAUCUUCCUCUCAGGmiRBase21
aly-miR3435-5pUGGCAUAAUUCUGUCAAUUCCmiRBase21
aly-miR3435-3pAAUUGACAGUAUUAUGCCAGAmiRBase21
aly-miR3436-5pCGAGCAAAAAUCAUUGUUGAUmiRBase21
aly-miR3436-3pCAACAACGAUUUUUGGGUCGUUmiRBase21
aly-miR3437-5pAAAAAACAAGGAUCCACGGAUmiRBase21
aly-miR3437-3pCGGUGGAUCUUGUUUUUUGUmiRBase21
aly-miR3438-3pUCCAUAGCUUCAUCUCUGACCmiRBase21
aly-miR3438-5pUCAAGGAUUAAGCUAUGAAGCmiRBase21
aly-miR3439-5pUUGGGGUUUCGAAAUCAAGAGmiRBase21
aly-miR3439-3pUCUGAUUUUCGAAGUCCCAAAAmiRBase21
aly-miR3440-5pUGGUUUCCCUGGCCAAUCCACUmiRBase21
aly-miR3440-3pUGGAUUGGUCAAGAGAACCGCAmiRBase21
aly-miR3441-5p.2CGAAGAAAAUGAAGUCGUUUUmiRBase21
aly-miR3441-5p.1UUCAAAGCAUCUUUGAAGGAAmiRBase21
aly-miR3441-3p.1CCCUCAAUGAUGUUUUGAAGCmiRBase21
aly-miR3441-3p.2AACGACUUCAUCUUCUUUGCUmiRBase21
aly-miR3442-5pACCAUGUUUAGACUCUGAAUUmiRBase21
aly-miR3442-3pUUCAGAGUCUAAACAUGGUGUmiRBase21
aly-miR3443-5pUUCUAAUCCCGCCAUGCACCGmiRBase21
aly-miR3443-3pGUGCCUUGUGAGAUUAGAGUUmiRBase21
aly-miR3444a-5pUUGGGAGCUCGAUGAGAUCGAmiRBase21
aly-miR3444a-3pAAUCUCAUCAAUCUCCCAAUAmiRBase21
aly-miR3445-5p.2GGUCUUUCUCCCUAUCAAGCGmiRBase21
aly-miR3445-5p.1CGAACCAUCACCUUCCAAACCmiRBase21
aly-miR3445-3p.1UUUGGAAGGUGAUUGUUUGCUmiRBase21
aly-miR3445-3p.2CUUGAUAGUGAGAAAGACCCAmiRBase21
aly-miR3446-5pCUCGGAAGCUAGACGUGUGGCAGGmiRBase21
aly-miR3446-3pUGCCACUCUUUUAGCUUCCGAAUCmiRBase21
aly-miR3447-5pCGUGACGAACAUAAUCAAACGmiRBase21
aly-miR3447-3pUUUGAGUGUGUUUGUUAUGAAmiRBase21
aly-miR3448-5pCCAGGAAAACAUCUUCAGACAmiRBase21
aly-miR3448-3pUCUGAGGAUUUUUUUUGUGGUCmiRBase21
aly-miR3449-5pUCUAGAUUGCUUUCGGUCUGUmiRBase21
aly-miR3449-3pAGAUAGAAAGCAAUCUGGAUA--miRBase21
aly-miR395iCUGAAGUGUUUGGAGGAACUCmiRBase21
aly-miR841UACGACCCACUGGAAACUAAAmiRBase21
aly-miR1887CACUUAGAUUGUUCUUAGUAUGAGmiRBase21
aly-miR4221AAGAGUUCAAAAGUAGUGAAGAmiRBase21
aly-miR4222UUUCAUUCGAAAUUGUUACCGCmiRBase21
aly-miR4223AUGGAAUUUGAUAAAUAAACACmiRBase21
aly-miR4224CAACUGAGCUUCCUCAUCUCUmiRBase21
aly-miR4225GAAUCGAUGGUUAAACAACACmiRBase21
aly-miR4226UACAAGAUGCAUUCGAGCAAUAmiRBase21
aly-miR4227UCAUUUGUGCCAAUCAUUCUAmiRBase21
aly-miR4228AAAGCCUUGAACGCUGUCGUUmiRBase21
aly-miR4229UUGGCAGGGAGGUCCUCCACACmiRBase21
aly-miR4230UGUCUCGGAAAUUUGCACCCUmiRBase21
aly-miR4231UAGACCUUUGUGUUGCCAUCGmiRBase21
aly-miR3444bAUCUCAUCAAUCUCCCAAUACmiRBase21
aly-miR4232UCACAUUUAUUAGGAUGUGUGCmiRBase21
aly-miR4233CACAUCAUCAACAUCAACUCCmiRBase21
aly-miR4234CAACUUAAAAUCAGUUGGCAAUmiRBase21
aly-miR4235ACUGAAAACACUACAACCCCUmiRBase21
aly-miR4236CAUUAAUUUGUUCCCCUCCUAmiRBase21
aly-miR4237AAACGUAAACAUAUAUAAUCGAmiRBase21
aly-miR4238UUUUUGCAAAUUAAAACCCCAAmiRBase21
aly-miR4239UCCGUUAUUUCCGCAUGCUCCmiRBase21
aly-miR4240AUGGCUAGAGUGACUAGACCCGmiRBase21
aly-miR4241CUUUGGGAUUUUCUUACAGCGAmiRBase21
aly-miR4242AAAGUUAACUAUGGCAUUCCCmiRBase21
aly-miR4243UGAAAUUAUAGAUUUCGUACAmiRBase21
aly-miR4244UUGUUGAUUCCUUGGAGAUUGmiRBase21
aly-miR4245ACAAAGUUUUAUACUGACAAUmiRBase21
aly-miR4246AAAUCCAAUUUUCAUUGCUUAAmiRBase21
aly-miR4247UGUAUCCUAAUAUUAGACCCCmiRBase21
aly-miR4248aACAUUUUAUUUUUGGCAAUCAmiRBase21
aly-miR4249UGAAUUUGAGAAGUUGAGGUAmiRBase21
aly-miR4250UCCAAAGGCACAAGAACAUCA--miRBase21
ath-miR156b-3pUGCUCACCUCUCUUUCUGUCAGUmiRBase21
ath-miR156d-3pGCUCACUCUCUUUUUGUCAUAACmiRBase21
ath-miR156f-3pGCUCACUCUCUAUCCGUCACCmiRBase21
ath-miR157a-3pGCUCUCUAGCCUUCUGUCAUCmiRBase21
ath-miR160c-3pCGUACAAGGAGUCAAGCAUGAmiRBase21
ath-miR161.1UGAAAGUGACUACAUCGGGGUmiRBase21
ath-miR162a-5pUGGAGGCAGCGGUUCAUCGAUCmiRBase21
ath-miR163UUGAAGAGGACUUGGAACUUCGAUmiRBase21
ath-miR165a-5pGGAAUGUUGUCUGGAUCGAGGmiRBase21
ath-miR165a-3pUCGGACCAGGCUUCAUCCCCCmiRBase21
ath-miR169a-3pGGCAAGUUGUCCUUGGCUACmiRBase21
ath-miR173-3pUGAUUCUCUGUGUAAGCGAAAmiRBase21
ath-miR159b-3pUUUGGAUUGAAGGGAGCUCUU--miRBase21
ath-miR319bUUGGACUGAAGGGAGCUCCCU--miRBase21
ath-miR169g-3pUCCGGCAAGUUGACCUUGGCUmiRBase21
ath-miR390b-3pCGCUAUCCAUCCUGAGUUCCmiRBase21
ath-miR394b-3pAGGUGGGCAUACUGCCAAUAGmiRBase21
ath-miR397bUCAUUGAGUGCAUCGUUGAUGmiRBase21
ath-miR398a-5pAAGGAGUGGCAUGUGAACACAmiRBase21
ath-miR398b-5pAGGGUUGAUAUGAGAACACACmiRBase21
ath-miR399fUGCCAAAGGAGAUUUGCCCGG--miRBase21
ath-miR401CGAAACUGGUGUCGACCGACAmiRBase21
ath-miR402UUCGAGGCCUAUUAAACCUCUGmiRBase21
ath-miR403-5pUGUUUUGUGCUUGAAUCUAAUUmiRBase21
ath-miR404AUUAACGCUGGCGGUUGCGGCAGCmiRBase21
ath-miR405aAUGAGUUGGGUCUAACCCAUAACUmiRBase21
ath-miR406UAGAAUGCUAUUGUAAUCCAGmiRBase21
ath-miR407UUUAAAUCAUAUACUUUUGGUmiRBase21
ath-miR408-5pACAGGGAACAAGCAGAGCAUGmiRBase21
ath-miR158bCCCCAAAUGUAGACAAAGCAmiRBase21
ath-miR164c-3pCACGUGUUCUACUACUCCAACmiRBase21
ath-miR167c-3pUAGGUCAUGCUGGUAGUUUCACCmiRBase21
ath-miR172e-3pGGAAUCUUGAUGAUGCUGCAU--miRBase21
ath-miR413AUAGUUUCUCUUGUUCUGCACmiRBase21
ath-miR414UCAUCUUCAUCAUCAUCGUCAmiRBase21
ath-miR415AACAGAGCAGAAACAGAACAUmiRBase21
ath-miR416GGUUCGUACGUACACUGUUCAmiRBase21
ath-miR417GAAGGUAGUGAAUUUGUUCGAmiRBase21
ath-miR418UAAUGUGAUGAUGAACUGACCmiRBase21
ath-miR419UUAUGAAUGCUGAGGAUGUUGmiRBase21
ath-miR420UAAACUAAUCACGGAAAUGCA--miRBase21
ath-miR426UUUUGGAAAUUUGUCCUUACG--miRBase21
ath-miR447a-3pUUGGGGACGAGAUGUUUUGUUGmiRBase21
ath-miR447a.2-3pUAUGGAAGAAAUUGUAGUAUUmiRBase21
ath-miR447c-5pCCCCUUACAAUGUCGAGUAAAmiRBase21
ath-miR447c-3pUUGGGGACGACAUCUUUUGUUG--miRBase21
ath-miR771UGAGCCUCUGUGGUAGCCCUCAmiRBase21
ath-miR773aUUUGCUUCCAGCUUUUGUCUCmiRBase21
ath-miR774aUUGGUUACCCAUAUGGCCAUCmiRBase21
ath-miR775UUCGAUGUCUAGCAGUGCCAmiRBase21
ath-miR776UCUAAGUCUUCUAUUGAUGUUmiRBase21
ath-miR777UACGCAUUGAGUUUCGUUGCUUmiRBase21
ath-miR778UGGCUUGGUUUAUGUACACCGmiRBase21
ath-miR779.2UGAUUGGAAAUUUCGUUGACUmiRBase21
ath-miR779.1UUCUGCUAUGUUGCUGCUCAUmiRBase21
ath-miR780.1UCUAGCAGCUGUUGAGCAGGUmiRBase21
ath-miR780.2UUCUUCGUGAAUAUCUGGCAUmiRBase21
ath-miR782ACAAACACCUUGGAUGUUCUU--miRBase21
ath-miR822-5pUGCGGGAAGCAUUUGCACAUGmiRBase21
ath-miR822-3pUGUGCAAAUGCUUUCUACAGGmiRBase21
ath-miR823UGGGUGGUGAUCAUAUAAGAUmiRBase21
ath-miR825UUCUCAAGAAGGUGCAUGAACmiRBase21
ath-miR826aUAGUCCGGUUUUGGAUACGUGmiRBase21
ath-miR827UUAGAUGACCAUCAACAAACUmiRBase21
ath-miR829-5pACUUUGAAGCUUUGAUUUGAAmiRBase21
ath-miR829-3p.1AGCUCUGAUACCAAAUGAUGGAAUmiRBase21
ath-miR829-3p.2CAAAUUAAAGCUUCAAGGUAGmiRBase21
ath-miR830-5pUCUUCUCCAAAUAGUUUAGGUUmiRBase21
ath-miR830-3pUAACUAUUUUGAGAAGAAGUGmiRBase21
ath-miR831-5pAGAAGCGUACAAGGAGAUGAGGmiRBase21
ath-miR831-3pUGAUCUCUUCGUACUCUUCUUGmiRBase21
ath-miR832-5pUGCUGGGAUCGGGAAUCGAAAmiRBase21
ath-miR832-3pUUGAUUCCCAAUCCAAGCAAGmiRBase21
ath-miR833a-5pUGUUUGUUGUACUCGGUCUAGUmiRBase21
ath-miR835-3pUGGAGAAGAUACGCAAGAAAGmiRBase21
ath-miR836UCCUGUGUUUCCUUUGAUGCGUGGmiRBase21
ath-miR837-5pAUCAGUUUCUUGUUCGUUUCAmiRBase21
ath-miR837-3pAAACGAACAAAAAACUGAUGGmiRBase21
ath-miR838UUUUCUUCUACUUCUUGCACAmiRBase21
ath-miR839-5pUACCAACCUUUCAUCGUUCCCmiRBase21
ath-miR840-5pACACUGAAGGACCUAAACUAACmiRBase21
ath-miR840-3pUUGUUUAGGUCCCUUAGUUUCmiRBase21
ath-miR841a-5pUACGAGCCACUUGAAACUGAAmiRBase21
ath-miR841a-3pAUUUCUAGUGGGUCGUAUUCAmiRBase21
ath-miR843UUUAGGUCGAGCUUCAUUGGAmiRBase21
ath-miR844-5pUGGUAAGAUUGCUUAUAAGCUmiRBase21
ath-miR844-3pUUAUAAGCCAUCUUACUAGUUmiRBase21
ath-miR845aCGGCUCUGAUACCAAUUGAUGmiRBase21
ath-miR846-5pCAUUCAAGGACUUCUAUUCAGmiRBase21
ath-miR848UGACAUGGGACUGCCUAAGCUAmiRBase21
ath-miR849UAACUAAACAUUGGUGUAGUAmiRBase21
ath-miR850UAAGAUCCGGACUACAACAAAGmiRBase21
ath-miR851-5pUCUCGGUUCGCGAUCCACAAGmiRBase21
ath-miR851-3pUGGGUGGCAAACAAAGACGACmiRBase21
ath-miR852AAGAUAAGCGCCUUAGUUCUGmiRBase21
ath-miR853UCCCCUCUUUAGCUUGGAGAAGmiRBase21
ath-miR847UCACUCCUCUUCUUCUUGAUGmiRBase21
ath-miR855AGCAAAAGCUAAGGAAAAGGAAmiRBase21
ath-miR854aGAUGAGGAUAGGGAGGAGGAGmiRBase21
ath-miR854dGAUGAGGAUAGGGAGGAGGAG--miRBase21
ath-miR856UAAUCCUACCAAUAACUUCAGCmiRBase21
ath-miR859UCUCUCUGUUGUGAAGUCAAAmiRBase21
ath-miR860UCAAUAGAUUGGACUAUGUAUmiRBase21
ath-miR861-5pCCUUGGAGAAAUAUGCGUCAAmiRBase21
ath-miR861-3pGAUGGAUAUGUCUUCAAGGACmiRBase21
ath-miR862-5pUCCAAUAGGUCGAGCAUGUGCmiRBase21
ath-miR862-3pAUAUGCUGGAUCUACUUGAAGmiRBase21
ath-miR863-5pUUAUGUCUUGUUGAUCUCAAUmiRBase21
ath-miR863-3pUUGAGAGCAACAAGACAUAAUmiRBase21
ath-miR864-5pUCAGGUAUGAUUGACUUCAAAmiRBase21
ath-miR864-3pUAAAGUCAAUAAUACCUUGAAGmiRBase21
ath-miR865-5pAUGAAUUUGGAUCUAAUUGAGmiRBase21
ath-miR865-3pUUUUUCCUCAAAUUUAUCCAAmiRBase21
ath-miR866-5pUCAAGGAACGGAUUUUGUUAAmiRBase21
ath-miR866-3pACAAAAUCCGUCUUUGAAGAmiRBase21
ath-miR845bUCGCUCUGAUACCAAAUUGAUGmiRBase21
ath-miR867UUGAACAUGGUUUAUUAGGAAmiRBase21
ath-miR868-5pUCAUGUCGUAAUAGUAGUCACmiRBase21
ath-miR868-3pCUUCUUAAGUGCUGAUAAUGCmiRBase21
ath-miR869.1AUUGGUUCAAUUCUGGUGUUGmiRBase21
ath-miR869.2UCUGGUGUUGAGAUAGUUGACmiRBase21
ath-miR870-5pAAGAACAUCAAAUUAGAAUGUmiRBase21
ath-miR870-3pUAAUUUGGUGUUUCUUCGAUC--miRBase21
ath-miR1886.1UGAGAGAAGUGAGAUGAAAUCmiRBase21
ath-miR1886.2UGAGAUGAAAUCUUUGAUUGGmiRBase21
ath-miR1886.3AAUUAAAGAUUUCAUCUUACUmiRBase21
ath-miR1887UACUAAGUAGAGUCUAAGAGAmiRBase21
ath-miR1888aUAAGUUAAGAUUUGUGAAGAA--miRBase21
ath-miR2111b-3pAUCCUCGGGAUACAGUUUACCmiRBase21
ath-miR2112-3pCUUUAUAUCCGCAUUUGCGCA--miRBase21
ath-miR2933aGAAAUCGGAGAGGAAAUUCGCCmiRBase21
ath-miR2934-5pUCUUUCUGCAAACGCCUUGGAmiRBase21
ath-miR2934-3pCAUCCAAGGUGUUUGUAGAAAmiRBase21
ath-miR2936CUUGAGAGAGAGAACACAGACGmiRBase21
ath-miR2937AUAAGAGCUGUUGAAGGAGUCmiRBase21
ath-miR2938GAUCUUUUGAGAGGGUUCCAGmiRBase21
ath-miR2939UAACGCACAACACUAAGCCAU--miRBase21
ath-miR773b-5pGGCAAUAACUUGAGCAAACAmiRBase21
ath-miR773b-3pUUUGAUUCCAGCUUUUGUCUCmiRBase21
ath-miR3434-5pACUUGGCUGAUUCUAUUAUUmiRBase21
ath-miR3434-3pUCAGAGUAUCAGCCAUGUGAmiRBase21
ath-miR774b-5pUGAGAUGAAGAUAUGGGUGAUmiRBase21
ath-miR774b-3pCAUCCAUAUUUUCAUCUCGAAmiRBase21
ath-miR841b-5pUACGAGCCACUGGAAACUGAAmiRBase21
ath-miR841b-3pCAAUUUCUAGUGGGUCGUAUU--miRBase21
ath-miR4221UUUUCCUCUGUUGAAUUCUUGCmiRBase21
ath-miR4227UCACUGGUACCAAUCAUUCCAmiRBase21
ath-miR4228-5pAUAGCCUUGAACGCCGUCGUUmiRBase21
ath-miR4228-3pUCGGAUGCGAAACGGUGGUGUmiRBase21
ath-miR3440b-5pUUUUCUUGGCCCAUCCACUUCmiRBase21
ath-miR3440b-3pUGGAUUGGUCAAGGGAAGCGUmiRBase21
ath-miR4239UUUGUUAUUUUCGCAUGCUCCmiRBase21
ath-miR4240UGACUAGACCCGUAACAUUACmiRBase21
ath-miR4243UUGAAAUUGUAGAUUUCGUAC--miRBase21
ath-miR3932aAACUUUGUGAUGACAACGAAGmiRBase21
ath-miR3932b-5pUUUGACGUGCUCGAUCUGCUCmiRBase21
ath-miR3933AGAAGCAAAAUGACGACUCGG--miRBase21
ath-miR5012UUUUACUGCUACUUGUGUUCCmiRBase21
ath-miR5013UUUGUGACAUCUAGGUGCUUUmiRBase21
ath-miR5014a-5pACACUUAGUUUUGUACAACAUmiRBase21
ath-miR5014a-3pUUGUACAAAUUUAAGUGUACGmiRBase21
ath-miR5015UUGGUGUUAUGUGUAGUCUUCmiRBase21
ath-miR5016UUCUUGUGGAUUCCUUGGAAAmiRBase21
ath-miR5017-5pAUUUGUUACUAAUUUGGAAUGmiRBase21
ath-miR5017-3pUUAUACCAAAUUAAUAGCAAAmiRBase21
ath-miR5018UUAAAGCUCCACCAUGAGUCCAAUmiRBase21
ath-miR5019UGUUGGGAAAGAAAAACUCUUmiRBase21
ath-miR5020aUGGAAGAAGGUGAGACUUGCAmiRBase21
ath-miR5021UGAGAAGAAGAAGAAGAAAAmiRBase21
ath-miR5022GUCAUGGGGUAUGAUCGAAUGmiRBase21
ath-miR5023AUUGGUAGUGGAUAAGGGGGCmiRBase21
ath-miR5020bAUGGCAUGAAAGAAGGUGAGAmiRBase21
ath-miR5024-5pAUGACAAGGCCAAGAUAUAACAmiRBase21
ath-miR5024-3pCCGUAUCUUGGCCUUGUCAUUmiRBase21
ath-miR5025ACUGUAUAUAUGUAAGUGACAmiRBase21
ath-miR5026ACUCAUAAGAUCGUGACACGUmiRBase21
ath-miR5027ACCGGUUGGAACUUGCCUUAAmiRBase21
ath-miR5028AAUUGGGUUUAUGCUAGAGUUmiRBase21
ath-miR5029AAUGAGAGAGAACACUGCAAA--miRBase21
ath-miR5628GAAAUAGCGAAGAUAUGAUUAmiRBase21
ath-miR5629UUAGGGUAGUUAACGGAAGUUAmiRBase21
ath-miR5630aGCUAAGAGCGGUUCUGAUGGAmiRBase21
ath-miR5631UGGCAGGAAAGACAUAAUUUUmiRBase21
ath-miR5020cUGGCAUGGAAGAAGGUGAGACmiRBase21
ath-miR5632-5pUUGAUUCUCUUAUCCAACUGUmiRBase21
ath-miR5632-3pUUGGAUUUAUAGUUGGAUAAGmiRBase21
ath-miR5633UAUGAUCAUCAGAAAACAGUGmiRBase21
ath-miR5634AGGGACUUUGUGAAUUUAGGGmiRBase21
ath-miR5635aUGUUAAGGAGUGUUAACGGUGmiRBase21
ath-miR5636CGUAGUUGCAGAGCUUGACGGmiRBase21
ath-miR5637AAUGCGCAACUCUAUAUUUCCmiRBase21
ath-miR5638aAUACCAAAACUCUCUCACUUUmiRBase21
ath-miR5639-5pUAGUCCACUGUGGUCUAAGGCmiRBase21
ath-miR5639-3pUUUAGCCUCAGACCACGGUGGACUmiRBase21
ath-miR5640UGAGAGAAGGAAUUAGAUUCAmiRBase21
ath-miR5641UGGAAGAAGAUGAUAGAAUUAmiRBase21
ath-miR5642aUCUCGCGCUUGUACGGCUUUmiRBase21
ath-miR5643aAGGCUUUUAAGAUCUGGUUGCmiRBase21
ath-miR5644GUGGGUUGCGGAUAACGGUAmiRBase21
ath-miR5638bACAGUGGUCAUCUGGUGGGCUmiRBase21
ath-miR5645aAUUUGAGUCAUGUCGUUAAGmiRBase21
ath-miR5646GUUCGAGGCACGUUGGGAGGmiRBase21
ath-miR5647UCAAGUUUGAUGACGAUUCCAmiRBase21
ath-miR5648-5pUUUGGAAAUAUUUGGCUUGACUmiRBase21
ath-miR5648-3pAUCUGAAGAAAAUAGCGGCAUmiRBase21
ath-miR5645cAACCUAUUUAACGACAUGACUmiRBase21
ath-miR5649aAUUGAAUAUGUUGGUUACUAUmiRBase21
ath-miR5650UUGUUUUGGAUCUUAGAUACAmiRBase21
ath-miR858bUUCGUUGUCUGUUCGACCUUGmiRBase21
ath-miR833bUGUUUGUUGACAUCGGUCUAGmiRBase21
ath-miR156iUGACAGAAGAGAGAGAGCAGmiRBase21
ath-miR5651UUGUGCGGUUCAAAUAGUAACmiRBase21
ath-miR156jUGACAGAAGAGAGAGAGCACmiRBase21
ath-miR5652UUGAAUGUGAAUGAAUCGGGCmiRBase21
ath-miR5653UGGGUUGAGUUGAGUUGAGUUGGCmiRBase21
ath-miR5654-5pAUAAAUCCCAACAUCUUCCAmiRBase21
ath-miR5654-3pUGGAAGAUGCUUUGGGAUUUAUUmiRBase21
ath-miR5655AAGUAGACACAUAAGAAGGAGmiRBase21
ath-miR5656ACUGAAGUAGAGAUUGGGUUUmiRBase21
ath-miR5657UGGACAAGGUUAGAUUUGGUGmiRBase21
ath-miR5658AUGAUGAUGAUGAUGAUGAAAmiRBase21
ath-miR5659CGAUGAAGGUCUUUGGAACGGUAmiRBase21
ath-miR5660CAGGUGGUUAGUGCAAUGGAAmiRBase21
ath-miR1888bUUAGGCUAAGAUUUGUGAAGAmiRBase21
ath-miR5661AGAGGUACAUCAUGUAGUCUGmiRBase21
ath-miR5662AGAGGUGACCAUUGGAGAUGmiRBase21
ath-miR5663-5pAGCUAAGGAUUUGCAUUCUCAmiRBase21
ath-miR5663-3pUGAGAAUGCAAAUCCUUAGCUmiRBase21
ath-miR5664AUAGUCAAUUUUAUCGGUCUGmiRBase21
ath-miR5665UUGGUGGACAAGAUCUGGGAUmiRBase21
ath-miR5666AUGGGACAUCGAGCAUUUAAUmiRBase21
ath-miR5645eAUUUGAGUCAUGUCGUUAAG--miRBase21
ath-miR5595aACAUAUGAUCUGCAUCUUUGCmiRBase21
ath-miR5996UGACAUCCAGAUAGAAGCUUUGmiRBase21
ath-miR5997UGAAACCAAGUAGCUAAAUAGmiRBase21
ath-miR5998aACAGUUUGUGUUUUGUUUUGUmiRBase21
ath-miR5014bAUUUGUACACCUAGAUCUGUAmiRBase21
ath-miR5999UCUUCACUAUUAGACGGACAA--miRBase21
ath-miR8121AAAGUAUAAUGGUUUAGUGGUUUG--miRBase21
ath-miR8165AAUGGAGGCAAGUGUGAAGGAmiRBase21
ath-miR8166AGAGAGUGUAGAAAGUUUCUCAmiRBase21
ath-miR8167aAGAUGUGGAGAUCGUGGGGAUGmiRBase21
ath-miR8168AGGUGCUGAGUGUGCUAGUGCmiRBase21
ath-miR8169AUAGACAGAGUCACUCACAGAmiRBase21
ath-miR8170-5pAUAGCAAAUCGAUAAGCAAUGmiRBase21
ath-miR8170-3pUUGCUUAAAGAUUUUCUAUGUmiRBase21
ath-miR8171AUAGGUGGGCCAGUGGUAGGAmiRBase21
ath-miR8172AUGGAUCAUCUAGAUGGAGAUmiRBase21
ath-miR8173AUGUGCUGAUUCGAGGUGGGAmiRBase21
ath-miR8174AUGUGUAUAGGGAAGCUAAUCmiRBase21
ath-miR8175GAUCCCCGGCAACGGCGCCAmiRBase21
ath-miR8176GGCCGGUGGUCGCGAGAGGGAmiRBase21
ath-miR8177GUGUGAUGAUGUGUCAUUUAUAmiRBase21
ath-miR8178UAACAGAGUAAUUGUACAGUGmiRBase21
ath-miR8179UGACUGCAUUAACUUGAUCGUmiRBase21
ath-miR8180UGCGGUGCGGGAGAAGUGCmiRBase21
ath-miR8181UGGGGGUGGGGGGGUGACAGmiRBase21
ath-miR8182UUGUGUUGCGUUUCUGUUGAUUmiRBase21
ath-miR8183UUUAGUUGACGGAAUUGUGGCmiRBase21
ath-miR8184UUUGGUCUGAUUACGAAUGUA--miRBase21
ath-miR826bUGGUUUUGGACACGUGAAAAU--miRBase21
aar-miR854UGGAUAUAGAGGAAUAUAACACPNRD
aly-miR3449-3pAGAUAGAAAGCAAUCUGGAUAPNRD
aly-miR4250UCCAAAGGCACAAGAACAUCAPNRD
ath-miR157mUUGACAGAAGAGAGAGAGCACPNRD
ath-miR167mUGAAGCUGCCAGCAUGAUCUGPNRD
ath-miR172eGGAAUCUUGAUGAUGCUGCAUPNRD
ath-miR172mAGAAUCCUGAUGAUGCUGCAGPNRD
ath-miR173mUUCGCUUGGAGAGANAAAUCACPNRD
ath-miR1888aUAAGUUAAGAUUUGUGAAGAAPNRD
ath-miR2935UGGAAUCACACGGUCGUCAUUCPNRD
ath-miR2939UAACGCACAACACUAAGCCAUPNRD
ath-miR3933AGAAGCAAAAUGACGACUCGGPNRD
ath-miR420UAAACUAAUCACGGAAAUGCAPNRD
ath-miR4243UUGAAAUUGUAGAUUUCGUACPNRD
ath-miR426UUUUGGAAAUUUGUCCUUACGPNRD
ath-miR447cUUGGGGACGACAUCUUUUGUUGPNRD
ath-miR5029AAUGAGAGAGAACACUGCAAAPNRD
ath-miR5999UCUUCACUAUUAGACGGACAAPNRD
ath-miR782ACAAACACCUUGGAUGUUCUUPNRD
ath-miR783AAGCUUUGCUCGUUCAUGUUCPNRD
ath-miR8121AAAGUAUAAUGGUUUAGUGGUUUGPNRD
ath-miR8184UUUGGUCUGAUUACGAAUGUAPNRD
ath-miR826bUGGUUUUGGACACGUGAAAAUPNRD
ath-miR841b-3pCAAUUUCUAGUGGGUCGUAUUPNRD
ath-miR870UAAUUUGGUGUUUCUUCGAUCPNRD
ath-miRf10000-nprCCUCGAUCCAGACAACAUUCCCCUPNRD
ath-miRf10001-nprCCCAGAAAAUCUCAAAGCCCPNRD
ath-miRf10002-nprACUCCUCUUCUUCUUGAUGUAPNRD
ath-miRf10003-nprUCCUUGGCUACCACACAAGUPNRD
ath-miRf10004-nprAAACGACGUCGUUGGUGAUUPNRD
ath-miRf10005-nprGUGCAUGUGCAUGUGCAUGUPNRD
ath-miRf10006-nprUACCUUUCUGUCUUGUGUCAPNRD
ath-miRf10007-nprGAGUCCACCGGAGCCACUCUPNRD
ath-miRf10008-nprUCCACUUCCGUUGUAGCUUCGGPNRD
ath-miRf10009-nprUUUGGAUGGAUCAUUUGGAUPNRD
ath-miRf10010-nprGCUACCGCAGCCGCUGCCGCAPNRD
ath-miRf10011-nprCGGAUCCGGAUACGGAUCCGGPNRD
ath-miRf10012-nprUGCUUUGUCCAAGAACCUGAAAPNRD
ath-miRf10013-nprUUGGUCGCUGAAUCCAGCGACAUGPNRD
ath-miRf10014-nprCCUCGCAAAAGUUGCGAGGGAUPNRD
ath-miRf10015-nprAGAAGACUCUGAAGCUGGCAPNRD
ath-miRf10016-nprUUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10017-nprUACUCGACCAGGGGGUCGAGUAGUPNRD
ath-miRf10018-nprUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10019-nprGUCGCUGCUUUUGGUCGCUGAAPNRD
ath-miRf10020-nprUACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10021-nprCUACUCGACCUCGGGGUCGAGUGGPNRD
ath-miRf10022-nprCACUCGACCCCGAGGUCGAGUGUCUUPNRD
ath-miRf10023-nprUGCUCGAGUGUCUGGUUGAGUGCPNRD
ath-miRf10024-nprUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10025-nprAAGAAGACUCUGAAGCUUGUPNRD
ath-miRf10026-nprACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10027-nprUACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10028-nprUACUCGACCUCUGGGUCGAGUGPNRD
ath-miRf10029-nprCUACUCGACCUCUGGGUCGAAUGPNRD
ath-miRf10030-nprGAUACUUUGCAGCCACAAUCUPNRD
ath-miRf10032-nprCUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10033-nprCUAGUCGACCUCGGGGUCGAGUGPNRD
ath-miRf10034-nprAAGUCACUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10035-nprACUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10036-nprACUUGACCUCUAGGUCGAGUGPNRD
ath-miRf10038-nprCACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10039-nprGAUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10040-nprAUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10041-nprUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10042-nprCUACUCGACCUCUGGGUCGAGUGGUPNRD
ath-miRf10043-nprUCGACCUCUGGGUCGAGUGGUUUGPNRD
ath-miRf10044-nprGGUCGAGUGGUUUGUCAUGAUCAPNRD
ath-miRf10045-nprUCUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10046-nprCUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10047-nprGGUGGUGUCGAUCGACACCAUCPNRD
ath-miRf10048-nprAUGGGAUCGAUCGAUCCCAGGPNRD
ath-miRf10049-nprCUUGCGAGGGAAGGCUUCCUCGPNRD
ath-miRf10050-nprAUCUUGGCCUUGUCAUCUCAPNRD
ath-miRf10052-nprAGUUGUUGGUUCAACAACAUPNRD
ath-miRf10053-nprCCAUUCACCAACUGCAGACAPNRD
ath-miRf10054-nprGUUAGGAGAGCUGUUAAGAAGPNRD
ath-miRf10055-nprUGGUUACCCAUAUGGCCAUCUCPNRD
ath-miRf10056-nprACACCAUCAUGGUCAGAUCCGPNRD
ath-miRf10057-nprUCAUGGUCAGAUCCGUCAUCCCACUUAPNRD
ath-miRf10058-nprGUGAACCACACUUGGAGUCCUCPNRD
ath-miRf10059-nprACCACACUUGGAGUCCUCCCACAPNRD
ath-miRf10060-nprUCCGGAGGGAUUCCUUCCUUPNRD
ath-miRf10061-nprAAGGUGUUAAAAUCCCUUGUPNRD
ath-miRf10063-nprCCAGGAGCUUCCUCGUUCUUPNRD
ath-miRf10064-nprAUCGCCGGUGGAAUCUCUCCGGUGAPNRD
ath-miRf10065-nprCCGGUGGAAUCUCUCCGGUGAPNRD
ath-miRf10066-nprAGGUCUUGGGUUCGAGGAACPNRD
ath-miRf10067-nprUGGGUUCGAGGAACGCCAAGPNRD
ath-miRf10068-nprCACCGGUGGAGGAGUGAGAGPNRD
ath-miRf10069-nprUGAUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10070-nprACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10071-nprUACUCGACCAAAGGGUCGAGUGGUPNRD
ath-miRf10072-nprUCUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10073-nprCUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10076-nprCUACUCGACCAAGGGGUCGAGUGPNRD
ath-miRf10077-nprUCUACUCGACCAGGGGGUCGAGUGGUUPNRD
ath-miRf10080-nprCACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10081-nprUCGACCUCGUGGUCGAGUGGPNRD
ath-miRf10082-nprACUCGACCUGGGGUCGAGUGGUPNRD
ath-miRf10083-nprGUUACUCGACCAUGGGGUCGAGUAUPNRD
ath-miRf10085-nprUACUCGAGCUCGUGGUCGAGUPNRD
ath-miRf10086-nprUGCUCGAUUGUCUGGUUGAGPNRD
ath-miRf10088-nprUACUCGACCAUGGGGUCGAGUGGUGPNRD
ath-miRf10089-nprGGUCGAGUGGUGACGUGAAGUGPNRD
ath-miRf10090-nprCGAAGGUGUCGAUCGAUACCCCUPNRD
ath-miRf10091-nprCUAGUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10092-nprUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10093-nprUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10094-nprGAGGUCGAGUGUCUUCUACUPNRD
ath-miRf10095-nprUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10096-nprGUUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10098-nprUGGUGUCGAUCGACACCCAAGUPNRD
ath-miRf10099-nprUCUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10100-nprCUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10101-nprCUACUCGGCCAUGGGGUCGAPNRD
ath-miRf10102-nprCCUCGCAAAAAUUGCGAGGGAAPNRD
ath-miRf10103-nprGGUUCCCAAAGCGUUUUCUCGAUPNRD
ath-miRf10104-nprCCACUCGACCCCGAGGUCGAGUGPNRD
ath-miRf10105-nprUUGGUGGAGAAUCGUUCGGUPNRD
ath-miRf10106-nprAGUGUAGUUGUUGCCGGAGAPNRD
ath-miRf10107-nprUCAGCAUAUGCUGGAUCUACUPNRD
ath-miRf10108-nprUGCAGUGCAUAUUUGGCUGCAPNRD
ath-miRf10109-nprUGGAGUGGACGAGGGAAUCUPNRD
ath-miRf10110-nprUGUUACCGUUGCCGCUGCCGCPNRD
ath-miRf10111-nprUUUGGCGCUAUCCAUCCUGAPNRD
ath-miRf10112-nprUCCUGAGUUUCAUUGGCUCUPNRD
ath-miRf10113-nprGAUGGCGUAUGAGGAGCCAUPNRD
ath-miRf10114-nprGAUCAUGCUAUCUCUUUGGAPNRD
ath-miRf10115-nprACCAUCUUCUUCGUCUUCGCCPNRD
ath-miRf10116-nprAGUGGCUGCAGCUGCAGCGACUPNRD
ath-miRf10117-nprGCACAUCAUCUUGCUUCCUCPNRD
ath-miRf10118-nprAUCAUCUUGCUUCCUCCACAAPNRD
ath-miRf10119-nprCUCGGUAGAGAUCUUCUUCUCPNRD
ath-miRf10120-nprGUGUGUAUGUCUCUACUUGGACPNRD
ath-miRf10121-nprACCAUUGGAAAGUGCUCUAAPNRD
ath-miRf10122-nprUGCCCACCAAAUUAUCAAGAPNRD
ath-miRf10123-nprCCGACCCGAAUACCCGAACGPNRD
ath-miRf10124-nprAGUUGGUGUCGCUCGACACCPNRD
ath-miRf10125-nprGUGGUCGAUUGCGUGGUCGAPNRD
ath-miRf10126-nprCUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10127-nprCUACUCGACCUAGGGGUCGAGUGGUPNRD
ath-miRf10128-nprCCUCGCAAUUGUCUCGCAAAUUUGPNRD
ath-miRf10129-nprAAGUCACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10130-nprCACUCGACCUGGGGGUCGAGUGAUPNRD
ath-miRf10131-nprUACUCGACCUCUAGGUCGAGUGGUPNRD
ath-miRf10132-nprACCUCUAGGUCGAGUGGUUUGPNRD
ath-miRf10133-nprUACUCGACCUGUUGGUCGAGUGGPNRD
ath-miRf10135-nprUCGACCUCUGGGUCGAGUGGUPNRD
ath-miRf10139-nprCUGCUCGACCUGUGGGUCGAGUGGUPNRD
ath-miRf10141-nprACUCUACCUCAUGGUCGAGUGPNRD
ath-miRf10142-nprAUGCUCGAAUGUCUGGUUGAGUGCPNRD
ath-miRf10143-nprCUACUCGAGCUCGUGGUCGAGUGGUPNRD
ath-miRf10144-nprUCGAGCUCGUGGUCGAGUGGUGPNRD
ath-miRf10145-nprCACUCGACCACCUGGUCGAGUPNRD
ath-miRf10146-nprUGCUCGAGUGUAUGGUUGAGUGCPNRD
ath-miRf10147-nprGAAGAAGGCUCUGAAGCUUUUCPNRD
ath-miRf10148-nprGGUGGUGGAAAGAUCAAGAUPNRD
ath-miRf10149-nprAUCCCUCGCAAAUUUUGCGAPNRD
ath-miRf10151-nprUCUACUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10152-nprCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10153-nprUGCUCGAGUGUCUAGUUGAGUGCPNRD
ath-miRf10154-nprUAUUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10155-nprUGAUACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf10156-nprACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf10157-nprCUACUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10158-nprUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10159-nprUCGACCCCCUGGUCGAGUAUPNRD
ath-miRf10160-nprACUCGACCAGGGGGUCGAGUAUGPNRD
ath-miRf10163-nprUACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10165-nprUACUCGACCUUGGGGUCGAGUGPNRD
ath-miRf10166-nprCGACCUUGGGGUCGAGUGGUPNRD
ath-miRf10167-nprAGAGGUGUCGAUCGACACCAACPNRD
ath-miRf10168-nprGCGGUACUCGACCAGUGGGUCGAGUPNRD
ath-miRf10169-nprUACUCGACCAGUGGGUCGAGUPNRD
ath-miRf10170-nprCUACUCGACCAGGGGGUCGAGUAGUPNRD
ath-miRf10171-nprGCGGUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10172-nprUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10173-nprCCACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10174-nprUCGGCUUCAGCUCUUCCAUCPNRD
ath-miRf10175-nprGGCACUCGACCACGGGGUCGAGUGPNRD
ath-miRf10176-nprCUCGACCACGGGGUCGAGUGPNRD
ath-miRf10179-nprAGUGGUGGGAUCGAUCGAUCCPNRD
ath-miRf10180-nprGCCGCCAUAUCUCUCCGCCGUCPNRD
ath-miRf10181-nprGUUGUUGCCGUGAACGGCGUGAGPNRD
ath-miRf10182-nprAACGGCGUGAGUGCCGUAGAPNRD
ath-miRf10183-nprAGCCAUCAUCAUGUUCCUGUPNRD
ath-miRf10184-nprAAAUCGAUUUGGGGAUUUAGGPNRD
ath-miRf10185-nprGCGUUGGUGACCAGCCUCUGPNRD
ath-miRf10186-nprCUGCGUUUGCGGGUGGUAGAPNRD
ath-miRf10187-nprGAUCAUGCGAUCUCUUUGGAUPNRD
ath-miRf10188-nprGAUGAUCCGUCACGAUGUGGUPNRD
ath-miRf10189-nprGAUUCUCGCCGGAGAGAAGAPNRD
ath-miRf10190-nprCUACUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10192-nprCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10193-nprGAUACUCGACCAUGGGGUCGAGUGGUGPNRD
ath-miRf10194-nprCUCGACCAUGGGGUCGAGUGGUPNRD
ath-miRf10195-nprUCUACUCGACUAGGGGGUCGAGUGUPNRD
ath-miRf10196-nprGGUCGAGUAGAGGACAUCACPNRD
ath-miRf10197-nprCACUCGACCAAGGGGGUCGAGUGAPNRD
ath-miRf10198-nprUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10199-nprACUCGACCUCUAGGUCGAGUPNRD
ath-miRf10200-nprUACUCGACCUCAGGGUCGAGUGPNRD
ath-miRf10201-nprCUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10202-nprUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10203-nprGGUCGAGUGGUUUGGCAUGAUCAPNRD
ath-miRf10204-nprUCGAGUAUGCAGUCGAGUGGUGPNRD
ath-miRf10205-nprUACUCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf10207-nprGGUACUCGACCACAGGGUCGAGUGPNRD
ath-miRf10208-nprCUCGACCACAGGGUCGAGUGPNRD
ath-miRf10209-nprAUGGUGGUACUCGGCCAGGUGGUPNRD
ath-miRf10210-nprCUCGACCAAGGGGUCGAGUGGUPNRD
ath-miRf10211-nprGGUACUCGACCAGGUGGUCUAGUGGUPNRD
ath-miRf10212-nprCUCGACCAGGUGGUCUAGUGGUPNRD
ath-miRf10213-nprUACUCGACCAGGGGGUCGAGUAAUPNRD
ath-miRf10214-nprACCUGGGGGUCGAGUGGUCUPNRD
ath-miRf10217-nprCUACUCGACCGCUGGGUCGAGUGGUPNRD
ath-miRf10218-nprCUCGACCAGGAGGUCGAGUGPNRD
ath-miRf10219-nprUACUCGACCAUGGGGUCGAGUPNRD
ath-miRf10220-nprCACUCGACCUCAUGGUCGAGUGAPNRD
ath-miRf10221-nprGAUACUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10222-nprCUCGACCAGGGGGUCGAGUGGPNRD
ath-miRf10223-nprCACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10224-nprGUAUGGUGUCGAUCGACACUGGAGPNRD
ath-miRf10226-nprAGAUUAGGGUUGAUGCGCUGPNRD
ath-miRf10227-nprACUCGACCCCCUGGUCGAGUGPNRD
ath-miRf10228-nprACUCGACCACGAAGUCGAGUPNRD
ath-miRf10229-nprCCACUCGACCACGAGGUCGAGUGCPNRD
ath-miRf10230-nprAGUUGGUGUCGCUCGACACCGAGPNRD
ath-miRf10231-nprCACUCGACCACGUGGUCGAGUGPNRD
ath-miRf10232-nprACUGCUACUCGACCAAGGGGUCGPNRD
ath-miRf10233-nprCUACUCGACCAAGGGGUCGUGPNRD
ath-miRf10234-nprCCAGCUUUCCAUUGCACUAAPNRD
ath-miRf10235-nprGAGCAUUGUGGAGAUCAAAUPNRD
ath-miRf10236-nprGAAGUUGCGGUGAAGCGGCUPNRD
ath-miRf10237-nprUGCUCGUCUUCGCCGGUUAGPNRD
ath-miRf10238-nprGCGUACAGAGUAGUCAAGCAUPNRD
ath-miRf10239-nprCGCCUUGCAUCAACUGAAUCPNRD
ath-miRf10240-nprAUCGAAGGAGAUGGAGGACGPNRD
ath-miRf10241-nprUCGUGGCCGAUCUGCUGAGGPNRD
ath-miRf10243-nprUGGAGCCAUGGUGGGAGCUGPNRD
ath-miRf10244-nprUUCUUCCGCCGCUUGGAGUCPNRD
ath-miRf10245-nprUGUUGGCUUGAACGACGGCCAUPNRD
ath-miRf10246-nprACUGAUACGGCCCAUUAAGAPNRD
ath-miRf10247-nprAUGUGCCCAUCUUCACCAUCPNRD
ath-miRf10248-nprCUUGGAUUUGGUCUGAUUACPNRD
ath-miRf10249-nprCUUGUACUGGUUAGCGUCCAPNRD
ath-miRf10250-nprGAUGAUGAUGAUACUCAGGAPNRD
ath-miRf10251-nprGUUCCGGCGAGUCUGUUCCCPNRD
ath-miRf10252-nprGGAGCUGUUAUCUCCUCUAGAPNRD
ath-miRf10253-nprUUUGCGAUGAGUUUGCGAGGAUPNRD
ath-miRf10254-nprUGAACCGCUGCCUCCAGCGAPNRD
ath-miRf10255-nprGGACUGCACAUUUAAGAGCCPNRD
ath-miRf10256-nprGCUAUGUGUGCUCACUCUCUPNRD
ath-miRf10257-nprGUGUGCUCACUCUCUAUCCGPNRD
ath-miRf10258-nprCCCAUGCCUUUCUUGUGUAAPNRD
ath-miRf10259-nprUAUCUCUGCAACUGCAACUGCPNRD
ath-miRf10260-nprGAGGUGUCGAUCGACACCAACPNRD
ath-miRf10261-nprUCGCAAAUUUGCGAGGGAGUUGCGPNRD
ath-miRf10262-nprGCGAGGAAUUUGUGAGGGUCGPNRD
ath-miRf10263-nprCGUAUGGUGUCGAUCGACACCAUPNRD
ath-miRf10264-nprUGGUGUCGAUCGACACCAUCPNRD
ath-miRf10265-nprGGAACUGGCUGGUGACGAGUPNRD
ath-miRf10266-nprGCGGCGGUGGAGAAGCUCCUGCGGUPNRD
ath-miRf10267-nprGAUACUCGACUUCCAGAUUGAGUGAPNRD
ath-miRf10268-nprGACACUCAACCUCAUGGUCGAGUGPNRD
ath-miRf10270-nprCUGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10274-nprGAUACUCGACUUCCAGGUUGAGUGPNRD
ath-miRf10276-nprGAUACUCGACUUCCAGGUUGAGUGAPNRD
ath-miRf10277-nprCUCGACUUCCAGGUUGAGUGPNRD
ath-miRf10278-nprCUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10279-nprACUCAGCCUGGGGGUCGAGUGAUPNRD
ath-miRf10282-nprAUUACUCGACCCCUGGGUCGAGUAPNRD
ath-miRf10283-nprUACUCGACCUCUUGGUCGAGUGPNRD
ath-miRf10284-nprAUCUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10285-nprAUCUACUCGACCAGGGGGUCGAGUGUPNRD
ath-miRf10286-nprACUCGACCAGGGGGUCGAGUGUPNRD
ath-miRf10287-nprGUUCUCUCUCAUUCCCGAUCGPNRD
ath-miRf10288-nprUAUGGUGUCGAUCGACACUGPNRD
ath-miRf10289-nprACUCGGCCUGGGGGUCGAGUGAUPNRD
ath-miRf10295-nprGGAUCGAUCGAUCCCGAACUGGPNRD
ath-miRf10296-nprUACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10297-nprGUCACUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10298-nprCUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10300-nprGUAGUGUCGGUCGACACUGAPNRD
ath-miRf10301-nprUCCAGCGACAUGCAAACGAACAAPNRD
ath-miRf10302-nprUUGUCGGAGUCGUCAUUUUGCPNRD
ath-miRf10303-nprGUGGUUGUUGUUCUACAGGGPNRD
ath-miRf10304-nprAUGAUGCUGUUGGGUUUCUCPNRD
ath-miRf10305-nprUCUCCAAAUCAGUUUUAACAPNRD
ath-miRf10306-nprGUCACUUCCAGACCAGCGAGPNRD
ath-miRf10307-nprAGAGAUACGACGGAGAUGGAPNRD
ath-miRf10308-nprGCUGUUAGAGAACCAAGUUCCAPNRD
ath-miRf10309-nprGAAUCAGUUGGGGAGAAAGUAPNRD
ath-miRf10310-nprUCCGAAUCAGAAUCGGAGUCPNRD
ath-miRf10311-nprACCGCCGCCGUGUUCUGUCGAPNRD
ath-miRf10312-nprUCCUGCUAAUGGUUCUAGCAGAAPNRD
ath-miRf10313-nprUAUCUCUCCUACGUAGCAAUCPNRD
ath-miRf10314-nprCACCCGUCAAGAACGAGGAAPNRD
ath-miRf10315-nprACCUUUAUAUCCGCAUUUGCGPNRD
ath-miRf10316-nprCCAGAAAUUCUCAAAGCCCCPNRD
ath-miRf10317-nprGAGAACGCGUCGUCGACGAGUPNRD
ath-miRf10318-nprUAGAAGGGAGUGAGUUCUCGPNRD
ath-miRf10320-nprCGUCAUCUUCCAAUUCGUCCPNRD
ath-miRf10321-nprAGCUGGCUCUUCCGGGCGAAPNRD
ath-miRf10322-nprUGCUGUCUGGAGAUCGAGCUUPNRD
ath-miRf10323-nprAGUUGGGUCAUCCCAUAACUPNRD
ath-miRf10324-nprCGGAUUGUGGAAUGUUUCAGPNRD
ath-miRf10325-nprAUCCCUCGCAACUUUUGCGAPNRD
ath-miRf10326-nprUCUACUCGAUCUUGGGGUCGAGUGGUPNRD
ath-miRf10328-nprUGUUGGUAGAGUGAUAGGUCPNRD
ath-miRf10329-nprUACUCGACCAGGGGGUCGAGUAGUGPNRD
ath-miRf10331-nprGGUGUCGAUCGACACUGGUUPNRD
ath-miRf10332-nprACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10333-nprACUCGACCUGGAGGUCGAGUPNRD
ath-miRf10334-nprUCUACUCGACCUCAGGGUCGAGUGPNRD
ath-miRf10336-nprUACUCGACCUCAGGGUCGAGUGGUPNRD
ath-miRf10339-nprAAGACACUCGACCUCGGGGUCGAGUGPNRD
ath-miRf10340-nprCUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10341-nprGUACUCGACCAGGUGGUCGAPNRD
ath-miRf10343-nprUACUCGACUUUGGGGUCGAGUPNRD
ath-miRf10345-nprGGCACUCGCCCUCGUGGUCGAGUGAPNRD
ath-miRf10346-nprCUCGGGAUGGUUCCUCGAUGPNRD
ath-miRf10348-nprUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10349-nprGUUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10352-nprUACUCGACCGCGGGGUCGAGUGPNRD
ath-miRf10353-nprACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10354-nprGUGUCGAUCGACACUGGUGUCUPNRD
ath-miRf10355-nprCUGGUGUCGAUCGACACUGGPNRD
ath-miRf10356-nprUACUCGACCAAGGGGUCGAGUGUGPNRD
ath-miRf10357-nprCUUGUCCAAAAGCUGACUAUAPNRD
ath-miRf10358-nprCUUGGGGUCAAGCGGUCCACPNRD
ath-miRf10359-nprUGUGGGAAUUUCUCUCAUUAPNRD
ath-miRf10360-nprCCGAUAGUAACACCGCUGGUPNRD
ath-miRf10362-nprUUGGUCGCUGAAUCCAGCGACAPNRD
ath-miRf10364-nprUGGAUUCCCAAAGCACCGAUPNRD
ath-miRf10365-nprGGGACAGUAGAUGUCACAGGPNRD
ath-miRf10366-nprAAUGCUCCUCCUGUUUCACCUPNRD
ath-miRf10367-nprUUGUCUUGGUCAAUCAUGACUAPNRD
ath-miRf10368-nprACUUGGGUGGUGCUGAUUAUPNRD
ath-miRf10369-nprUCAUGGUCGGAUUCAUCAUCCCPNRD
ath-miRf10370-nprAUGCAAUGCAGCUCCUGAGCUPNRD
ath-miRf10371-nprACACUUGGAGUCCUCCCACAPNRD
ath-miRf10372-nprAGGAGAGUUGCCCUGAAACUPNRD
ath-miRf10373-nprUGACCUGCCAAAGGAGAGUUGPNRD
ath-miRf10374-nprUGAAUCGAUUUGGCCGGGUCPNRD
ath-miRf10375-nprGGCCGUCUUCGUCGACAUCGUPNRD
ath-miRf10376-nprCAUCGUCUUCUUCCUCGAUCPNRD
ath-miRf10377-nprUGGCGACGGUGGUGAGGACGPNRD
ath-miRf10380-nprACCCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10383-nprCGAUCGGUCUGGCCGAUCCGAUCPNRD
ath-miRf10384-nprUCUACUUGACCAGGGGGUUGAGUGPNRD
ath-miRf10385-nprUCUACUCGGCCAAGGGGUCGAGUGGUPNRD
ath-miRf10386-nprUACUCGACCAGGUGGUCGAGUGAUPNRD
ath-miRf10387-nprUCUCGGAGUCUCGUCGGAGAGAPNRD
ath-miRf10388-nprUUCUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10389-nprGGUACUCGACCACGAGGUCGAGUPNRD
ath-miRf10390-nprCUACUCGACCUAAGGGUCGAGUGGUGPNRD
ath-miRf10394-nprAGAAGACUCCGAAGCUGGCAPNRD
ath-miRf10397-nprUCUACUCGACUAGGGGGUCGAGUGGUPNRD
ath-miRf10398-nprCCACUCGACCACGAGGUCGGGUGPNRD
ath-miRf10399-nprCUACUCGACCUCGUGGUCGAGUGPNRD
ath-miRf10401-nprCCACUCGACCACGAGGUCGACUGPNRD
ath-miRf10402-nprACUCGACAAGGGGGUCGAGUGPNRD
ath-miRf10403-nprCCACUCGACCCCGAGGUCGAGUGUPNRD
ath-miRf10404-nprCCAUUUUGUGGGGACUGAGAPNRD
ath-miRf10405-nprGGGGGUGAAUCCAUUCAUUGAPNRD
ath-miRf10406-nprUGGAAGGUGUCGAUCGACACCAUPNRD
ath-miRf10407-nprAUUUGCGAGGGAAUUGCGACPNRD
ath-miRf10408-nprCUCGCAAAAUUUGCGAGGGAAUPNRD
ath-miRf10409-nprGUUGGUGUCGCUCGACACCGPNRD
ath-miRf10410-nprGGUGUCGAUAGACACCAUCUPNRD
ath-miRf10411-nprUGUCGAUCGACACCCUGGUGPNRD
ath-miRf10412-nprCUACUCGACCUCUGGGUCGAGUGPNRD
ath-miRf10413-nprCACUCGGCCUCGGGGUCAAGUPNRD
ath-miRf10414-nprGAGGUGAAGACACUCGGCCUCGPNRD
ath-miRf10416-nprCACUCGGCCUCGGGGUCGAGUPNRD
ath-miRf10417-nprCCUCGUGGUCGAGUGAUGUGPNRD
ath-miRf10418-nprCACUCGGCCUCGUGGUCGAGUPNRD
ath-miRf10419-nprAGGUGAAGACACUCGGCCUCGPNRD
ath-miRf10423-nprUGCGAUGGUGUCGAUCGACACPNRD
ath-miRf10425-nprGAGAAGACUCUGAAGCUGGCAPNRD
ath-miRf10426-nprCUACUCGACCUCUUGGUCGAGUGGUPNRD
ath-miRf10427-nprAAACGACGUCGUUUCGUUCUPNRD
ath-miRf10428-nprAAGACGGCUGGGAAAUGGCAPNRD
ath-miRf10429-nprUUGAAGGACCUGAAGCUAUGCUPNRD
ath-miRf10431-nprUGAUGCUGCAUCGGCAAUCAACPNRD
ath-miRf10432-nprAGGGUUUUGGCUCCGGAGGUPNRD
ath-miRf10433-nprAACGUUGCCGCAGCCGCUGUPNRD
ath-miRf10434-nprGGCCCAUCAGGCCUAGCUGUPNRD
ath-miRf10435-nprCUCUGCCAAAGGAGAUUUGCPNRD
ath-miRf10436-nprACGGCGAAGAAACACGCCAUPNRD
ath-miRf10437-nprGAAUCCGGCGAAUUUUCAGCPNRD
ath-miRf10438-nprUAGGAUCAAGAUGGGGAUGAPNRD
ath-miRf10439-nprUCUCCAACAUGGAGAUUCUCACCPNRD
ath-miRf10440-nprCUUCUCCAACAUGGAGAUUCPNRD
ath-miRf10441-nprAAGCACAUCCUCUUGCUUCCPNRD
ath-miRf10442-nprGAGGCUGAAGCUGACGUGGCPNRD
ath-miRf10443-nprGGCUGCAGAGAGUUUGGAUUCPNRD
ath-miRf10444-nprUAUAGUUGGGUCACAGCCACPNRD
ath-miRf10445-nprUUGAUGAUGCUGCAGCUGCAPNRD
ath-miRf10446-nprAGCUUCCAAAACGACGUCGUPNRD
ath-miRf10447-nprUGCUGGUGGUGCUCCUCCAUPNRD
ath-miRf10448-nprCUCCGGUGAUUUCUUCGCCGPNRD
ath-miRf10449-nprCAUAUUUAGAAGGUGGUGGUGPNRD
ath-miRf10450-nprUGGAAGAGAUACUCUCUAGGPNRD
ath-miRf10451-nprAAGAAGGAGGAACAACCUGUUGPNRD
ath-miRf10452-nprUCGAACCCGAACCUGAACCGAPNRD
ath-miRf10453-nprAACUCGAACCCGAACCUGAAPNRD
ath-miRf10455-nprCCACUCGACCACGAGGUCGAGUGUPNRD
ath-miRf10456-nprUCACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10459-nprACGGAUCCGGAUCCGGAUGCPNRD
ath-miRf10460-nprCUACUCGACCAGUGGGUCGAGUGUPNRD
ath-miRf10462-nprCACUCGACCACGAGAUCGAGUGPNRD
ath-miRf10464-nprUACUCGACCAGGGGGUCGAGUGAUPNRD
ath-miRf10465-nprUCUACUCGACCAGGGGGUUGAGUGPNRD
ath-miRf10467-nprUCACUCGACCCCGAGGUCGAGUGUCUPNRD
ath-miRf10468-nprCACUCGACCCCGAGGUCGAGUPNRD
ath-miRf10469-nprCCACUCGACCUCGAGGUCGAGPNRD
ath-miRf10470-nprCCACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10471-nprUCACUCGACCACGAGGUCGAGUGUPNRD
ath-miRf10473-nprUACUCGACCUCUGGGUUGAGUGPNRD
ath-miRf10474-nprUACUCGACCUGGGGUUCGAGUPNRD
ath-miRf10475-nprUCGUGGUCGAGUGUUGAGGUGAAGUPNRD
ath-miRf10476-nprCACUCGACCUCGGGGUCGAGUGAUGPNRD
ath-miRf10477-nprCACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10479-nprUGUUACUCGACCACGUGGUCGAGUGGUGPNRD
ath-miRf10482-nprUCUACUCGACUAGGUGGUCGAGUGGPNRD
ath-miRf10483-nprGGUCGCCCUUGGUCGAGUAAAPNRD
ath-miRf10484-nprCGACGAUUCCUCGUCCUGGUPNRD
ath-miRf10486-nprGACACCCUGAUGCAUCGAUCPNRD
ath-miRf10487-nprCACUCGACCUCGGGGUCGAGUGAUGUGPNRD
ath-miRf10488-nprAAGACACUCGACCUCGGGGUCGAGUGAPNRD
ath-miRf10489-nprGUUACUCGACUUGGGGGUCGAGUAUGPNRD
ath-miRf10491-nprUCGACCUCGGGGUCGAGUGAUGUGPNRD
ath-miRf10493-nprGCGAUGGUGUCGAUCGACACUGPNRD
ath-miRf10496-nprUCCCAGCAACUCCCUCGCAAPNRD
ath-miRf10497-nprUACUCGACUAAGGGGUCGAGUGGUPNRD
ath-miRf10498-nprGAUACUCGACUUCCAGGUUGAGPNRD
ath-miRf10499-nprUGAUGCUAGCCGUGAAGGAGAAAAPNRD
ath-miRf10500-nprAGGUUAGGGUUGAUGCGCUGPNRD
ath-miRf10501-nprAACAAGGUACUGCUCGUUAGGUUPNRD
ath-miRf10502-nprCCGUGAACGGCGUCAGUGCCAUPNRD
ath-miRf10504-nprGAUUCUUCUGAGCUAGCCUCPNRD
ath-miRf10505-nprACCUACAUACUUGUUCGUCAPNRD
ath-miRf10506-nprUGAACUUGGCUUGUGGGUCUPNRD
ath-miRf10507-nprGCUCCAAUCUCAUGAAGUGCCPNRD
ath-miRf10508-nprACCGUCGAGAAUUUUGGAGAAPNRD
ath-miRf10509-nprUCGCAAAUUUGCGAGGGAUUPNRD
ath-miRf10511-nprCUUUGGGUUUGUCACCAAAGAPNRD
ath-miRf10515-nprGGAGAAGACUCUGAAGCUGGPNRD
ath-miRf10516-nprAUUGCAAACUUUGUGAGGGAPNRD
ath-miRf10517-nprGGGUCGAGUGAUCUGUUGAGAUCPNRD
ath-miRf10518-nprCACUCGACCCCUUGGUCGAGPNRD
ath-miRf10519-nprACUCGACCAGGGGGUCGAGUGGUGPNRD
ath-miRf10520-nprGUUACUCGACCAUGGGGUCGAGUGPNRD
ath-miRf10521-nprCCACUCGACCCCGAGGUCGAGUGCPNRD
ath-miRf10522-nprUUACUCGACCAUGAGGUCGAGUGUPNRD
ath-miRf10524-nprACUCGACCUCUGGGUCGAGUPNRD
ath-miRf10525-nprCUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10528-nprAGGUGAAGACACUCGACCUCGGGGUPNRD
ath-miRf10529-nprCUAUGGUGUCGAUCGACACUAPNRD
ath-miRf10533-nprACUGGUUCAAACCGGUUUACAPNRD
ath-miRf10535-nprAGAGAGGUUAGGGUUGAUGCPNRD
ath-miRf10536-nprUACUCGACUAGGGGGUCGAGUPNRD
ath-miRf10537-nprUACUCGACCCAGUGGUCGAGUGGUPNRD
ath-miRf10541-nprUUCCCUCGCAAAUUUGCGAGPNRD
ath-miRf10542-nprUCUACUCGACGUCGGGGUCGAGUGPNRD
ath-miRf10543-nprUCUACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10544-nprUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10546-nprACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10547-nprUACUCGACCUCUUGGUCGAGUGGPNRD
ath-miRf10548-nprGGCACUCGACCACGUGGUCGAGUGPNRD
ath-miRf10550-nprCUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10552-nprGAUGGGUGUCGAGUGAUUCUPNRD
ath-miRf10553-nprCCGCAUGAACCCGAAGAAUUUPNRD
ath-miRf10554-nprGGUCUAAGUGUACGAAUCAAPNRD
ath-miRf10555-nprGCGCUGACGUGGCUCUCGGAPNRD
ath-miRf10556-nprGGAAGCUCUCUCUACAUAUAUAPNRD
ath-miRf10557-nprUUGCCGCUUGUAAUUUACCAUCPNRD
ath-miRf10558-nprCCGGAGAUGGAUAACAACGAPNRD
ath-miRf10559-nprUUCACUGCAGAAGCUGGCGUPNRD
ath-miRf10560-nprUGCACUUCACUGCAGAAGCUGPNRD
ath-miRf10561-nprUUCGUCGCCGUUGUUCGAUCPNRD
ath-miRf10562-nprCCUUUGGCACCUUUGUUGGCPNRD
ath-miRf10564-nprGAGAAUCUUGAUGAUGCUGCPNRD
ath-miRf10565-nprGAUGCAUCUUCACCAGGUGGAPNRD
ath-miRf10567-nprGCGUGCUCACUCUCUUUUUGPNRD
ath-miRf10568-nprUUGAAAAUGUUGUUGCUGCUGCUGPNRD
ath-miRf10569-nprUUGUUCCCCUCCUAAAGGAUPNRD
ath-miRf10570-nprUUGCUCAUAAGGAUGUUACUPNRD
ath-miRf10571-nprUGGAGAUGACGCCGGAGAGAPNRD
ath-miRf10572-nprUCCAUGAAAUGCCAUGAGAGPNRD
ath-miRf10574-nprCGGCAAGUCAUCCUUGGCUGCPNRD
ath-miRf10575-nprAUCACUCCAAGUCUCUAAUUPNRD
ath-miRf10576-nprAGCGUUGCUUCGUCAUCUUCUPNRD
ath-miRf10577-nprGACGAUCGGUCUGGCCGAUCCGPNRD
ath-miRf10578-nprCAACUGCAACUGCUUGUAUAPNRD
ath-miRf10579-nprGACGGUGUCGAUCGACACUGPNRD
ath-miRf10580-nprCCUCGCAAACGUCUCGCAAAUUUGPNRD
ath-miRf10582-nprCCUCGCAAACUUUGCGAGGGAPNRD
ath-miRf10584-nprGGUUGCUCGAGUGGCUGCUCAPNRD
ath-miRf10585-nprCUACUCGACCUUUGGGUCGAGUGGUPNRD
ath-miRf10588-nprUCUGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10590-nprUCUACUCGACCUUGUGGUCGAGUGGUPNRD
ath-miRf10591-nprACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10592-nprGUUGGUGUCGCUCGACACCGAGPNRD
ath-miRf10593-nprUCAAAGCUUUGAUGGUGUAGCUAAAPNRD
ath-miRf10598-nprCACUCGACCUGGGGGUCGAGUAPNRD
ath-miRf10600-nprUCACUCGACCUAGGGGUCGAGUAPNRD
ath-miRf10601-nprACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10602-nprACUCGACCCGGGGGUCGAGUPNRD
ath-miRf10604-nprCUGGUGUCGAUCGACACCCAGPNRD
ath-miRf10605-nprCUCGACCUCUUGGUCGAGUGGUPNRD
ath-miRf10606-nprUGCUCGACCUGGGGGUCGAGUGGUCUPNRD
ath-miRf10607-nprAUGCUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10608-nprCUCGACCUCUUGGUCGAGUGPNRD
ath-miRf10609-nprCACUCGACCAUGAGGUCGAGUGPNRD
ath-miRf10613-nprCCACUCGACCACGAGGUCGAGUGPNRD
ath-miRf10614-nprCACUCGACCAGGGGGUCGAGUPNRD
ath-miRf10618-nprGGUCGAGUGAUGUGAUCGAGUPNRD
ath-miRf10619-nprCACUCGACCUGGGGGUCGAGUGAUGUPNRD
ath-miRf10621-nprUCACUCGACCUGGGAGUCGAGUGAPNRD
ath-miRf10622-nprAUCCCGAGCUGGCGGACAUUPNRD
ath-miRf10625-nprGAAGACUCUGAAGCUCGACAPNRD
ath-miRf10626-nprUCGACCUGGGGGUCGAGUGAPNRD
ath-miRf10627-nprAUUGUUGUCCGAGUCGUCAUPNRD
ath-miRf10629-nprACCGGUAUCUGGUCCGGUUUCPNRD
ath-miRf10630-nprCCGGAUACGGAUCCGGAUCCPNRD
ath-miRf10631-nprAAGGAAAGUAUCCUUCUUAAPNRD
ath-miRf10632-nprUCGAUCUCAUCGAUCUCCCAPNRD
ath-miRf10633-nprUGGCGGUGGAUACUUCUUGAUCGGPNRD
ath-miRf10634-nprAUGGUGCUGCAUCUGCGACUPNRD
ath-miRf10637-nprAAAUUGAGACGAGCGUUGUCUCCPNRD
ath-miRf10638-nprCUUCUCCAAGUCAUUCUCUGPNRD
ath-miRf10639-nprUUGGGGCUUUGAGAAUUUCUGGCPNRD
ath-miRf10640-nprUUGCCCUCUUCUGCAGCAGAPNRD
ath-miRf10641-nprGUUUGCCUAUCGCUGAUUCAGCGACPNRD
ath-miRf10642-nprUUGUACAUCACUUUUAGUGUPNRD
ath-miRf10643-nprAAUGAGCUCUCGAAAAGAAGAPNRD
ath-miRf10644-nprUGUUGCCGUAGCUGCAGCGGCPNRD
ath-miRf10645-nprCGUAGCUGCAGCGGCUGUUGPNRD
ath-miRf10646-nprGAGAAGUGGAUUGGAGCAAUUCPNRD
ath-miRf10647-nprCAGCUUCUUGAUACGUCCCAPNRD
ath-miRf10648-nprAUUAGAGUUUUCUGGAUACUPNRD
ath-miRf10649-nprCACCAUCUUCGUUGCUCUCUPNRD
ath-miRf10650-nprGCAGUCAAUGCAACUUAAUPNRD
ath-miRf10651-nprGCUACCGGAGCAUUCCAUGCPNRD
ath-miRf10652-nprGCUGCGAUAGAGUGGUUUUGPNRD
ath-miRf10653-nprUCGCAAAAGUUGCGAGGGAUPNRD
ath-miRf10654-nprACUCGACCCCCUUGUCGAGUAPNRD
ath-miRf10655-nprUUACUCGACCUGGGGGUCGAGUGGPNRD
ath-miRf10656-nprUACUUGACCAGGGGGUCGAGUAPNRD
ath-miRf10657-nprGUUACUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10658-nprCUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10659-nprUGGUGAUGUCUUCUACUCGACCUGGPNRD
ath-miRf10661-nprUACUCGACCCCCAGGUCGAGUGPNRD
ath-miRf10663-nprUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10664-nprUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10666-nprGCUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10668-nprCUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10669-nprUCUACUCGACCUGGGGGUCGAGUGPNRD
ath-miRf10670-nprGUCCUGAGUACUCUCUUCCAPNRD
ath-miRf10671-nprACUCGACCUCGUGGUCGAGUGGUGPNRD
ath-miRf10674-nprACUACUCGACCCCCUGGUCGAGUAPNRD
ath-miRf10675-nprCACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10676-nprCUCGACAUGGGGGUCGAGUGGPNRD
ath-miRf10677-nprCACUCGACCAGGUGGUCGAGUGAPNRD
ath-miRf10680-nprCCUCGCAAAAUUUGCGAUGGAPNRD
ath-miRf10681-nprAAUCCCCCGCAAAUUGCGAGGPNRD
ath-miRf10682-nprAUUUCUGAAACAAAGCAAAAGCPNRD
ath-miRf10683-nprUUCCACCCUGAGGAGAUUAUGPNRD
ath-miRf10684-nprCGUAAACCUGUAAUUUUCCCGCCAPNRD
ath-miRf10685-nprACCUGUAAUUUUCCCGCCAAAAACPNRD
ath-miRf10686-nprGUAAUUUUCCCGCCAAAAACUPNRD
ath-miRf10687-nprUUAGCUGAAGAAGCAGAGGAGPNRD
ath-miRf10688-nprUGUUCGUUUGCAUGUCGCUGGAUPNRD
ath-miRf10689-nprUGUCGCUGGAUUCAGCGACCPNRD
ath-miRf10690-nprUUCAGCGACCAAAAGCAGCGAPNRD
ath-miRf10691-nprUCGAUCAAUGCAUUGAAAGUGACPNRD
ath-miRf10692-nprACUUUUCACUGUUUGAUUCGUPNRD
ath-miRf10694-nprACGCUCCUCUGGUUUGAGAUCPNRD
ath-miRf10695-nprCAAGCACAACAUAUCCUCUUPNRD
ath-miRf10696-nprCUUUGAAAGUAGAUACACUAUCAUCPNRD
ath-miRf10697-nprUUAGUCAUGAUUGACCAAGAPNRD
ath-miRf10698-nprAUAGAGCGAGAAAGGCAUCAUPNRD
ath-miRf10699-nprAAAUCUCUCUGUUGUGAAGUCAAACPNRD
ath-miRf10700-nprCUCUCUUUCUCCAUGGCUGACPNRD
ath-miRf10701-nprUGCAGUUCCUGGAGGUGGAGGAPNRD
ath-miRf10702-nprGUGGGAGGACUCCAAGUGUGPNRD
ath-miRf10703-nprGAGGACUCCAAGUGUGGUUAPNRD
ath-miRf10704-nprGCAGAAGUAGCGAGGUUGAGUPNRD
ath-miRf10705-nprGCGAUGGUCAUGACGGUUGAUGUUPNRD
ath-miRf10706-nprUCUUCUUCGUCGCCAUUACUPNRD
ath-miRf10707-nprUCUCUUGCAACCCAUCGAGAPNRD
ath-miRf10708-nprUCUCUGGCUUGGGACUUUUGPNRD
ath-miRf10709-nprACAUUCUUCACAGGGAUUGAPNRD
ath-miRf10710-nprCCGGUGGGAUUUCUCCGGCGAUPNRD
ath-miRf10711-nprGAACCCAAGACCUCACCCUUPNRD
ath-miRf10712-nprGUUUCUCCCACACGGCGGCGPNRD
ath-miRf10713-nprUCCUGAGUACUCUCUUCCAPNRD
ath-miRf10714-nprUGAUACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf10715-nprCUGGGUUGUGAUGUUCUGCAPNRD
ath-miRf10716-nprCUCGACCAGGGGGUCGAGUGGUCUPNRD
ath-miRf10717-nprUCUCCGACGAGACUCCGAGAAAPNRD
ath-miRf10718-nprUACUCGACCCAGGUGGUCGAGUPNRD
ath-miRf10720-nprCCCGCGGUAUACCACGGGUUAAPNRD
ath-miRf10721-nprGAAAGUCAAGGCUGAUUGGUGCPNRD
ath-miRf10722-nprAGGCUGAUUGGUGCAGUCUGPNRD
ath-miRf10723-nprACUUGACCCCGUGGUCGAGUAPNRD
ath-miRf10724-nprAUACUCGACCCACUGGUCGAGUAPNRD
ath-miRf10725-nprACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf10726-nprGAUGGUGUCGAACGACACCAACPNRD
ath-miRf10727-nprUGUGGAGGAUACACCUUAUCCUPNRD
ath-miRf10729-nprUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10730-nprACUCGACCAGGGGGUCGAGUGAPNRD
ath-miRf10731-nprUCUACUCGACCAAGAGGUCGAGUGGUPNRD
ath-miRf10732-nprUGGUGAUGUCUUCUACUCGACCUPNRD
ath-miRf10733-nprUACUCGACCAUGGGGUCGAGUAUPNRD
ath-miRf10734-nprUCUAUCUCAGUCCCCACAAAPNRD
ath-miRf10735-nprUACUCGACCACGUGGUUGAGUPNRD
ath-miRf10736-nprAGAUGGUGUCGAUCGACACCUUCPNRD
ath-miRf10737-nprUGGUGAUGUCCUCUAGUCGACCPNRD
ath-miRf10738-nprACUCGACCCAGUGGUCGAGUPNRD
ath-miRf10739-nprGAUACUCGACCUGUUGGUAGAGUGAPNRD
ath-miRf10740-nprAAAGUCGCAAUUCCCUUGCAACAPNRD
ath-miRf10741-nprUCGUUCGAGAGGUCGCUUUGGGPNRD
ath-miRf10742-nprGGUGCGGAUGGUUCUAUCAUAPNRD
ath-miRf10743-nprAGCUGAUUCGAUGAACUUGUPNRD
ath-miRf10744-nprGACAAGGAAGCAUAGCUUCAPNRD
ath-miRf10745-nprGCUUCAGGUCCUUCAAUGGAGGPNRD
ath-miRf10746-nprGCGGCUGUUGCAGCUGCUGCPNRD
ath-miRf10747-nprCAAGCACCAGCUCGAAGAAGCUUAGPNRD
ath-miRf10748-nprAUCAUGAAGGAGAGAUCUUUPNRD
ath-miRf10750-nprUAAGUAUGGCAGGAUUAAGAPNRD
ath-miRf10751-nprCUUGUGGAGAGGAAGCAAGAPNRD
ath-miRf10753-nprCUCUAGCUCUUUAGUCCUGUPNRD
ath-miRf10754-nprUCCUCCACCACCGAGAGCAUPNRD
ath-miRf10755-nprUGCAGCUGCAGCAUCAUCAAPNRD
ath-miRf10756-nprUGGGUUCUUAUUCUGCUGCAPNRD
ath-miRf10757-nprUCCGCCGAGUCUUCUUUUUGPNRD
ath-miRf10758-nprUAGCUUGAGAGUCAAGUUAAUPNRD
ath-miRf10759-nprUUUCUUGGCCCAUCCACUUCUAPNRD
ath-miRf10761-nprAGUCCUAGAGAGUAUCUCUUCCACCAPNRD
ath-miRf10762-nprAGCUUCUGGUCAGAGGCUUGPNRD
ath-miRf10763-nprGGUGGUGAAGAAGCAUGGUUPNRD
ath-miRf10764-nprGAGAAGAUGAAGCUGUUCUGPNRD
ath-miRf10765-nprGAGCUUGGAACCAAUUGUGUUCPNRD
ath-miRf10766-nprGUUCAGGUUCGGGUUCGAGUPNRD
ath-miRf10767-nprCACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10768-nprUCUACUCGGCCUAGGGGUCGAGUGPNRD
ath-miRf10769-nprGGCACUCGACCUCGGGGUCGAGUGGUGGPNRD
ath-miRf10770-nprCUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10774-nprAUAUCUUGAUCUUUCCACCAPNRD
ath-miRf10775-nprUUGAUCUUUCCACCAUCUACPNRD
ath-miRf10776-nprAUGCCUCGCAAUAUUUGCGACGGAPNRD
ath-miRf10778-nprCUACUCAGCCAGGGGGUCGAGUGGUPNRD
ath-miRf10780-nprUGAGGCAUCUCAUUCCUUCUPNRD
ath-miRf10781-nprAUACUCGACCCCCAGGUCGAGUGACPNRD
ath-miRf10783-nprUCACUCGACCCCCUGGUCGAGUAGAPNRD
ath-miRf10785-nprAAGUGGUGAAGUCUUCUACUCGACCPNRD
ath-miRf10787-nprUACUCGACCAGGAGGUCGAGUGPNRD
ath-miRf10788-nprACUCGACCUCAUCAUUCUACCUAGAPNRD
ath-miRf10789-nprGUCCAAGCAGACAAAACUGUPNRD
ath-miRf10790-nprUCGACCUCGAGGUCGAGUGAPNRD
ath-miRf10792-nprGAGGAAAGUCUUUUUCUCCUUCAPNRD
ath-miRf10793-nprAAAGUCUUUUUCUCCUUCACPNRD
ath-miRf10794-nprGUGAGUUUAGGGUUCUUGAAPNRD
ath-miRf10795-nprCUCUGUGGGAGAAGUUCCUUPNRD
ath-miRf10796-nprACGACGGCGUUUAGAUGAAGPNRD
ath-miRf10797-nprCUUUUAGGUCGAGCUUCAUUGPNRD
ath-miRf10798-nprUUCCGCAACUUUUGGCGUUGPNRD
ath-miRf10799-nprGGCAUACUUGUUGUGAUGCUUGUGPNRD
ath-miRf10800-nprCAUUAUCACAGUACUAUGAUPNRD
ath-miRf10803-nprUGGUUGAGUGCGGAAUGGAGAAGACPNRD
ath-miRf10807-nprUGUCUUCAUCGUCAUCACAAPNRD
ath-miRf10808-nprUCUCUCGCAAUAUUUGCGAGGPNRD
ath-miRf10814-nprCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf10816-nprUACUCGACCACAUGGUCGAGUPNRD
ath-miRf10817-nprUACUCGACCCCCUGGUCGGGUAPNRD
ath-miRf10820-nprUCUAGUGUCGAUCGACACCAUPNRD
ath-miRf10821-nprGGUACUCGACCACGGGGUCGAGUGPNRD
ath-miRf10822-nprCUACUCGACCAAGGGGUCGAGUGGUGPNRD
ath-miRf10823-nprUCGACCUCAAGGUCGAGUGAPNRD
ath-miRf10824-nprCUCUACUCGACCUGGUUGUCGAGUGPNRD
ath-miRf10825-nprUCGACCUGGUUGUCGAGUGGUPNRD
ath-miRf10829-nprCUCGACCAUGGGGUCGAGUGPNRD
ath-miRf10832-nprUACUCGACCAGGGGGUUGAGUAAPNRD
ath-miRf10833-nprUCCAGUGUCGAUCGACACUAGPNRD
ath-miRf10834-nprGGUGUUGGUGUCGAUCGACACCPNRD
ath-miRf10835-nprAAGACACUCGACCUCGGGGUCGAGUPNRD
ath-miRf10836-nprGUGAUGUCCUCUACUCGACCPNRD
ath-miRf10837-nprCAUCAACCCUAACCUCUCUCAUGPNRD
ath-miRf10838-nprACUUGACCCCCUGGUCGAGUAPNRD
ath-miRf10839-nprAGUCGUCCAAGUACGACUAUPNRD
ath-miRf10840-nprGUGAUGUCCUCUACUCGACCAGGPNRD
ath-miRf10841-nprUAUUCGACCCCCAGGUCGAGPNRD
ath-miRf10843-nprUAGCCGCUUCACCGCAACUUPNRD
ath-miRf10844-nprAUAGCCGCCGUUGAGAUCUCUPNRD
ath-miRf10845-nprUCAUGUUAUGUGAUUCUUCUPNRD
ath-miRf10846-nprUGAAUACGACCCACUAGAAAUUGAAPNRD
ath-miRf10847-nprUCAGCUGUGUCUUCGUUGUCAUCPNRD
ath-miRf10848-nprAGCUAAGGCGCUUAUCUUCUPNRD
ath-miRf10849-nprUGCAGAGGACAGACCAAAGAPNRD
ath-miRf10850-nprGUCUCUAGAGGAGCCAGAGCCAPNRD
ath-miRf10851-nprGGUCUAAACGCAAACGCUGUPNRD
ath-miRf10852-nprUGGUGGUGAAUCAGCCAGUCCUPNRD
ath-miRf10853-nprUCCUCCAUGCAUAGGGGGAGGPNRD
ath-miRf10855-nprAGAGUGUCGGCGAUGGCGAGGAUPNRD
ath-miRf10856-nprUGAGGCAUGUGUCUGGGGUCPNRD
ath-miRf10857-nprUAAUCCUCCUAAAUGUGCCGPNRD
ath-miRf10860-nprUCCUUAUGAGCAAUCUCCAAUPNRD
ath-miRf10861-nprAAGGAUGACUUGCCGGAACGPNRD
ath-miRf10862-nprGAGGAGACUGCGUUAUGCAUUUGPNRD
ath-miRf10863-nprUACAAGCAGUUGCAGUUGCAPNRD
ath-miRf10864-nprCUCGCAAAUCCCUCGCAGAAPNRD
ath-miRf10865-nprCGCCUCGCAAAUCCCUCGCAGAAPNRD
ath-miRf10867-nprCACUCGACCACCAGGUCGAGUPNRD
ath-miRf10868-nprACUCGACCACGAGGUCGAGUAGPNRD
ath-miRf10870-nprCUACUCGACCAGGUGGUCGAGUGGUPNRD
ath-miRf10871-nprUGGUGAUGUCCUUUGCUCGACCPNRD
ath-miRf10872-nprUUGCUCGACCCGGGGGUCGAGUPNRD
ath-miRf10874-nprACUCGACCCCCAGGUCGAGCAPNRD
ath-miRf10875-nprGGCUUUUAAGAUCUGGUUGCGGUUPNRD
ath-miRf10880-nprGCUCGACCUGGGGGUCGAGUGGUPNRD
ath-miRf10884-nprCCUGGGGGUCGAGUGAUGUGPNRD
ath-miRf10887-nprUGGUGAUGUCCUCUGCUCGACCPNRD
ath-miRf10888-nprGCUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf10890-nprCUACUCGACCUGAGGGUCGAGUGPNRD
ath-miRf10891-nprCUCGACCUGAGGGUCGAGUGGUPNRD
ath-miRf10892-nprUCUACUCGACCUGAGGGUCGAGUGPNRD
ath-miRf10894-nprAUACUCGACCACGAGGUCGAGUGPNRD
ath-miRf10895-nprUACUCGACCCCCUGGUCGAGUGAPNRD
ath-miRf10896-nprGGAGGAGGAGUACGAUACGAPNRD
ath-miRf10897-nprACUCGACCUGGGGGUCGAGUGAUPNRD
ath-miRf10899-nprAGGGGGUCGAGUAAUGUCAUPNRD
ath-miRf10903-nprUACUCGACCUGGUGGUCGAGUGGPNRD
ath-miRf10904-nprGACGAAGAAGAUGGUGAUGUGAUPNRD
ath-miRf10906-nprUGGUCCUUCUUCCAUAUCCUPNRD
ath-miRf10908-nprAUGUGGAUUCCAACAGGAAGPNRD
ath-miRf10909-nprAAGGGACGAGAAAGUGUUGGUPNRD
ath-miRf10910-nprUCCUUGAAAGGUUCAUUAUCPNRD
ath-miRf10911-nprCAAACGCAGCGUUUGCGGUUPNRD
ath-miRf10912-nprAAGCCGAGACCAAAGCUGGUPNRD
ath-miRf10913-nprAUGAUGCGCAAAUGCGGAUAPNRD
ath-miRf10914-nprUGGGGCUUUGAGAUUUUCUGGPNRD
ath-miRf10915-nprACCCAAUCUCUACUUCAGUCUPNRD
ath-miRf10916-nprGCAAGAUGAUCACUGUGGUCPNRD
ath-miRf10917-nprUGUACAUCACUUUUAGUGUAPNRD
ath-miRf10918-nprUCUUAAUAGCGCUCCUAACAPNRD
ath-miRf10919-nprGAGAGCAAGAGCAGCAGCUUUPNRD
ath-miRf10920-nprAACCGGAUUCUGGUUUGGUUAPNRD
ath-miRf10921-nprGUGACGGUGGGACGAAUGUUPNRD
ath-miRf10922-nprGGUGGUGCGACAGGCUUUGGUPNRD
ath-miRf10923-nprUCAGCGGUUGGAGUUGCUCCPNRD
ath-miRf10924-nprUGAGGCGUAUCAGGAGGUAGUPNRD
ath-miRf10925-nprGGAAAACAGAGCAUGAUGAUGAPNRD
ath-miRf10926-nprGAGGCUUCAGGGCAUUACCAGPNRD
ath-miRf10927-nprGGACCGGAGACCAUAUAAACAPNRD
ath-miRf10928-nprGUUGAGCUCGGCUUAACUGCPNRD
ath-miRf10929-nprAUGUCCCAUGGUGAAACUUUGUCPNRD
ath-miRf10931-nprGGCGGCGGCAAACUCUACUGPNRD
ath-miRf10932-nprGUGUCGAUCGACACUGGGPNRD
ath-miRf10933-nprAGAGUUUCCUCAAAAAUAGAGGAPNRD
ath-miRf10934-nprCCGGGUCCGAGUUCGGGUUCGGPNRD
ath-miRf10935-nprACGUCGCAUAUUUGCGAGGGPNRD
ath-miRf10937-nprUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf10940-nprUACUCGACAAGGGGGUCGAGUGGPNRD
ath-miRf10941-nprACCACUCGACCACCUGGUCGAGUAPNRD
ath-miRf10947-nprUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10948-nprCUUCUACUCGACCUGGUGGUCGAPNRD
ath-miRf10949-nprUACUCGACCUGGUGGUCGAAUGGUPNRD
ath-miRf10951-nprAAGUGGUGAUGUCUUCUACUCGACCPNRD
ath-miRf10952-nprUACUCGACUUGGUGGUCGAGUGGUCPNRD
ath-miRf10953-nprUACUCGACUUGGUGGUCGAGUPNRD
ath-miRf10954-nprAAGUGGUGAUGUCUUCUACUCGACPNRD
ath-miRf10956-nprCACUCGACCUCGGGGUCGAGUGGUGPNRD
ath-miRf10957-nprCUCGCCCUCGUGGUCGAGUGAPNRD
ath-miRf10958-nprCACUCGACCUGGUUGUCGAGUGGUPNRD
ath-miRf10959-nprUACUCGACCUGGGGGUCGAGUAUGUPNRD
ath-miRf10960-nprGGUUACUCGACCUGGGGGUCGAGUPNRD
ath-miRf10965-nprUCGACCCGGUGGUCGAGUGGPNRD
ath-miRf10966-nprCACUCGACCUCGGGGUUGAGUGAUPNRD
ath-miRf10967-nprCACUCGACCUCGGGGUUGAGPNRD
ath-miRf10968-nprUUGGUGUCGAUCGACACACAPNRD
ath-miRf10971-nprUCCUGAGUACUCUCUUCCAAPNRD
ath-miRf10973-nprUGUUGUGUCGGUCGACACCAPNRD
ath-miRf10974-nprAUUUUCCCGCCAAAAGCGUAAACPNRD
ath-miRf10975-nprACCCGGAAUUUUCCCGCCAAAAPNRD
ath-miRf10976-nprAAAACCCGGAAUUUUCCCGCPNRD
ath-miRf10977-nprGUUGAGAUGACAAGGCCAAGPNRD
ath-miRf10978-nprGAUUAAUGCAGUGAAAGUGACPNRD
ath-miRf10981-nprUAUCAGGAGGUUCAGUCAUGPNRD
ath-miRf10982-nprGCUGGAGGAACUGCAGCUAUGUAPNRD
ath-miRf10983-nprUUGUGACAAGAGCAAGUCCAAPNRD
ath-miRf10984-nprUUCUUUGCUUCCCCAAUGCUPNRD
ath-miRf10985-nprCUUCUUGGUGCAGCCAUGUUUGGCPNRD
ath-miRf10986-nprCGGAUCUGACCAUGAUGGUGUUUPNRD
ath-miRf10988-nprGGCGCCUCUCCAUUGGCAGGPNRD
ath-miRf10989-nprUGGUGAGACUCCAUGUUCUUPNRD
ath-miRf10990-nprACAAACGAAGCAGCUUGUUUGUPNRD
ath-miRf10991-nprUUCUUAAUAGCGCUCCUAACPNRD
ath-miRf10993-nprAAGAGAGAGGGUUUAAGGCUUPNRD
ath-miRf10994-nprUCCUGCACCGCUCGAUCCGCPNRD
ath-miRf10995-nprGGUGAUGCCAUCUACUCGACPNRD
ath-miRf10997-nprUUCUCCGACCUCCUCCGAGAPNRD
ath-miRf10998-nprACUCGACCCCCUGGUCGAGUPNRD
ath-miRf10999-nprCUCGACCCAGGUGGUCGAGUPNRD
ath-miRf11000-nprUACUCGACCUCGUGGUCGAGUGGUPNRD
ath-miRf11001-nprGGUCGAGUGAAUGAUGAUGGUGPNRD
ath-miRf11002-nprUACUCGACUUGGUGGUAGAGUGPNRD
ath-miRf11004-nprCUACUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf11005-nprUACUCGAUCAUGGGGUCGAGUGGUGPNRD
ath-miRf11006-nprUACUCGAUCAUGGGGUCGAGUPNRD
ath-miRf11009-nprGUGUUGGUGUCGAUCGACACCUPNRD
ath-miRf11010-nprCUCUGUAUUCUUCCACAGCUPNRD
ath-miRf11011-nprUACUCGAUCACUUGGUCGAGUPNRD
ath-miRf11012-nprGUACUCGACCUCGUGGUCGAGUPNRD
ath-miRf11016-nprGGUAUCGAUCGACACCUUCGPNRD
ath-miRf11017-nprUUUCUUCGCAAGUCCCUCGCPNRD
ath-miRf11021-nprGAGGUUUGCGAUGAGAAAGAGPNRD
ath-miRf11022-nprAUUGUUGUCUUCACUACCGAPNRD
ath-miRf11023-nprCCUUUAAGCUCCUCGAUAUCAUCAUPNRD
ath-miRf11024-nprUUAUGGUCAGUUUUUGGACAPNRD
ath-miRf11025-nprAUUGCAAUGGCAACACUAAAPNRD
ath-miRf11026-nprCUUGUAAAGAGAUUUGUAGUCPNRD
ath-miRf11027-nprUUCAUUGCCAUGUUCUAGUUPNRD
ath-miRf11028-nprAACAACUGAUAGAGCUGCAAUPNRD
ath-miRf11029-nprAGCUCCAUAUCCUUCAAUGGPNRD
ath-miRf11030-nprAUUGUGGUUUCUUCUCUGGAPNRD
ath-miRf11031-nprAACUUCAGCAAGUGACUUUGPNRD
ath-miRf11032-nprUCGCGAGCAACUUCAGCAAGUPNRD
ath-miRf11033-nprGCUGUGGCAUCAUCAAGAUUCAPNRD
ath-miRf11034-nprGAGAGGAGAGAUAGCGUCGGGUAAUPNRD
ath-miRf11035-nprACACUCUCUUGGUCCCGAAAPNRD
ath-miRf11036-nprGAGGAGGAGGAGCACCACCGUPNRD
ath-miRf11037-nprUCAUCGGAGAAACAGAGGAGCPNRD
ath-miRf11038-nprUGGGCCUUAAAGCCCAGUUUPNRD
ath-miRf11039-nprACUGAGCUAUAGGCUCUUCUPNRD
ath-miRf11041-nprACGACGGUAGUCACGUGAGACPNRD
ath-miRf11042-nprGGAAGAGGCAGUGCAUGGGUAPNRD
ath-miRf11043-nprUUCUGGAGCUUACCUUCGAGPNRD
ath-miRf11044-nprAGAAGAAGAGGCGUCCUCCUPNRD
ath-miRf11045-nprUUUCUUGUGGAGGAAGCAAGAUPNRD
ath-miRf11046-nprCGGACCCGAAACCUGACCCGPNRD
ath-miRf11047-nprCAUGAUCUUGUCUUCCUCUCPNRD
ath-miRf11048-nprGAUGAAGAAGCUGAAGUACAGGPNRD
ath-miRf11049-nprCCAUGCAUUUGGGAUCCGAPNRD
ath-miRf11050-nprGGAUUUGCUUACUUUGGCCUUPNRD
ath-miRf11051-nprCGCUGUUGGAGCAUCAUCAAPNRD
ath-miRf11052-nprACUCAGAUAGAGAACGAAAGPNRD
ath-miRf11053-nprUACCAUCUCUUGAGGAACUUGGPNRD
ath-miRf11055-nprCAGCUCCCAUGGAAGCAGAAPNRD
ath-miRf11056-nprGAGAGGAGAGAGUCUUUGUUPNRD
ath-miRf11058-nprCCAUUGUUGCCUGAGAAGAAAPNRD
ath-miRf11059-nprCACUCGACCCACAGGUCGAGPNRD
ath-miRf11062-nprACUCGACCAGGUGGUCGAGUGPNRD
ath-miRf11065-nprAAGUGGUGAUGUCUUCUACUCGACCUPNRD
ath-miRf11066-nprUCCUCGCAAAAUUUGCGAGGGAPNRD
ath-miRf11068-nprGCCUGAGCUGAGGAUACUCGACCPNRD
ath-miRf11069-nprCACUCGACCCCCUGGUCGAGUAGAPNRD
ath-miRf11070-nprUGGCAUGUGAUACCUUUUUGPNRD
ath-miRf11072-nprUCUACUCGACCUGGGGUUCGAGUGGUPNRD
ath-miRf11073-nprAUACUCGACCACCAGGUCGUGUGPNRD
ath-miRf11078-nprUACUCGACCAUGGGGUCGAGUAAUGPNRD
ath-miRf11080-nprACUCGACCCCGAGGUCGAGUPNRD
ath-miRf11081-nprUUGGUGUCGAUCGACACCUCPNRD
ath-miRf11085-nprAAAGUCCUUUUCUCCUUCACGGPNRD
ath-miRf11086-nprAGUGUUUGAACCUAACGAGCPNRD
ath-miRf11087-nprUUGUGAAGAAAGGGUUCUUAPNRD
ath-miRf11088-nprGAAUAAAGCCAUGGAUGGAUCUPNRD
ath-miRf11092-nprUCAUGGUCGUGAUCGUGGUCAUCPNRD
ath-miRf11095-nprGAGGAAAGUGUCCCUCGCAAAPNRD
ath-miRf11096-nprAACAGAGACCAUCUCUUCCCPNRD
ath-miRf11098-nprACUCGGCCAGGUGGUCGAGUGGUPNRD
ath-miRf11100-nprACUCGACCUGGUGGUCGAGUGPNRD
ath-miRf11101-nprUCCUCUGUAUCUUCGUUGUCAPNRD
ath-miRf11103-nprUUGAGUUGUAUGUGAAUACGPNRD
ath-miRf11104-nprAAGUCACUCGACCUCGGGGUCAAGUGAPNRD
ath-miRf11105-nprUGAAGUCACUCGACCUCGGGGUCPNRD
ath-miRf11107-nprACUCGACCAUGGGGUCGAGUGPNRD
ath-miRf11109-nprACUCGACCCCUUGGUCGAGUPNRD
ath-miRf11110-nprUACUCGACUAGGGGGUCGAGUAAUPNRD
ath-miRf11112-nprUCUAGUGUCGAUCGACACUAGPNRD
ath-miRf11113-nprGGCCCAUUCGAAGCCCAUUAPNRD
ath-miRf11115-nprUGCUCUCUGGCGUAUUCUUCPNRD
ath-miRf11117-nprGCUUGUGGCUGCAACGUAUCGPNRD
ath-miRf11118-nprACUCGACCACCUGGUCGUGUGPNRD
ath-miRf11121-nprCUCUCUUCCAAGUUUAUGCGPNRD
ath-miRf11123-nprAAUCGACCAGGGGGUCGAGUGGUPNRD
ath-miRf11124-nprAAGUCACUCGGCCUGGGGGUCGAGUGAUPNRD
ath-miRf11125-nprUAUUCCUCGCAAAUUUUGCGACGPNRD
ath-miRf11127-nprCCUACUCGACCAGGGGGUCGAGUGPNRD
ath-miRf11131-nprUGGGUGUCGAUCGACACCAUPNRD
ath-miRf11133-nprUGGAUCAUCGUUGUAAGCAUPNRD
ath-miRf11134-nprCACAUCAGACGGUUGAGUUGCUPNRD
ath-miRf11136-nprUCGAGCACAUGACAUCCAGAPNRD
ath-miRf11137-nprUCCGUGUGUUCCUCUUGGUACPNRD
ath-miRf11138-nprUCAUCGCGGUGGAGGAGGAGGAPNRD
ath-miRf11139-nprAGAGAAUGAGGUUGAGCCAAPNRD
ath-miRf11140-nprAUGAGAGAAGCUUCAUCUACAPNRD
ath-miRf11141-nprCAUCCAGAUGAUCCAUCCAAPNRD
ath-miRf11142-nprGUAUAGCAUCAUGAGCAAUCAPNRD
ath-miRf11143-nprUGACAGAAAGAGAGGUGAGCAPNRD
ath-miRf11145-nprUCUGCAUGCUCCUUGUUGAUGPNRD
ath-miRf11146-nprCUUCUGAGGAUUCACCCGUUGAPNRD
ath-miRf11147-nprGUUCGAUCUCCGCCGCUACUPNRD
ath-miRf11148-nprAGAGUAAGCACACAUAGCUUCPNRD
ath-miRf11150-nprAGUAACGUCCUUAUGAGCAAUCUCPNRD
ath-miRf11151-nprAGCUCCGGCAAUGAUUGAGGPNRD
ath-miRf11152-nprACCCUCACAAAUUCCUCGCAPNRD
ath-miRf11153-nprUCGCAAACUUUGCGAGGGAUPNRD
ath-miRf11156-nprGGCACUCGACCUCGGGGUCGAGUGGUPNRD
ath-miRf11157-nprUGUUGGUGUCGGUCGACACUGPNRD
ath-miRf11158-nprGAUCGACACCCUGUUGGUGUCGGUCPNRD
ath-miRf11164-nprUCACUCGACCUCGAGGUCGAGUGUPNRD
ath-miRf11165-nprCGACCUGGUGGUCGAGUGGUPNRD
ath-miRf11166-nprGGUUACUCGACCACGAGGUCGAGUAGPNRD
ath-miRf11167-nprGAGAAGUGUAUGUGAGGACCUAGACPNRD
ath-miRf11170-nprACUCGACCAGGGGGUCGAGUAPNRD
ath-miRf11176-nprUCGACCUGGGGGUCGAGCGAPNRD
ath-miRf11177-nprUUACUCGACCCAGGGGUCGAGUAPNRD
ath-miRf11178-nprACUCGACCUGGGGGUCGAGUAGPNRD
ath-miRf11180-nprCACUCGACCCCCUGGUCGAGPNRD
ath-miRf11181-nprUACUCGACCAGGGGGUUGAGUGGPNRD
ath-miRf11182-nprACUCGACCUAGGGGUCGAGUAPNRD
ath-miRf11186-nprUCUACUCGACUUGGGGGUCGAGUGGUPNRD
ath-miRf11188-nprUCCAGUGUUGAUCGACACUAGPNRD
ath-miRf11189-nprUACUCGACCUGAGGGUCGAGUAGPNRD
ath-miRf11194-nprGUUUACUUACUCGUGGUGGGCPNRD
ath-miRf11195-nprAGAGAAACCCAACAGCAUCAUPNRD
ath-miRf11198-nprUCUUCUUCGAUCGGUUCUGAPNRD
ath-miRf11199-nprGUCUGGCACGAGGCCCUUAAPNRD
ath-miRf11200-nprCCUUGAAGAGUGUUGUUGCUPNRD
ath-miRf11203-nprCAAGCCCAAAAAACGUUUUGPNRD
aly-miR869*CACUUAUCUCAACCCUAGUGA--PMRD
ath-miR3434ACUUGGCUGAUUCUAUUAUUPMRD
ath-miR3434*UCAGAGUAUCAGCCAUGUGAPMRD
ath-miR3440b-5pUUUUCUUGGCCCAUCCACUUCPMRD
ath-miR3440b-3pUGGAUUGGUCAAGGGAAGCGUPMRD
ath-miR3932aAACUUUGUGAUGACAACGAAGPMRD
ath-miR3933AGAAGCAAAAUGACGACUCGGPMRD
ath-miR4221UUUUCCUCUGUUGAAUUCUUGCPMRD
ath-miR4227UCACUGGUACCAAUCAUUCCAPMRD
ath-miR4228AUAGCCUUGAACGCCGUCGUUPMRD
ath-miR4239UUUGUUAUUUUCGCAUGCUCCPMRD
ath-miR4240UGACUAGACCCGUAACAUUACPMRD
ath-miR4243UUGAAAUUGUAGAUUUCGUACPMRD
ath-miR5012UUUUACUGCUACUUGUGUUCCPMRD
ath-miR5013UUUGUGACAUCUAGGUGCUUUPMRD
ath-miR5014-5pACACUUAGUUUUGUACAACAUPMRD
ath-miR5014-3pUUGUACAAAUUUAAGUGUACGPMRD
ath-miR5015aUUGGUGUUAUGUGUAGUCUUCPMRD
ath-miR5015bUCUGUUGUUGUUGGUGUUAUGPMRD
ath-miR5016UUCUUGUGGAUUCCUUGGAAAPMRD
ath-miR5017UUAUACCAAAUUAAUAGCAAAPMRD
ath-miR5018UUAAAGCUCCACCAUGAGUCCAAUPMRD
ath-miR5019UGUUGGGAAAGAAAAACUCUUPMRD
ath-miR5020aUGGAAGAAGGUGAGACUUGCAPMRD
ath-miR5020bAUGGCAUGAAAGAAGGUGAGAPMRD
ath-miR5020cUGGCAUGGAAGAAGGUGAGACPMRD
ath-miR5021UGAGAAGAAGAAGAAGAAAAPMRD
ath-miR5022GUCAUGGGGUAUGAUCGAAUGPMRD
ath-miR5023AUUGGUAGUGGAUAAGGGGGCPMRD
ath-miR5024-5pAUGACAAGGCCAAGAUAUAACAPMRD
ath-miR5024-3pCCGUAUCUUGGCCUUGUCAUUPMRD
ath-miR5025ACUGUAUAUAUGUAAGUGACAPMRD
ath-miR5026ACUCAUAAGAUCGUGACACGUPMRD
ath-miR5027ACCGGUUGGAACUUGCCUUAAPMRD
ath-miR5028AAUUGGGUUUAUGCUAGAGUUPMRD
ath-miR5029AAUGAGAGAGAACACUGCAAAPMRD
ath-miR5628GAAAUAGCGAAGAUAUGAUUAPMRD
ath-miR5629UUAGGGUAGUUAACGGAAGUUAPMRD
ath-miR5630aGCUAAGAGCGGUUCUGAUGGAPMRD
ath-miR5631UGGCAGGAAAGACAUAAUUUUPMRD
ath-miR5632UUGGAUUUAUAGUUGGAUAAGPMRD
ath-miR5633UAUGAUCAUCAGAAAACAGUGPMRD
ath-miR5634AGGGACUUUGUGAAUUUAGGGPMRD
ath-miR5635aUGUUAAGGAGUGUUAACGGUGPMRD
ath-miR5636CGUAGUUGCAGAGCUUGACGGPMRD
ath-miR5637AAUGCGCAACUCUAUAUUUCCPMRD
ath-miR5638aAUACCAAAACUCUCUCACUUUPMRD
ath-miR5638bACAGUGGUCAUCUGGUGGGCUPMRD
ath-miR5639UAGUCCACUGUGGUCUAAGGCPMRD
ath-miR5640UGAGAGAAGGAAUUAGAUUCAPMRD
ath-miR5641UGGAAGAAGAUGAUAGAAUUAPMRD
ath-miR5642aUCUCGCGCUUGUACGGCUUUPMRD
ath-miR5643aAGGCUUUUAAGAUCUGGUUGCPMRD
ath-miR5644GUGGGUUGCGGAUAACGGUAPMRD
ath-miR5645aAUUUGAGUCAUGUCGUUAAGPMRD
ath-miR5645cAACCUAUUUAACGACAUGACUPMRD
ath-miR5646GUUCGAGGCACGUUGGGAGGPMRD
ath-miR5647UCAAGUUUGAUGACGAUUCCAPMRD
ath-miR5648-5pUUUGGAAAUAUUUGGCUUGACUPMRD
ath-miR5648-3pAUCUGAAGAAAAUAGCGGCAUPMRD
ath-miR5649aAUUGAAUAUGUUGGUUACUAUPMRD
ath-miR5650UUGUUUUGGAUCUUAGAUACAPMRD
ath-miR5651UUGUGCGGUUCAAAUAGUAACPMRD
ath-miR5652UUGAAUGUGAAUGAAUCGGGCPMRD
ath-miR5653UGGGUUGAGUUGAGUUGAGUUGGCPMRD
ath-miR5654AUAAAUCCCAACAUCUUCCAPMRD
ath-miR5655AAGUAGACACAUAAGAAGGAGPMRD
ath-miR5656ACUGAAGUAGAGAUUGGGUUUPMRD
ath-miR5657UGGACAAGGUUAGAUUUGGUGPMRD
ath-miR5658AUGAUGAUGAUGAUGAUGAAAPMRD
ath-miR5659CGAUGAAGGUCUUUGGAACGGUAPMRD
ath-miR5660CAGGUGGUUAGUGCAAUGGAAPMRD
ath-miR5661AGAGGUACAUCAUGUAGUCUGPMRD
ath-miR5662AGAGGUGACCAUUGGAGAUGPMRD
ath-miR5663AGCUAAGGAUUUGCAUUCUCAPMRD
ath-miR5664AUAGUCAAUUUUAUCGGUCUGPMRD
ath-miR5665UUGGUGGACAAGAUCUGGGAUPMRD
ath-miR5666AUGGGACAUCGAGCAUUUAAUPMRD